Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6881177.3                       7 PI      82       1609     2132                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012768003 Xl3.1-IMAGE:6954869.5 - 122 ESTs
                                                                       ....-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6954869.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTTGGGACGGATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTTGTGTGTGTATGTGTGTTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAA
                                                  Xl3.1-CHK-1012685450                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGxxGxATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTTGTGTGTGTATGTGTGTTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                3     8     5    11    15    25    19    31    20    34    22    35    25    37    27    37    27    38    27    38    34    38    39    39    39    39    42    42    42    42    42    42    40    42    42    42    43    44    32    44    41    44    41    44    43    46    45    46    46    47    46    48    47    48    48    48    46    49    44    49    48    49    48    49    48    49    47    50    47    50    47    50    48    50    48    50    47    50    47    50    48    50    46    50    47    50    45    51    47    51    45    50    34    50    33    50    44    49    45    48    40    48    39    46    39    44    39    44    37    43    34    43    32    41    32    40    28    38    28    37    27    36    23    35    19    33    16    33    18    31    17    31    18    30    16    28    15    27    16    27    16    26    15    26    14    25    14    25    16    25    16    23    16    21    17    22    15    19    14    18    14    18    13    16    10    14    11    15    11    16    10    15    11    16    12    16    13    17    13    17    12    16    14    18    14    18    14    18    14    18    14    17    14    17    14    17    14    19    13    18    15    18    15    18    16    20    18    20    18    20    16    19    10    19    10    19    10    18    10    18    10    17    10    19    10    20    10    20     9    21     9    20     9    19     9    19     9    20     9    22     8    22    10    23    10    23    11    25    12    27    12    28    12    28    12    28    13    30    13    30    14    30    14    30    16    32    18    35    28    37    28    39    26    41    23    41    28    41    30    41    30    41    33    41    35    42    38    43    37    42    38    43    39    44    40    45    40    45    42    47    42    47    41    46    42    46    42    46    43    47    45    49    41    49    42    49    44    50    43    50    43    50    46    50    47    50    46    49    44    49    45    49    44    49    48    51    47    49    47    49    45    47    45    47    45    47    44    46    45    46    45    46    42    45    38    44    43    44    40    44    38    44    37    43    31    43    26    42    24    41    24    39    18    37    16    34     9    27     6    15     5    13
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGAGACGCGCTATTGACGTCACGTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGAGTAAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGCAGTGTAAATTAGTATTTCCCTGCAAGCATTTCTAGCAAAGGAGGATAAGTCAGAGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGACTTTCAGTGAGGCTCAATGTGATGTTTTGTAGTAGAGAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --TC--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------CC--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --T-----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A--C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----T-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----TG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------A--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------T-G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----A-----C
                                               BLH ATG     150    2708                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MIN     150     317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH MPR      75     317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               BLH OVR     150      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               CDS MIN     150     317                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               EST CLI      10      26                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
                                               ORF LNG     150       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           
  5   1   2       chi Emb4                            IMAGE:5543165.5p ACTGATTCATTTTGAAACAtttttttttCCCATGACAGTATCCCTTTATAGAAGGGGAACAACTCCGGGTATCCGCTAAATAGAGTGCAAATATGCCAGCAAAAAAGAGCTGCTAGTTGTCTGTCTGATAGAAACCATCACAAACAGACAGTTTTATATTATACTGTTATATTGGCACAGTTCTCTATCTCAAGGCCCCCATACAAGGGCTGATAAAAGCTGCCGACAGACCCTGTAGCTGTCAGCACTTTGGACTAGGGGTGCCAGCCAATCAGCAGTTAGACTGCAGTTCCCCGTCAGGTTCTTCTATGTGCCCGTCTCTTAACTGTGCTTCTGGCCAGGACTATTCAGACTCACCGACCATTCATTGAAACACTAACAGGAACCATAGCGGATCTATGTGGTGCAACAATAAAGGGGCCATAGTCATAGATACTCATTTTAAGCCTAAGTGGAACAGGCAAGATCTAGCTATTCCAAATATCATACGGAAATTAATTTTGTACAGTATTATCTGTGCGTCTATTTCCACCTTAAAGTTTATGCTGTTGTATAGCAGTATGTACGCATAAAACCGATTGTTGGATATACATTATAAAAGCAAAACTAAAAATATCACTGAACGGTCTCTGGGCAATTCACTAGTAATTTTTTAATAGTGTTTTCCTTTTCCCCATCAGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCCAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAAGATTCTTGTAAAAGGAGAGTAATGTTGCAACGGGGTGGACTCGCCCTGTTTACGGTTTGGGGGTGGATAATCCATGGGGCAT
  5   1   2       bld Oo1  5g                         IMAGE:5084261.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCCGGGATCGCCGGGTGCAGCAGCTATTGGGCGGGACTGGGAGCGGGCACGCGCAGGAATTGTTGGGACGGTCGGAGACGCGCTATTGACGTCACGTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGAAGGCAAGATCTTTTTGTGTACATGGAGGGGGCTCTCACCCCTCCATCCCAGACACCTGGGATCCAGATTCCAGAACTTATTTGGATCCGCCCAGCGCAAAGAAAGTGGCCCTTCCATGGCATAGCGACCCCACCTGGTGGTTGAAACCCTGGACTCCTTGGGAAAGATGAACCCCCGCGGACAAGAAATCCCTAAACCCGGGGAAATGTggggggggatggggtgggAAAATCCCCCCCTAAAGGGG
  5   1   2       bld Oo1  5g                         IMAGE:6861141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCTTGGTANNCCGGTCCGGAATTCTTCGGGATTCGGAGACGCGTAATTGACGTCTCTCTCTCGCGGTATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGGATCAGATCAGACCTATTGAATCGCAAGCCAAGAGTTGCCCTCATGATGGTACCCATGGTGTGAACCTGCTTCTGGGAGTGGCCCCCNAAAGATACTTCCCGGGATGGGGGTGTGGAGTCCCTAGGGGAAGCCTTGCCTACCCTTTTTTTGGCATTGAAAGTAAATTGGCCCCCAATTCAATGGCCAGCCTAACAACAATAGAATTTGGATTTTTGCCGGGGCACAATTCAACTTTGCTCTTGGGAAAG
  5   1   2       bld Oo1  5x                         IMAGE:6642539.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGATCGGAGACGCGTAATTGACGTCACGTTCTCGCGGTATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTTATCGAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATNNCGCAGCAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCANAAGATACTACAGGGATGGGGTTGTGAGTCCCTGGGGGAGCTGGCTACCTTTTTTTGGCAGTGATGTANTTGGGCCCAATTCAATTGCAGCCCAACAACCTTAAATTATGATTTTGACGGGGCACAATCCAACCTGGGCCCTGGGAAAGGTTTATAAATTGGC
  5   1   2       bld Ga15 5g                            XL511c24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCACGCGCAGGAATTGTTGGGACGGTCGGAGACGCGCTATTGACGTCACGTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACNANAGCCGACAAATCNCACAAGTTTATGGTTTCTACGACGAGTGTCTTCNCAAATACGGCTCANTCACANTGTGGCGCTACTGCACANANATCTTTGACTACCTCANTCTGTCNGCTATCATC
  5   1   2       bld Oo1  5g                IMAGE:6642732-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTAGACGTCACGTTCTCGCGGTATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGAC
  5   1   2       bld Emb1 5g                         IMAGE:5155358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCGCAGGAATTGTTGGGACGGTCGGAGACGCGCTATTGACGTCACGTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACGGGGAATGGGGGTGTGAGTCCCTAAGGGGAGGCTGGCTACCCTTTTTTGGGT
  5   1   2       bld Brn1 5g3  in                    IMAGE:6949909.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGGAATTCTTGGGATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCNTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCCGCTCTGGAGTGACCCATAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCCTACCTTTTTGGCGTGATGTAGTGGCACCATTTCATGCAGCCCACAACATAGATATGATTTGCCGGGCACATCAACTTTGTCTGGAAAGGTTATAAATGGGCACTTCAAGGA
  5   1   2       bld Ga15 5g                            XL462m14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCGCGGTATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACNACGAGTGTCTTCNCAAATACGGCTCANTAACAGTGTGGAGGTACTGCACANANATCTTTGACTACCTCANCCTGTCANCTATCATCNATGGCAANATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCNNACNCTGGATCA
  5   1   2       bld Tbd7 5g3  in                         XL060m01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCGGTATCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAANAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGCCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCA
  5   1   2       bld Emb1 5g                         IMAGE:6637055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTCCGAGACGCGCTATTGACGTCACGTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCCAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACGGGATGGGGGGGTGAGTTCCTAGGGGGAGCTGGCTACCTTTTTTGGCATTGATGTAGTGGCACCATTCAATGCAACCAACAACATAGAATATGATTTGCCGGGGCCATTAGCCTTGTCCATGGAAAGGATCCAAGGGGCCCTTTCAATGGAAACGGCCCTTAACTGGTGGGGTCCACC
  5   1   2       bld Ga15 5g3  in                       XL503b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACAAACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCANTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCANCCTGTCANCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGACTCTCACCCTCCATCCANACACTGGATCANATCANAACTATTGATCGCAANCAANAANTGCCTCATGATGGACCCATGTGTGACCTGCTCTGG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4959785.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACAAACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTAC
  5   1   2       bld Em10 5g                         IMAGE:8322206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATG
  5   1   2       bld Int2 5g                         IMAGE:8527931.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACACTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTTGATCGCAGCAGAAGTGCTCATGATGGACCATGTGTGACTGCTCTGAGTGACCAGAAGATCTACGGATGGGTGTGATCTAGGGAGCTGCTACTTTGCATGAGATTGCCAATCATGCGCACACTAAATATTGCGGCCTCACTGTCTGAGTTATGCCTCAGAA
  5   1   2       bld Emb4 5g                         IMAGE:4679779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TATCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCT
  5   1   2       bld Brn1 5g                         IMAGE:6954869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACAGGGATGGGGGTGGTGAGTCCCTAGGGGGAAGCTGGGGCTACCTTTTTTGGGGCAGTGATGNTAGTGGGCCCCAATTCCAATGGCAGCCCNNAACAACATTAGATATGGATTTTGGCCCGG
  5   1   2       bld Eye1 5g                         IMAGE:6946010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTNGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCAGGTGTGACCCGCTCTGGGATGACCCAAAAGATTCCACAGGATGGGGTGTGAGTCCCAAGGGGACCTGGCTACCCTTTTTGGCAGTGATGTAGTGGCCCCATTTCATGCACCCCAACAACTAGATATGAATTTGGCCGGGGACCTCAAACTGGTCCGGGGAGGGTTAT
  5   1   2       bld Emb4 5g                         IMAGE:4970583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAGATACTACNGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTGGCAGTGATGTAGTGGCACA
  5   1   2       bld Ga15 5g3  in                       XL504k20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACAAACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGACTCTCACCCTCCATCCAGACACTGGATCANATCANAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGGACCCATGTGTGACCTGCTCTGGAGTGAC
  5   1   2       chi FaB                             IMAGE:8072315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGNACCAGNGATACTACGGGATGGGTGTGAGTCTTAGGGAGCGGCTACCTTTTGCAATGTGTATG
  5   1   2       bld Kid  5g                         IMAGE:7011789.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGCTCTCGCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTG
  5   1   2       bld Ga18 5g3  in                        xlk6j23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTCGCTGTGTGGAGAGGAGGAAGNGGAGGTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGNNNNGNNTACAGGCTCATTGAGGAGGGANCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTANNNNNNGAGNNANTCTTGTAGAAGAGAGNAATGTGCAACGGGNGGACTCGCCTGTTACGGNTTGTGGNGATATCCATGGGCAGNTCTACGATCTCAAGNNANTNTTCAGGGTGGGNGGNGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGNTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGNTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGNGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATNGCAAGATCTTTTGTGTACATGGTGGGCTC
  5   1   2       bld DMZ  5g3  in                         xl228d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGTGTTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGG
  5   1   2       bld DMZ  5g3  in                         xl244g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGTGTGGAGAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCANAAGATACTACGGGA
  5   1   2       bld Oo1  5g                         IMAGE:6638726.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCATGAGGAGGAAGCGGAGGCTCCTGGTGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCCGAAGATCTACANGATGGGGGTGGGGAATCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTANTGGCCCAATTTCAATGCAGCCAACAACATAGATATGATTTGCCGGGGCACATCACCTTGGTCATGGGAAAGGTTATAAGGGGGCACCTTCCAATGAGACTGCCCTTTAACAGGTGGGGGTCC
  5   1   2       add Ga18      in                        xlk5d21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTGGAGAGGAGGAAGNNGACNNCCTGGGGGANATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGGNANNNTTNCAGGNTCATTGAGGAGGGANCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGNGAAAGCTCTGTGTGCTAAAGCANGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGNGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGNTGAAACATTCCTCCTTCTTTTAGCACTGAAGGNTCGNTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGNTTCTACGACGAGNGTCTTCGCNAATACGGNTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGNAAGATCTTTTGTGTACATGGNGGGCTCTCACCCTNCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCNAGAAGNNNCNCATGATGNACCCATGTGTGACCTGCTCTGGAGNGANCNAGAAGATACTACGGGATGGGGNNTGAGTCCTAGGGGAGC
  5   1   2       bld Neu7 5g3  in                         XL031f02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGGAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTT
  5   1   2       bld Thy  5g                         IMAGE:8550115.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAANNNCCTAATGNNNTGAGTGCATCGATCGATTCGTCCGGAGCGGGAGGCTCCGGGGGGAGATCGCTACCACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCTCCAGACACTGGATCGATCAGAACTATTGATCGCAGCAGAAGTGCCTCTGATGACCATGTGTGACTGCTCTGAGTGACCGAGATCTCGGATGGGTGGATCTAGGGACTGTACTTTNGCATGTGATGCCATCATGACACACTAATGATGCGGCCTCCTGCTGAGATCATGCTCAGACGCTATGTGTCCCATATGTCGGGAGATCTCTGCGAACTACAACTATGAGGCAGAAGACTAACTCTTCGA
  5   1   2       bld Tbd1 5g                              AW872044.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTCTCGCGGTGTCTCGCTCTCGCTGTGTGGAGAGGAGGAAGCGGGAGGCTCCGGGGGGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGGGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTNTGTGGATCGGGGGTTNTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAA
  5   1   2       bld FaB  5g3  in                    IMAGE:8069972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACG
  5   1   2       chi Emb3      in                    IMAGE:3400667.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAGCGGAGGCTCCTGGGGGAGATACCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCANGGTGGGTGGTGATGTGCCACAGACAAAATATCTCTTCATGGTTGACTATATCGATCATGAGTTATAACGTGTTGATACATTGCGTTATCTATTGAGCTCGGTGGTAGATTAC
  5   1   2       chi Int2                            IMAGE:8528245.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCATAGTGTGNNNGGAGATCAACAATTCGATTCGTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCATGAGAGCCGGCTAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAATAACGGTGTGGATGTACTGCACAGAGATCTTTGACTACCTTGGCCTGTCAGCTATCTTCGATGGTTAGATCTTTTGTGTACATGATGTGCTATCACCCTCATTTCATACGCTTGATTTAATCTCAACTATTGTTCGCAGTGTAGAAGTGCTCCTTGATGTTACCTTGTGTGACTTGCTTGTGGTGACCCTATTAACCTATAGGATGGGGTGAGATACTTATGGAAATGGATTATATATTGAAA
  5   1   2       bld Oo1  5g                         IMAGE:6861776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCTGGACCGGTCCGGATTCTCGGGATCACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGAAGGGGTGTGAGTCCTAGGGGAACTTGGCTACCTTTTTTGGCAGTGATGTAGTGGCCCAATTCAATGGCACCCAACACCTAGATATGAATTTGCGGGCACATCAACTTGTCATGGGAAGTTATAAAGTGGGCCTTCAATGGAGACTGGTCCTTAACAGTGGTGGGTCCGGCACACAAATACTGGCTAACAGGTGTTGGAGAAAGGTAAT
  5   1   2       bld Tbd7 5g3  in                         XL060b18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGATACCGACACACACCGCTCCCCGGGNACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCT
  5   1   2       bld Tbd7 5g3  in                         XL057h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATACCGACACACACCGCTCNCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTNTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTA
  5   1   2       bld Tbd7 5g3  in                         XL098f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCGACACACACCGCTCCCCGGGACCCACATCCGGTGAGAGAGTCCGGCCTGTGGCGGAAGCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTG
  5   1   2       bld Egg4 5g                         IMAGE:3744001.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAGATCGCTACACACACCGCTCCCCGGATCCGTTACAGGCTCATTGAGGAGGGACCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCNGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTTCATTCAGACACTGCATCAGATCAGA
  5   1   2       bld Ga18 5g                           xlk162l24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCTCATTGAGGAGGGANCATGACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGANGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCTAAAGCACGAGAGANTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGNTCTACGATCTCNAGGAANTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGNTCGNTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGNTTATGGNTTCTACGACGAGTGTCTNCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAG
  5   1   2       bld Bla1                            IMAGE:3381524.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACTGAAATCAGTGATCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTGCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACACTGCATCCATACACTGGATCAGATCAGATCTATCGATCGG
  5   1   2       bld Egg6      in                    IMAGE:4434880.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GACTGAAATCAGTGACCTCGACAGGCAGATTGAACAGCTGAGACGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCCAAAGCACGAGAGATTCTTGTAGAAGAGAGTAATGTGCAACGGGTGGACTCGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGAGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTCTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTCTGTGTACATGGTGGACTCTCACCCTCCCATCAGACACTGGAT
  5   1   2       bld Lmb1                            IMAGE:8535520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGAAATCAGTGACCTCGACAGGCAGATTGAGCAGCTGAGGCGCTGTGAGCTCATCAAGGAGAGTGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACATTTCATGCAGCCNACACATAGATATGATTTGCCGGCACATCAGCTGTCATGGAAGATACAGTGCACTTCATGAGAGGTCTTACTGTGTGTCGCACAACTCTGCTCAGTGTGGATGACTGCTACTGACTGATGAACTACGAAGATCATATATGAGTGCCCAGAACAAG
  5   1   2       bld DMZ                                  xl302e06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGAGAGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAGCTTGTCATGGAAGGATACAAGTGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAANCTACTGCTACAGGT
  5   1   2       bld DMZ                                  xl302i02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAGAGAGAAGTGAAAGCTCTGTGTGCGAAAGCTCGAGAGATTCTCGTAGAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACAGGATGGGGTGTGAGTCCTANGGGAGCTGGCTACCTTTTTGGCAGTGATGT
  5   1   2       bld DMZ                                  xl295h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAGCTTGTCATGGAAGGATACAAGTGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACAC
  5   1   2       bld DMZ                                  xl317o22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGAGTAACGTGCAACGGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAGCTTGTCATGGAAGGATACAAGTGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAAACTACTGCTACAGGTGT
  5   1   2       bld Emb4                   IMAGE:5537526-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGTGGACTCTCCTGTTACGGTTTGCGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAGTTGTTCAGGGTGGGTGGTGATGTGCCCGAGACAAATTACCTTTTCATGGGCGACTTTGTGGATCGGGGGTTTTACAGCGTCGAAACATTCCTCCTTCTCCTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAGCTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAAC
  5   1   2       bld Ov1                             IMAGE:8329772.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCTGTTACGGTTTGTGGTGATATCCATGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGGTGTGAGTCCTANGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACANGTGTGGGAATGTAGCTGCCCTACTTGAGCTGGATGAACACCTACAAAAGAAA
  5   1   2       bld Te1                             IMAGE:6928229.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGCAGTTCTACGATCTCAAGGAATTGTTCAGGGTGGGTGGTGATGTGCCAGAGACAAATTACCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGACTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACCGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTTGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTTGCCGGGCACATCAACTTTGTCGTGGAAAGGTTATAAGTGGGCACTTTCAATGGAGACGGGTCTTTTAACAGTGTGGGGTCCAGCACCCAAACTTACTGGCTACAAGGTGTGGGGAAAATGGTAACTCGGCCACTTACTTTTGAAGCCTGTGGATGGAAACACCCTCACCAAAAAAGAGAATTCCATTTAAAATATTTGAGAGGGTTGCGccccccccccGGGGAAACCCAAAGGAAGGGAAAATTCTCCCTTTTCCCACAAGAAAAGAccccccccTTCCCGCCTTTGAA
  5   1   2       bld Thy                             IMAGE:8547191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGAGACCTACATCNATTCGTCCCGTGGTGATGTGCCAGAGACAAATTATCTTTTCATGGGTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACC
  5   1   2       chi Emb1                            IMAGE:5155616.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGACTTTGTGGATCGTGGGTTTTACAGCGTTGAAACATTCCTCCTTCTTTTAGCACTGAAGTTCGTTATCCAGATCGGATCACCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACAGTGTGGAGGTACTGCACAGAGATCTTTGACTACCTCAGCCTGTCAGCTATCATCGATGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTAAAGAGAATTCCCACTTGCACAGTATGAGGCATCTGTATGTCCTGTAGTTTGACTCTGTCTTGTCTTTAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCCGGAGACAAGAGGAATCCCTTTCCAAGAAACCCGGCGCTGATTACTTCCTGTGACCTGCCCAATCAAAACCCAGGCCCTCTCCACTCCTTTCTCCTGGATGCCTTTTAGACTGCTCCCCCAGACAACTCTCCTCCCTTATCTCTGCCCAATGGGAACCAGGG
  5   1   2       bld DMZ                                  xl324e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGCACTGAAGGTTCGTTATCCAGATCGGATCACCCTGATACGTGGCAACCACGAGAGCCGACAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTCACAGTGTGGCGCTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCGGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAGCTTGTCATGGAAGGATACAAGTGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAGAAAGAATTCATTATATTTGAGGCTGCCCCCCAGG
  5   1   2       bld Spl       in                    IMAGE:8463805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNAGATCCATGATAGAATTCGTCCCCCCTGATACGCGGCAACCACGAGAGCCGGCAAATCACACAAGTTTATGGTTTCTACGACGAGTGTCTTCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCCCAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACTGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAGAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTACTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCACTGCTCTTTTGAGA
  5   1   2       bld Oo1                             IMAGE:5079297.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGGTAAACCGGTCCGGAATTCTCCGGGATCGCAAATACGGCTCAGTAACCGTATGGAGGTACTGCACAGAGATCTTTGACTACCTCAGTCTGTCGGCTATCATCGACGGCAAGATCTTTTGTGTACATGGTGGGCTCTCACCCTCCATCCAGACACTGGATCAGATCAGAACTATTGATCGCAAGCAAGAAGTGCCTCATGATGGACCCATGTGTGACCTGCTCTGGAGTGACCCAGAAGATACTACAGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCCCAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACTGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAGAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTACTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCACTGCTCTTTTGAGAAAAGGATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCCCCTTATATGGAACCTTTTTGTGTATGTGTGTTAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCCCTGCAGGTATTTCTAGCAAAC
  5   1   2       bld Tbd7                                 XL110a14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGACCTGCTCCTGGAAATGACCCAGNAANATACTACGGGTATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAAC
  5   1   2       bld Tbd7      in                         XL059o04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGNAAGNAACTACGGGNATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAG
  5   1   2       bld Tbd7      in                         XL071h14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAGATCTACGGGATGGGGTGTGAGTCCTAGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTT
  5   1   2       bld Emb4                            IMAGE:4970705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACGCGTGGGGAGCTGGCTACCTTTTTGGCAGTGATGTAGTGGCACAATTCAATGCAGCCAACAACATAGATATGATTTGCCGGGCACATCAACTTGTCATGGAAGGTTATAAGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTACTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCCTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTTCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGTGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGG
  5   1   2       bld Tbd7                                 XL075i18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGTGGAAGGATACAAGCNGGCACTTCAATGAGACGGTCTTAACTGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAGAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTTGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCTCCTTTGAGAAAATGATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAGCCTTGTGTGTATGTGAGTAAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCC
  5   1   2       bld Tbd5      in                    IMAGE:3581325.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGTGGCACTTCAATGAGACGGTCTTAACAGTGTGGTCAGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAGGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATACCATTGCCCTGCAAGCTTTCTAGCACCGAAG
  5   1   2       bld Te2                             IMAGE:7394207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCACCAAACTACTGCTACAGGTGTGGGAATGTAGCTGCCATACTTGAGCTGGATGAACACCTACAAAAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccTGATCACAGTCATCCNTTATGTCTCTCCACTCTGAGCTCACATCCCTGTACTAGCTGCTGAATGTACCAGTATGAGTGCCTAGTGTAGTGGACTATCCACTGGACAGAGAACTGTGAGAGTGCCACTGAATCATGTC
  5   1   2       bld Ga18                               xlk52g18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAAGAATTCATTATATTTGAGGCTGCCCCCCAGGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTACTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTNNNNNTTAAGAAAAGTATTTTCCAGCATCCAGCTCAGCTGCAGNNNNTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCTGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGTGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccTGANTCACAGNCATTCCTTATGTCTCTCCCANTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTA
  3   1   2       chi Tad1                            IMAGE:6879295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGTTGCAAAGATTCAACACTATACTTCTTCCTCTTCAGGTGCGGCCGTGGCAATGACTCCTATGATATCATCAGTATCGAACAGATAATATGCTATCCTCATAGGCGCTACTGTCGTNGGTGTCTGTCGCGCGTACCTCTGATGTCGGTCGCAGTGGGATTGGCGCGTCGACGGTGTGTGAAGCACAGTGGAGGAGGTCGGAGAAGATGTGCGGGAGGGATTGGCTAGNGGGTAGAGGGCTGAGTCAATTTCCTATTCCCTCCTCATAATTTGTGCGTGCCCGCTGCCCTGTGTATCACTCCAANCTGAACGTCAAGCTCTGAGTNAACACATCATAGAATAATGTAAATCATCGTCTCGCAGCGCTGATTTGNCTTACAATAAACTCCCTCCCAGTTAGTGGCTCCTCCGCATCCGCATGCTGGTGCATGTGGCCAACTAAGACTATGGCGATTTACATTTCCCCCAGAACCCCGAGTTGTCTCTATGTTCTTCTAGATGACATTCCTCAGACATATTGAGTTTTTATTCTCTCCCGTGGGTACCACGTTGATAAGCAAAAACTTCCTGTTGGGAATATAAACCCCCCCCCGCCCCGGTGATTTACACCCAGTTCCATCTCCATTATATGTCTTTTCCCCACTTATGAGGCCCTTCACCATCCCCGCTGTATTAAAGCCCGCGAAGATTGTACACCAAGTATGGGAGTGCCTTAGTGTAAGTGGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTCTTCTGTTTTTTTTTTGTCAATCTAATTTTACAATTTGCCCCTTTTTGAAAACAANTCCCCGCTATACTGAAAAGGGGGGGGAGCGTGTTTAAATTAACTTGTGGGAACC
  5   1   2       bld Bone      in                    IMAGE:8740779.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAGTTTTTGGAGATCACATCGAATTCAAATTCGTCCCCTTCCAAGAAGCCCGTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGAGAGACATGTGAAGAATGGTGCGCACTGAAACTCCAATGTCCATTTAAAGCTCCATGATGATAATTGCCCCTTGTGATGATGCAGATTCGAGCTATTGTGACTACTTGCAATTACATAGCGGAGCATTCTTGGATACAGCTTGCGAAGCTGGAAATTGGTAGCCAGGTGTTTTAACCCTTAGTTGATGCG
  5   1   2       bld Tad1      out                   IMAGE:6881177.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAGACAAGAGGAATCCCTTCCAAGAAGCCCGTCGCTGATTACTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCTCCTTTGAGAAAATGATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAGCCTTGTGTGTATGTGAGTAAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGCAGTGTAAATTAGTATTTCCCTGCAAGCATTTCTAGCAAAGGAGGATAAGTCAGAGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGACTTTCAGTGAGGCTCAATGTGATGTTTTGTAGTAGAGACAGAGGGAGGGGGCTAAATAGAGCAGCATTATGCAAAGAAACCAAAATACTTTTAGGATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccccTGAATCACAGTCATTCCTTATGTCTCTCCCATTCTGAAGCCTCATCCCCCTGTACTAAACTGCTGAGATTATACACCAGTATGGAAGTGCCCTTAATGCCAGGTGGGGACTAATTCCAGCTGGGGACCAGGGAGAGAACTGTTGAAAGAAGGGGGCGCCACTGGAAAAACGCCCTTGGTTCCACTTTAGAAAGT
  5   1   2       bld DMZ                                  xl339p19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTCGCTGATTATTTCCTGTGACCTGCCCAATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTANACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAGAGAANGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTANGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAG
  5   1   2       bld DMZ                                  xl298f04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCTCCTTTGAGAAAATGATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAGCCTTGTGTGTATGTGAGTAAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGCAGTGTAAATTAGTATTTCCCTGCAAGCATTTCTAGCAAAGGAGGATAAGTCAGAGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGACTTTCAGTGAGGCTCATTGTGATGTTTTGTAGTAGAGACAGAGGGAGGGGGCTAAATAGAGCAGCATTATGCAAGGAAACCAAAATACTTTTAGGATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccccccNAAT
  5   1   2       bld DMZ                                  xl297f04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAACACCAAGGCCTCTCCACTCCTTTCTCCTGATGTCTTTTAGACTGCTCCCAGCACAACTCTCCTCCTTATCTCTGCCAATGGGACCAGCGCTGCTCCTTTGAGAAAATGATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAGCCTTGTGTGTATGTGAGTAAGGTACTGGCAGCTGAGAGATCTGCTATTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGCAGTGTAAATTAGTATTTCCCTGCAAGCATTTCTAGCAAAGGAGGATAAGTCAGAGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGACTTTCAGTGAGGCTCATTGTGATGTTTTGTAGTAGAGACAGAGGGAGGGGGCTAAATAGAGCAGCATTATGCAAGGAAACCAAAATACTTTTAGGATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccccccccAAT
  5   1   2       bld Tbd3                            IMAGE:3548972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAAGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCTCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCC
  5   1   2       bld Bone      in                    IMAGE:8740086.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGCGCTGCGCTTTTAAGAAAAGTATTTGCCAGCATCCAGCTCAGCTGCAGAGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCAATTGTCCATTTAGAGGCTCCATGATGATTATATTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATATGTGACTAGCTGCATTTAACATAGCCGGAAGCCATTTCTCTTGTGGATTTAAACAGCTTGGCTGGAGGCTGGAATATTGTTAGCATGTGTTCACCATTGGTATCCGCCTCTAAGCTGCCAAGCTGGAAGATAACTAGAGCGCCTCTCTATTTGTTCACCCGATGCTAACGTGACTCAATGGCCACATAAGTATGCAACTC
  5   1   2       bld Ga15      in                       XL418i18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AGCATTGCCTCTACTTTTCTACATCCACCTTATATGGAACCTtgtgtgtgtatgtgtgtTAGGTACTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCTGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGTGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCA
  5   1   2       add Egg1                               PBX0105G05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTCGCACGAGGCTTTTCTACATCCACCTTATATGGAACCTTGTGTGTGTATGTGAGATACGTACTGTTAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCATGTATTTCTATCAAAGA
  5   1   2       bld Skin      in                    IMAGE:8640260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAANTNCCACGTNNNNNGNAGAACATAAATAAAAATCGTCCCCTGGCAGCTGAGAGATCTGCCGTTGTGCATATAGAATGGCCGTACCATCCACACCTTGTAAGAGGGGTGTGAAATAGCATTGCCCTGCAAGTATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCGTTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAGCTGCCACTGAGAGATACTAAAGCGCGCTTCTCTATTGTGTTTCACGGATGCATAAGCTGACTCTACTGCACTAGTAGCAAACACGATCAGTTCTCTCTTACTCTCACAACTAGTAAGTCATTCTTCTTACCTGCTCAATCAGCTTTCGATCTT
  3   1   2       bld Brn1 5g3  in                    IMAGE:6949909.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCCTTTAAAGAAGGGGTGGGAAAATAGGCATTGCCCTTGCAAGTATTTTCTAGCAAAGAAGGAAGAGATGGGGAGAAACCACTTGTAGCCAAAGCTGGGTGCTGCGTTTCCAGGAATTAGGTAAAGGAAATGCTCTGCACGATTTTCAGGGAGGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTNTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAG
  5   1   2       bld Ga18                                xlk3e18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCACACCTTGTAAGAGGGGTGNAGTGTAAATTAGTATTTCCCTGCAAGCATTTCTAGCAAAGGAGGATAAGTCAGAGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGACTTTCAGTGAGGCTCAATGTGATGTTTTGTAGTAGAGACAGAGGGAGGGGGCTAAATAGAGCAGCATTATGCAAGGAAACCAAAATACTTTTAGGATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccccccTGANT
  3   1   2       bld Bone      in                    IMAGE:8740086.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACGTGCGGTTCATCCCAACCCTGTAAGGGGTTGGAATAGCATGCTGCAGGTATTTCTAAGCAAGAAGAGAGATGGAGAAACACCTGTTAGCAGCTTGGTGCTGCGTTTCAGGAATTAGTTAAATGTAATGCTCTTGCAGACTTTCAGGGAGGCTCAATGTTGATGTTTTCTAGTAGAGACAGAGGGAGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTAGAATCATAGTTCTTCTTGATTTTATAAAACTCCTCTAATAACCCCCCCCTGATTCACAGTCATTCTTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTCTTCTGTTTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTCCCAGTCCCACGCGAATAACACAGGACCCGAACAACTCC
  3   1   2       bld Bone      in                    IMAGE:8740779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGCATTGCCCTGCAGTATTTTCTAGCAAAGAAGAGAGATGGAGAAAACACTGTAGCAGCTGGTGCTGCGTTTCAGGATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTTGATTTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCCGCCACCACCCAACAACACTAGCACTCCCGATTCGACC
  5   1   2       bld Te2N                            IMAGE:7205497.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATTTCTAGCAAAGAAGGAGAGATGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCCAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTTCTTCTTTAGCCCTTGCTCCCAAACTCCAAGTCTTTGTTCTGCACTTCTTTCTGGGTAACGATTTTTCCTTCGGttttttttttttttttCCTTCCAAATTTTTAA
  5   1   2       bld Egg1                               PBX0084A01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACGAGGGGGAGAAACACCTGTAGCCAAGCTGGGTGCTGCGTCTCAGGAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGATAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccccTGATTCACAGTCATTCCTTGTGTCTCTCCCATTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTATATACAAGTATGGAGTGCCTTAGTGCAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTTTGTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAAGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGT
  5   1   2       bld Gas6                            IMAGE:3438062.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAACACCTGTAGCCAAGCTGAATGCTGTGTCTCAGGAATTAGTAAATGTAATGCTCTGCACGATTTTCAGTGAGGCTCAATGTGATGTTTTGTAGTAGAGACAGAGGGAGGGGGCTAAATAGAGCAGCATTATGCAAGGAAACCAAAATACTTTTAGGATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCATTCTGAGCCTCATCCCCTGTACTAAGCTGCTGAGATTATACACAAGTATGGAGTGCCTTAGTGCAAGTGGGACTATTCCAGCTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACGCCATTGTCCACTTAGAAGCTCCATGATGATTTTGTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCCGAGTGTTGACATTAGCTGGCATTTTGCTCAAGTGGCGTCTGTAGCTCAGTGGAGCCGCTCTCTTGTGGATTTAAGCCGTTTTGCTGAGGCTGGGAATGTGCGTAGCCATTTGTTTAACCCTTTGTAGCCCGCCAACTGAGAGATAACTAAAGCAGAGTCGCTCTATTTA
  5   1   2       bld Tbd7      in                         XL109j22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGCTGCGTCTCAGGNAATTAGGTAAATGTAATGCTCTGCACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCGTTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCT
  3   1   2       bld Spl       in                    IMAGE:8463805.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGCATTCTCAAGAGAGTGAGAACCGTACCAGTGTGGGGTTCAGATTAGTAAGTAGCTTGCAGACTTAGGAGCTCATGGATTTTCTAGTGAGACAGAGGAGGGGATAATAGGCAGCATAGCAAGGAAACAAATACTTTAGATTCATAGTTCTTCCTGATTTTATAAACTCCTCTAATAACCCCCCCCCCCTGATTCACAGTCATTCCTTGTGTCTCTCCCATTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTATATACAAGTATGGAGTGCCTTAGTGCAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTTTGTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGGGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTCAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGCCATTATGTTATAGTTCACTTTCTTTCTTTAGCCTTTGCTCCCAAACTCCAGTCTTTGTTCCGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTCCAAGCTCCGCCACGCGCGCATCTCTACACAACAGAAACC
  5  -1   2       bld Bla2                            IMAGE:7299220.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTCAGATCTGCTACTCGGTGGAGACTGAAGCCACTAAGTGACTCCAGTTCAAGGAGGACGTACAGTGTTGTCGATAGAATATTGCGATCAGAGTCATGAGTTTGTGGCAGGGAGGCTATAGCACATACAGAAACAATACTTAGATCAAGTTCTCTGATTTTAAAATCCTNNAATAACCCCCCNTATACAGCATCCTATGTCTCTCCACTCGAGCCCACTCCCTGTATAAGCTGTGAGATTGACACAAGTATGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTTTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGtctttgttctgcactctttctggttaacgattttattctggtttttttcttcttctaattttacaattttggtaggatacagttacaagcatctgccaataaaatggaaaaagcaataaaaacatggaaaaatgaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGGACCCAATCCCCAAGTAATCC
  3   1   2       chi Ga18      in                        xlk5d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGNAGNNNNAANNNGANNTTTCTNGTAGAGNNNNNNGGNNNGGGGCTAAANNAGGGCAGCNTNATGCNANGGNAACCNAAAATNCTTTTAGNATTCANNAGTTTCTNNNNTGATTTTATAAANCTNNNNNNANNNNCCCCCCCCCCCCTGATTCACAGTCATTCCTTATNTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAANNGGAGCCATTCTCTTGTGGATTTAAACANCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTANNCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACNNNNNNTNCCAATAAAA
  3   1   2       bld DMZ  5g3  in                         xl228d10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGACTTTCAGGGAGGCTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCGTTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTACAAGCATCNCCAAAAAA
  3   1   2       bld FaB  5g3  in                    IMAGE:8069972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTGCAGACTTCAGGAGTCAATGGAGTTTCTGTAGAGACAGAGGAGGGGCTAATAGGCAGCATATGCAAGAAACCAAATACTTTAGAATCATAGTTCTTCCTTGATTTATAAAACTCCTCTAATACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTTTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTCTTCTAATTTTACAATTTTGGCAGGCTACAGCACACAGCTCCGCCGANGCCANACACATTTGAACCTATGTTTACC
  5   1   2       bld Ga15      out                      XL430o01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCAATGTGATGTTTTCTAGTAGAGACAGAGGGAGGGGGCTAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGCAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCCGCACTCTTTCTGGTTAACGATTTTCTTCTGGttttttttttttt
  3   1   2       bld Skin      in                    IMAGE:8640260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTGATTTTTTTAGTAGAGACAGAGGAGGGGCTAAATAGGGCAGCGTATGCAAGGAACCCAAATACTTTAGAATTCATAGTTCTTCCTTGATTTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACC
  5   1   2       bld Egg1                               PBX0054A10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACGAGGGGATAAATAGGGCAGCATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAccccccccccccTGATTCACAGTCATTCCTTGTGTCTCTCCCATTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTATATACAAGTATGGAGTGCCTTAGTGCAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTTTGTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGGGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTCAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGCCATTATGTTATAGTTCACTTTCTTTCTTT
  5  -1   2       bld Em10                            IMAGE:7982454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGGCAGATTATGCAGGAACCCAAAAAATTTAGAATTATAAGTTTTTTCTTGATTNAAAAAACTCCTCTAATAAcccccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGAAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGtttttttttttttCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATaaaatgtgaaaaagcaataaaaacatgaaaaataaaaaaaa
  5   1   2       bld Te2N                            IMAGE:7767314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTATGCAAGGAAACCAAAATACTTTTAGAATTCATAGTTTCTTCCTTGATTTTATAAAACTCCTCTAATAAcccccccccTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGttttttttCTTCTTCAAATTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAataaatgtgaaaaagctataaaacatggaaaatgaaaaaaa
  3   1   2       bld Ga15                               XL502c16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNGATTNTANAAAANTCCTNTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTGTGAGCCTCACATCCCCTGTAGTAAGNTGTCGAGATNGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGNGAAGATGGTGNGCACTGGAAAACTCCANTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCATGGTGATGATNGGCAGGATTTTGAGCCATAGTGTNGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTNTNGNGGATTTAAACAGCTNTGNNGAGGNNGGGAATATGNGTAGCCANGNGNTTAACCCTTTGTAGTCCGCCTCATAAGNTGCCANCTGAGAGATAAGTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATATGATCCAGTTTNT
  3   1   2       bld Ga15 5g3  in                       XL503b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGATTTTATAAAACTCCTGTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAAT
  3   1   2       bld Ga15      in                       XL418i18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GNATAAAACTCCTNTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTNTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATAGCAGTTACAAGCATCTGCCAA
  3   1   2       bld DMZ  5g3  in                         xl244g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGT
  3   1   2      seed Ga15 5g3  in                       XL504k20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATAAAACTCCTCTAATAACCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAA
  3   1   2       bld Ga18 5g3  in                        xlk6j23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCCCCCCCTGATTCACAGTCNTNCCTTANGTCTCTCCCNCTCTGANNCTCACNTCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCNNAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAANNGGAGCCATTCTCTTGTGGATTTAAANANNTTTGCTGAGGCTGGTAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTANNCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACNNNNNCTNCCAATAAAANGNG
  3   1   2       bld Tbd7 5g3  in                         XL060m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCCCCTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGNTCTGCACTCTNTGCTGGTTA
  3   1   2       bld Tbd7      in                         XL109j22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCCTGTACTAAGCTGCTGAGATTGTACACAAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTAAAAAGCAA
  3   1   2       bld Tbd7 5g3  in                         XL060b18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGANACAGTTACAAGCATCTGCCAATAAAATGNAAAAAGCNATAAAAACA
  3   1   2       bld Tbd7      in                         XL071h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTCACAGTCATTCCTTATGTCTCTCCCACTNTGAGCCTCACATCCCCCTGTACTAAGCTGCTGAGATTGTACACAAGGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTAAAAAGCAAAAAAACA
  3   1   2       bld Tbd7 5g3  in                         XL098f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCGCCAATAAAATGTAAAAAGCAAAAAAACA
  3   1   2       bld Neu7 5g3  in                         XL031f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTCACAGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCCTGTACTAAGCTGCTGAGATTGTACACAAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTCTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGNAAAAAGCAATAAAAACA
  3   1   2       bld Ga18      in                      xlk107e24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACAGTCATTCCTTATNTCTCTCCCACTCTGANNCTCACNTCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAANNGGAGCCATTCTCTTGTGGATTTAAACNNCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGNCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACNNNNNCTNCCAATAAAAT
  5   1   2       bld Ga18      in                      xlk107e24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCATTCCTTATGTCTCTCCCACTCTGAGCCTCACATCCCCTGTACTAAGCTGCTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGNNGNGNNTTCTCTTGTGGATTTAAACAGCTTTNNNNAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCNNTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTNCTGCACTCTTTCTNGNNNACGANTTTATTCTGGNttttttttCTTCTTCTAATTTTACNATTTNNNAGGATACAGNTACAAGCATCTGCCAAtaaaatgtgaaaagcaataaaaacatggaaaatgaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL469h23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGttttttttCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAAtaaaatgtgaaaaagcaataaaaacatggaaaaatgaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL469h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGAGATTGTACACAAGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCCAATAAAAT
  3   1   2       bld Egg6      in                    IMAGE:4434880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTATGGAGTGCCTTAGTGTAAGTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCG
  5   1   2       bld DMZ                                  xl247j16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGGGACTATTCCAACTGGGACCAGGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCCGCACTCTTTCTGGTTAACGATTTTCTTCTGttttttttttttNCTNCNAATTTNACAATTTNGGNA
  3   1   2       bld Tbd7      in                         XL070h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGAGACATGTGAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTACTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGNAAAAAGCAGATAAAAACA
  5   1   2       bld Tbd7      in                         XL070h19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGATGGTGCGCACTGGNAAAACTCCATTGTCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACtctttctggttaacgattttattctggttttttttcttcttctaattttacaattttGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAaaaagcaataaaaacatggaaaantgaanaaaaaaa
  3   1   2       bld Tbd7      in                         XL059o04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGATGGTGCGCACTGGAAAACTCCATTGTCCATTTANAGGCTCCATGATGATTATATGCCCCCTGGTNATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTNTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCNCTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCNGGTTAACGATTTTATTCTGTTTTTTTTTTTCTTCTAATTTTACAATTTGGTAGGATACAGTNACAAGCATCGCCAATAAAATGTAAAAAGCAANA
  3   1   2       bld Tbd7                                 XL053m22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCNCTGGAAAACTCCATTGTCCATTTANAGGCTCCATGATGATTTTGTGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAANCGGAGCCATTNTNTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTANCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGANAGATAACTAAAGCAGGGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTCAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGANCCAGTTTCTTCTCTTTTACTTTCTCNCAGCCATTATGTTANAGTTCNCTTTCTTTCTTTAGCCTTTGCTCCCAAACNCCAGTCTTTGTTCCGCNCTCTTTCTGGTTAACGATTTTANTCTGTTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTAAAAAGCAATAAAAACA
  3   1   2       bld Tbd5      in                    IMAGE:3581325.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAAAAAGCAATAAAAACAGAAAAAAG
  3   1   2       bld Emb4 5g3  in                    IMAGE:4959785.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTTAGAGGCTCCATGATGATTATATGCCCCCTGGTGATGATTGGCAGGATTTTGAGCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGGTTTTTTTTCTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAA
  3   1   2       bld Egg6                            IMAGE:4435842.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCATAGTGTTGACATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTGTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCAAAAAATATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATGGAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAAAAAAA
  3   1   2       add Tbd7 5g3  in                         XL057h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGACATTANCTGGCATTTTANANAANCGGAGCCATTNTNTTGTGGATTTAAACAGCTTTGCTNAGGCTGGGAANATGTGTANCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAANCTGCCAACTGANANATAACTAAAGCAGGGCTTNTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTCAGCTCCTACTTGCCNCCTAGTATGCCAAACATCTGANCCAGTTTCTTCTCTTTTACTTTCTCNCAGCCATTATGTTANAGNTCNCNTTCNTTCTTTAGCCNTTGCTCCCAAACNCCAGNCTTTGNTCCGCNCNCTTTCTGGTTAACGATTTTANTCTGNTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGNAAAAAGCA
  3   1   2       bld Emb1                            IMAGE:3402106.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTAGCTGGCATTTTACATAAGCGGAGCCATTCTCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGAAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAAGTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGTTTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATAAAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAATTTTA
  3   1   2       bld Emb3      in                    IMAGE:3400667.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCTTGTGGATTTAAACAGCTTTGCTGAGGCTGGAAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGGTTAACGAGTTTTATTCTCGTTTTTTTTTTTNTTCTTCTAAATTTTACAATTTTGGGTAGGGATACAGTGTACAAGCATTTNGCCAATAAAATGTGAAAAAGCAATAAAAACATGGAAAAATGAAAAAAA
  5   1   2       bld Ov1                             IMAGE:8330841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCACGCGTCCGAATATGTGTAGCCATGTGTTTAACCCTTTGTAGTCCGCCTCATAAGCTGCCAACTGAGAGATAACTAAAGCAGCGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTCTGGTTAACGATTTTATTCTGtttttttttttttCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATaaaatgtgaaaaagcaataaaaacatggaaaaatgaaaaaaaaaaaaaaaG
  3   1   2       bld Ga18      in                       xlk56m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCTTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTANNCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTGTGGTTAACGATTTTATTCTGGTTTTTTTTTTTCTTCTAATTTTACAATTTTGGTAGGATACAGTTACNNNNNCTNCCAATAAAATGNGAAA
  5   1   2       bld Ga18      in                       xlk56m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCTATTTGTGTTTCAGCGGGATGGCATAAAGCTGAGCTCCTACTTGCCACCTAGTATGCCAAACATCTGATCCAGTTTCTTCTCTTTTACTTTCTCACAGACATTATGTTATAGTTCACTTTCTTTCTTTAGCCCTTGCTCCCAAACTCCAGTCTTTGTTCTGCACTCTTTGTGGTTAACGATTTTATTCTGGtttttttttttCTTCTAATTTTACAATTTTGGTAGGATACAGTTACAAGCATCTGCCAATaaaatgtgaaaaagcaataaaaacatggaaaaatgaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)