Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4930098.5.5                    47 PI      92         23     2341                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012768024 Xl3.1-xl338g07.5 - 76 ESTs
                                                                       .......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl338g07.5                                                          GGCTTCTAGAAGTGCTGAGGGGTTTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTTGGATTTTGTTATTTACATACACAGTCTAATATAAGTGCAGACAAATTAAATCTATT
                                                  Xl3.1-CHK-1012685922                                                                TAGAAGTGCTGAGGGGTTTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTTGGATTTTGTTATTTACATACACAGTCTAATATAAGTGCAGACAAATTAAATCTATTTTAAAA
                                                      consensus depths                                                               2     2     2     2     4     5     7     8    14    15    18    21    26    28    26    29    28    31    28    31    28    31    29    31    29    31    29    31    29    31    30    32    30    32    31    32    31    32    31    32    31    32    31    33    31    33    32    33    32    33    34    34    34    34    33    34    34    34    34    34    34    34    34    34    34    34    34    34    34    34    33    34    34    34    34    34    32    34    32    34    31    34    31    35    31    34    31    34    29    34    30    34    29    34    28    32    28    31    27    31    26    31    25    29    23    28    23    26    23    26    23    26    22    26    21    24    19    24    18    24    19    24    13    18    11    18    11    18    10    16    10    15    10    15    10    15     9    15     9    14     8    14     8    14     8    13     8    13     7    12     6    12     6    12     6    12     6    12     6    11     6    10     6     9     6     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     5     6     5     6     5     7     6     8     6     8     6     9     6     9     6     9     5    10     5     9     5     9     8    10     7    10     8    10     8    10     9    12     8    12     9    12     9    13     9    14     9    14     9    14    11    14    10    14    10    16    10    18    11    18    12    17    12    17    12    18    12    17    12    17    12    17    12    18    11    18    14    19    15    20    15    22    19    23    19    23    18    23    18    23    19    23    19    23    19    23    16    23    23    25    19    25    22    25    23    27    24    27    24    27    24    27    23    27    25    29    26    29    30    32    31    33    32    33    29    32    29    32    29    32    31    32    27    32    27    32    29    32    27    31    27    31    29    30    29    30    29    30    27    30    26    30    28    29    28    29    29    29    25    27    26    27    24    27    26    28    26    28    24    28    22    27    24    27    24    26    24    26    20    26    22    26    21    26    21    24    13    19     9    18     7    16     7    11     5     9     4     8     4     8     4     8     3     6     2     4     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                               BLH ATG     100     151                                                          
                                               BLH MIN     100     388                                                          
                                               BLH MPR      61     388                                                          
                                               BLH OVR     100      23                                                          
                                               CDS MIN     100      51                                                          
                                               EST CLI      44      51                                                          
                                               ORF LNG     100       9                                                          
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328006.5p GTCTGAGAGGAAATCGGCTTCTTACTTAACCTTTCTGTCACACCCACGTGGTTACGAGGCTTCTAGAAGTGCTGAGGGGTTTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGC
  5   1   2       bld Int2 5g                         IMAGE:8822639.5p          CCCCCCCTTGATTACCTATTACCACAACCTCAATAAAATCGTCCCCGAGGCTTCTAGAAGTGCTGAGGGGTTTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAATGGTGATGCCTGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCACGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGCTAATGTCTGAGGTTATTATGACCTACTGCGCTGCCTAGCTACGGACTAAATAAATCTGATGACAGTATGGCAGTCTATGACTTTGGGGGAGAACATTGGATATCTCTCCTCCTAAATTCGA
  5   1   2       bld Neu7 5g3  in                         XL011c11.5p                                                                               GGTTTTCTTTTNGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGA
  5   1   2       bld Int2 5g                         IMAGE:8529623.5p                                                                                TTTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCTACTGCGGCTGCCCTAGCTACGGACTAGATAATCT
  5   1   2       chi Ov1                             IMAGE:6316897.5p                                                                                 TTTCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCACAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGCGATGCCTGGGGGGAATCCCATTGCAAAACTTTATTCTCCCACTCAGATTGGGCGAATATCGTTAAAATGCAAAATGCCAGAACACCGCCCGAAGATTATTTTGGGGTTATGCTGGCCACAACATGCCGTCGTGATCGCCTTATGGCCCCGCCACACCCCGAAAAAGAGTTCTCACGGGCAAAGGAGTTTACCAAAACCGCACTCTTTGTGGCAAAACACCCACCGGCCCATCTATCTGTTCCCTGCAGGGGCGTAATTTATACGCAAGCCGTCATCGTGGGCGGTAGCGGACCACTCAAGCCGGTTCTTCGCGAACCACGATCTGACAACATTCCCGGACGGCGACACAACCCCGCCACTTGTTCGGCCTCCGGCACTATTTTACACACCGTTCCTGAGAGCGAAAAGAGAGGAGACAAAATTCTTGTGAACTATGATTATACCCGCCAGACACTGTCAN
  5   1   2       bld Neu7 5g3  in                         XL019e17.5p                                                                                   GCTTTTCAGCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTA
  5   1   2       bld Emb4 5g                         IMAGE:4681245.5p                                                                                         CCACGCGTCCGGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAAGAACATTTGATATCTCCCTCCTAGAAATTCAAAAAAGGAGTTTTT
  5   1   2       bld Ga12 5g3  in                         XL194j23.5p                                                                                           GCTGGTAGTGACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTATCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGA
  5   1   2       bld Oo1  5g3  in                    IMAGE:5078102.5p                                                                                                     ACCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCT
  5   1   2       bld Sp1  5x3  out                   IMAGE:4964389.5p                                                                                                      CCCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGGAAATGAAAGAGACCGCAGAAAACTATTTGGGT
  5   1   2       bld Emb4 5g                         IMAGE:5514199.5p                                                                                                      CCCAGTGAAGGTTCACTATTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGA
  5   1   2       bld Neu4      in                    IMAGE:4085197.5p                                                                                                       CCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGA
  5   1   2       bld Emb4 5g                         IMAGE:5543460.5p                                                                                                       CCAGTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAAGATGCTGGGAAAATCTCTGGGGCTTAATGTCCTGGAGGGGTTATTAATGAGCCCTACTGCGGCTGGCCCTACCTTAAGGAACTAAATAAATCCGATGACCAAAGTTATTGCCCCTCTATGAACCCTGGGGGGAGGAAACTATTGGAATACCCCCACCCGCAAAAAAATTCCAAAAGGGGGCTTTCTTCAATAAGACATCGCACAATTCGGCGACACTCTGTCCTTGGCGGGGGGAAAAAAATTCCGCCGTCCCGATATCGCCTGCGCACATTCCGTGGCAACAAAATCTCACCCAT
  5   1   2       bld Oo1  5g                         IMAGE:6859009.5p                                                                                                          TGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAAGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCNTTGGGANGTGAAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAAAGTCTGGTGGTGGAACCTTACC
  5   1   2      seed DMZ  5g3  in                         xl338g07.5p                                                                                                          GTGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGA
  5   1   2       bld Tbd7 5g3  in                         XL053e06.5p                                                                                                           AGGGGTTCACAAGCTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTG
  5   1   2       bld Emb4 5x                         IMAGE:4683723.5p                                                                                                           GAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTCCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGCCAAATTTGGGGCATTTGTTTTAATGaaaaatgaaaaaaccccaaaaaaCTATTTGGGGCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACCTTTAATGACTCTCAGCCAACAGGGCTTCAAAGGATGCTGGGGCACATTCCTGGGCCTTAATGCCTTGAGGGTTATTAAATGGAGCCTTACTGGGGGTTGCCCTTACCTTTACCGGACTAAAATAAAATCCGGATTAAAAAAAGACATTTGGCCCCTTTATGACACTTTGGGGGGGAAGGAAACATCTTGGATATTCTCCAATCTCCaaaaaaattctaaaaaaGGAGAGTTTTTGTAACTCAAAAACTCCCACCACATGGGCAACCCCCCATTTCCTTTCGGGAGG
  5   1   2       bld Ga18 5g3  in                      xlk125d14ex.5p                                                                                                           TGAAGGTTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGNGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGANCGCAGAAAACTATTTGGNNCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGNTACAAAGGANNCTGGNCAGATCTCTGGGCTTNATGTCTTGNGGGNNATT
  5   1   2       bld Emb4 5g                         IMAGE:4683864.5p                                                                                                                 TTCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGGTATTTAATGAGCCTACTGCCGGCTGCCCCTACCTTTACCGACTAGAATAAATCTGGATGGACAAAGTTATTTGCAGTCCTATGGACCCTTGGGGGGGAAGGAACAATTTGGATAATCCTCCCATCCCTAAgaaaatttccaaaaaagggaggtttttttggaaaggtaaaaaaTTCCCCACCAAATTGGGAAGAAACACCACTTTCCCTCTTTGGGGAAGGGGTGAAAA
  5   1   2       bld Neu7 5g3  in                         XL035d04.5p                                                                                                                  GCACAAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCA
  5   1   2       bld Ga18 5g3  in                       xlk79e21ex.5p                                                                                                                      AAGTTGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGNTACAAAGGATGCTNGNNAGATCTCTNGGCTTAATGTCTTGANGTT
  5   1   2       bld Tbd7 5g3  in                         XL106k21.5p                                                                                                                          GGTNATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGGACTCTCA
  5   1   2       bld Tbd7 5g3  in                         XL101l03.5p                                                                                                                          GGTNATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGT
  5   1   2       bld Ooc1 5g                IMAGE:3747217-IMAGp.IMAGp                                                                                                                          CGTCATTGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGG
  5   1   2       bld Tbd7 5g3  in                         XL095o24.5p                                                                                                                                TGTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGNTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCG
  5   1   2       bld Oo1  5g3  in                    IMAGE:3405032.5p                                                                                                                                 GTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAAA
  5   1   2       bld Tbd7 5g                              XL078g12.5p                                                                                                                                 GTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACAAATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATT
  5   1   2       bld Ov1       in                    IMAGE:8328214.5p                                                                                                                                 GTGTGACTTGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTATGGACTAA
  5   1   2       bld Ooc2      in                    IMAGE:3747241.5p                                                                                                                                          TGACTTTGAATAACTCTCATCATGCTGTGTGCCGGCGGTTCCGTACCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAAGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAATTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAAATGTGATGGCCTGGTGGAATCCCCATGAAAACTTTATTCTTCAAGTCAGATTGGTGCATTTGGTTTAATGAANATGAAAGAAAACCGCGAAAAA
  5   1   2       bld Ga12 5g3  in                         XL200h17.5p                                                                                                                                                     ACTCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTG
  5   1   2       bld Emb4 5g                         IMAGE:5543046.5p                                                                                                                                                       TCTCATCATGCTGTGTGCCGGCGGTTCCGTAGCCTCTTCTCTCTCACATGTCTCACGGATACTTCGCAAGGGCTGTTTTAATGGTCTCAGCCAAGATGTTCTACAATCAGTTTTTAGACGGGACTATGCATCTGAATCAGTTAAAGGTGCTGTTATTGGCATTGATCTAGGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTTGGGGGAGGAACATTTGATATCTCCGTCCTAGAAATTAAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGGAGGGGAAGACTTTGATCAAGAATTGCTGGCAGTATATTGGTAAGCAATTTCAAAAAAGAAGCCTGGGGGTGA
  5   1   2       bld Emb3                            IMAGE:3399234.5p                                                                                                                                                                                                                                        TGGTCTCAGCCAAGATGTTCTACAATCACTTTTTAGACGGGACTATGCATCTGAATCACCTAAATGTGCTGTTATTGGCATTGATCTACGAACAACAAATTCTTGTGTTGCTGTAATGGAGGGAAAGCATGCAAAGGTCCTTGAAAATGCTGAAGGGGCCATAACAACGCCTGCAGTACTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGTAATGCCCGCTAAACGACAGGCAGTCACTACCCCTAACAGCACATCCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTGCACACGACACTAAGAGTGTCCTTCATAGTTGTG
  5   1   2       bld Spl       in                    IMAGE:8463438.5p                                                                                                                                                                                                                                                                                                             AAAATGNNNAATATAATCCNNNNGGGGATCCATGATTCGATTCGTCCCGGAGGGGAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTATGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCGTCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAG
  5   1   2       bld Ga15      in                       XL476k05ex.5p                                                                                                                                                                                                                                                                                                                                                                   AAAGCAAGCAAAGGTCCTTGAAAATGCTGAAGGGGCCAGAACAACGCCTTCAGTAGTAGCCTTTTCATCAGAGGGTGAACGTTTAGTTGGAATGCCAGCTAAACGACAGGCAGTCACTAACCCTAACAACACATTCTATGCTACAAAACGACTCATTGGCCGACGTTTTGATGACCCTGAAGTTCAAAAAGACACTAAAAATGTTCCTTTCAAAATTCTGAAAGCCTCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATG
  5   1   2       bld Int2      in                    IMAGE:8820812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTACCTTCAAAAATTCTCCGTTTGTATAATTTAATCGTCCCCAAATGGTGATGCCTGGGTGGAATCCCATGGAAAACTGTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCGTCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCAGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAGCTATGCAGATGCCGAAGTTAGCAAAGTGACATTGGTGAGTTTTGTTAGTCGTGGATGACGAGATGCCAAAGCTCAGCAACTGTGCAGATTTGTTTGACGAGCACCAGCAAGCAGTAATCCTGATGAGCAGTGGCAATGAGCTGCATCAGGTGGTGTGTTAGCTGGAATGTTACGATGTCTTGTTGTGATGTACCATATCTCTTGCATGGAACCTGAGATCTTTACCAACTTGTATTGGAGAAC
  5   1   2       bld Ga18      in                       xlk57p15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGAAAACTTTATTCTCCAAGTCAGATTGGTGCATTTGTTTTAATGAAAATGAAAGAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGNTACAAAGGATGCTGGGNAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTNCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGNTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGANAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGNGAAGTTTTGTTAGTCGGNGGAATGACGAGAATGCCAAAGGTNCAGCAAACTGTGCAAGATTTGTTTNGNCG
  5   1   2       bld Oo1                             IMAGE:6640659.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGACCGCAGAAAACTATTTGGGTCATGCTGCCAAAAATGCTGTGATCACTGTGCCTGCATACTTTAATGACTCTCAGCGACAGGCTACAAAGGATGCTGGGCAGATCTCTGGGCTTAATGTCTTGAGGGTTATTAATGAGCCTACTGCGGCTGCCCTAGCTTACGGACTAGATAAATCTGATGACAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTACCTGGAGATGTTACAGAATGTCTGTTGTTGGATGTTACCCCATTATCTCTTGGCATTGAAACACTTTGGAGAGGTCTTTACCAAACTGATGGGAAGAAACACCACTATACCAACAAAAGAAAAGCCCAGGTATTCTCTACTGCCTGCAGATGG
  5   1   2       bld Ga18      in                      xlk109e20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGTTATTGCAGTCTATGACCTTGGGGGAGGAACATTTGATATCTCCATCCTAGAAATTCAAAAAGGAGTTTTTGAAGTAAAATCCACAAATGGAGACACATTCCTTGGAGGTGAAGACTTTGATCAAGAATTGCTGCAGTATATTGTAAAGCAATTCAAAAGAGAGTCTGGTGTGGACCTTACCAAAGATAATATGGCACTTCAGAGAGTCCGAGAAGCTGCTGAAAAGGCAAAATGTGAATTGTCTTCCTCTTTACAGACGGACATCAATCTGCCATACCTTACTATGGATGCTTCTGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGNAGTAAATCCTGATGAAGCAGTTGNCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATNCCAACAAAGAAAAGCCAGGNATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTNCNNNNAGGNGAGCGANAAA
  5   1   2       chi Tad2      in                    IMAGE:6876156.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGACCAAAACACTTAAATATGAAATTGACACGTTCTCAGTTTGAGGGAATTGTTGGTGATTTAATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGGAATTGTTCATGTATCGGCCAAAGACAAAGGGAACAGGTCGTGAACAACAAATTGGNAATTCAGTCTTTCTGGGGGGACTTAAGCAAGGGATGAACATTTGAGAATAATGGGTAAAGGAAATGCCAGAAAAAAGTTTTGCGCGAACGAAAGGATTCGAAAGAAATAAAAGCGAACCCGCTGGTGGGAAAGGCAAATAAAAACAACTTGGCCTTGGAAGGGGAATTTAATTTTCCTTGGAACACCAAGAGAATCA
  3   1   2       bld Neu4      in                    IMAGE:4085197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATAAAGAGGACAGTTGCACCAAGCCAAAAAGCTATGCAAGATGCCGAAGTTAGCAAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATGTGGTAAAGAATGCAGAAAAGTATCAGAAGGA
  5   1   2       bld Ga18      in                      xlk117g14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAAGTGACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAANNNGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGNCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTNagaatatgnnaaagaatgcagaaaagtatgcagaagaagatagaagaagaaagGAGCGTGTGGAGNCAGTNAACAATGCTGAAGGNNTTATTCATGACACAGAGTCAAAAATGGANGAATTTAAGGNTCAGCTGCCAGCTGATGAGTNNNNAAACTAAAAGANNGNNCAGCAANGTAAAAGAACNCTTGGCACGAAAGNNNANGNAANTNGCGAGNNNNTCAGAAANGCTNNT
  5   1   2       add Gas3      in                      xlnga002j20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACATTGGTGAAGTTTTGTTAGTCGGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGGACGAGCACCAAGCAAAGCAGTAAATCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCTGATGGCCAGACACAGGTTGGAATTTAAGGTTCACCAAGGGAGCGAGGAATGTGCTTGTGACACCAAATCTTTTGGCCGGTTACATGGGTTGGTTTTCCCCTTGCCCCTCGAGGGGGGCCCCGTACCAATTTCGCCTAT
  3   1   2       bld Gas3      in                      xlnga002j20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTGGAATGACGAGAATGCCAAAGGTTCAGCAAACTGTGCAAGATTTGTTTGACGAAGCACAAACCAAACCAGTAAATTCCTGATGAAGCAGTTGCCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGA
  5   1   2       bld Ga18      in                       xlk57f01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGTTTGGNCGAGCACCAAGCAANNNNTAAATCCTGATGAAGCAGTTNNCATTGGAGCTGCAATTCAAGGTGGTGTGTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTaaagaatgcagaaaagtatgcagaagaagatagaagaagaaagGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGANNNNTCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAANTATTTGAAATGGCTTNCAAAANNNGGCATCTGAAAGNANNAGCTCTGAAAG
  3   1   2       bld Int2      in                    IMAGE:8820812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTTGGGCAAAGATGTGACAGGACCAAGCAAGCAGTATCCGATGAGCAGGCATGAGTGCATCAGTGTGTGGTAGCTGAGATGTTACAGAGTCTGTGTGATGTTACACCATATCTCTTGGCATGAAACACTGAGAGTCTTACAACTGATGAAGAAACACAACTATACCAACAAGAAAAGCAGGTATCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCTGCCCCTCGAGGAGTGCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGTGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAAGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTTAAAGAAGAGATAAGCAAGGTAAAAGAACTCTTGGCATGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTTATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTA
  3   1   2       bld Ov1       in                    IMAGE:8328214.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTAGCTGGAGATGTTACAGATGTCTTGTTGTTGGATGTTACACCATTATCTCTTGGCATTGAAACACTTGGAGGAGTCTTTACCAAACTGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTTACAACATCCAACTAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk117g14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGCNGAGATNTNCAGATGTCNTGTTGNTGGATNTTACACCNTNNCTCTTGGCATTGAANNNCTNGGAGNNGTCTTTNCCAANCTGATTGGAAGAAACNNANCTATNNCANNAAAGAAAANCCAGGTNTTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGNNTTCCCCCCTGCCCCTCGAGGAGTNCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGNCCTTTTTTTCACTGTTTATTCTTGGATTTTGTTATTTACATACACANTCTAANA
  3   1   2       bld Tad2      in                    IMAGE:6876156.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGTTTTTTTTTCTTTCTATAAACGCGGCCTGACCATTAATGGGCGCCCGGGTGCCACCACTGGGTGAGAAATTTTTCAAAAGGTTCCCCCCCCAAGGGATGAGTCGGAGGAAATATGGGCCATTGTGGACCAAACAATACTTTTCTTGGCCCCACGTTTTACCATTGGGTCTGGTTTTTCCCCCCCCTGCCCCCCTAGGAAGGAGTGGCCTTCCAGATTGAAATGTCCACTTTTGACCATCGAATGCAAACGGAATTTTGTTCCAGGTATCCGGCAAAAGGACAAAAGGAACCAGGTCGTGAACCAACAAATTGTTATTCAGTCTTTCCGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAGGAAGGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGCTACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAACATGAATTTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACCGCAGATTCTTGGATTTGCTNACCCACACACACGAAAAANANCNCCCCCCCCCAACAAACCACCCCCCCNNNCCTCACCAAACNAAAACCATGTCGC
  5   1   2       bld Te2                             IMAGE:7211592.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCCGCGAATTTNCCCGGGGATCTTGGAGGAGTCTTTACCAAACTGGATTGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGagaatatggtaaagaatgcagaaaagtatgcagaagaagatagaagaagaaagGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATACCATAAATCTTTTACTGTATTTTTGCAGTACTCCTTGTCCTTTTGTGGCTGTGNTTTAGTTGGAGTGTTGAAATTTGAAtttttttttttttctacaaatgaaaaataaaaaaaaaTCCCCGT
  3   1   2       bld Ga15      in                       XL476k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAACNCTTGGAGGAGTCTTTACCAAACTGATGGGAAGAAACACAACTATACCAACAAAGAAAAGCCAGGTATTCTCTACTGCTGCAGATGGCCAGACACAGGTAGAAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAGGNGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCA
  3   1   2       add Ga18 5g3  in                      xlk125d14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAACACACNNNNCANNAAAGAAAAGCNAGGTATTCTCNNCNNCTGNAGATGNNNAGACACAGGTAGAANTAAAGTTCNNNAAGGAGAGCGAGAANTGGCATGTGACANCANCTTCTTGGNCAGTTTACATNGNTTGGTTTCCCCNTGCCCCTCGAGGAGTNCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCNNCAANAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGNATATGGTAAAGAATGCAGAAAAGTATGCAGAAGNAGATAGAAGNAGANAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGANTNCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAANCGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTNCCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTNCTCTTTGTCTTTNGTNGCTGCTGTTTTAGTTGGATNNTGTAAGTTG
  3   1   2       bld Spl       in                    IMAGE:8463438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAGATTTACAACGATGAGACACACTTACACAAGAAAGCAGTATCTTATGTGCAGAGCCAGCACAGTAGAATAAGTTCACAGGAGAGCGAGAAATGCATGGACACAAACTTCTGGCCAGTTANCATTGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATGAAGTNCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTCTACCAAAGCATTAAAGACCTTAA
  3   1   2       bld Ga18      in                       xlk57f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACNAANNAAAGCNANNNNTCTCTACTGCTGNAGANNNCAGACACAGGTAGAAATTAAAGTTCNCCAAGGAGAGCGAGAAATGGCATGTGANAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCANTCTTCTGGCGGNCTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTNGAnnnnnnnnCTACAAAT
  3   1   2       bld Ga18      in                      xlk109e20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGAAAAGCCAGGTNNTCTCTACTGCTGNAGATGGCCAGACANANGTAGAANTTAAAGTTCACCAAGGAGAGCGAGNAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATNGNTTGNTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGNAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATNGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGNCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTG
  3   1   2       bld Tbd7 5g3  in                         XL053e06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAATTAAAGTTCACCAAGGAGAGCGAGAAATGGCATGTGACAACAAACTTCTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTACATGAGAATTTACCAGAGTCCNAGCAAAAATACCATAA
  3   1   2       bld Ga12 5g3  in                         XL200h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGAGAAATGGCATGTGACAACAAACTTNTTGGCCAGTTTACATTGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTNTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAAGAAGCAGCTNTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTNTTCAGAACTTTTCAAGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATAAAAA
  3   1   2       add DMZ  5g3  in                         xl338g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTTGGNCCAGTTTACNTTGGGTTGGTTTCCCCCCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTNTTCTGGCGGACTAAGCAAGGATGACATTGNGAATNTGGTAAAGAATGCAGAAAAGTnTGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCNGTAAACAATGCTGAAGGTNTTATTCNTGACNCAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACNAACTAAAAGAAGNGATCAGCAAGGTAAAAGAACTCTTGGCNCGAAAAGACGAAGAAACTGGCGAGAGCNTCAGAAATGCTTCATCAACTNTCCAACNGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAAGAAGCNGCTNTGAAAGTGGACAACAAAAAGAGGATCNGAAGGAAGAAAAGCNATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCNTGAGAATTTACCATAGTCCTGAGCAAAAATAACCNTAAATCTTTTACTGTATTTTTGCNGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTGAATTTT
  3   1   2       bld Ga18 5g3  in                       xlk79e21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTTTCCCCCCTGCCCCNCGAGGNNNNCCTCAGNTTGNANTNNCTTTTGACNNTGATGCAAATGGANTGTCANGTATCGGCAAAAGACAAAGGAACNAGGTNNGANCAACAATTGTTNTTCANTCNTCNNNNGGNCTAAGCAAGGATGACATTGAGAATATGGTAAANNNGNAGAAAAGTATGCAGAAGNAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTNNNTTCNTGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGNCGAAGAAACTGGCGAGAGCATNAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGNCCTTTTTTTCACTGTTTATTCTTNGATTTTGTTANTTANAT
  5   1   2       bld Egg1                               PBX0074F02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTGCCCCTCGAGGAGTGCCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTgagaatatggtaaagaatgcagaaaagtatgcagaagaagatagaagaagaaagGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTG
  3   1   2       bld Tbd3                            IMAGE:3548315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAGTGCTTCAGATTCAAGTCATTTTTGATAATGATGCCAATGGCATTGTTCATGTATTGGCTCAAGACAAAGCAACAGCTTGTGAACACATAATTGTTATTCAGTCTTCTGGCGGACTAAGTAAGTATGACATTGAGTATATGGTACAGAATGCAGACAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAACACATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCCCGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGC
  3   1   2       bld Ga12 5g3  in                         XL194j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTCAGATTGAAGTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAAGAAGCAGCTNTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTNTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATAAAAAAAA
  3   1   2       bld Ga18      in                       xlk57p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ANTNNCTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGNCAAAAGACAAAAGGANCAGGTCGTNNNNNNCAAATTGTTATTCAGTCNNCTGGCGGNCTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTNTTTTAGTTNGATNTTGTAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCACTTTTGACATTGATGCAAATGGAATTGTTCATGTATCGGCAAAAGACAAAGGAACAGGTCGTGAACAACAAATTGTTATTCAGTCTTCTGGCGGACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7 5g3  in                         XL101l03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTNTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAANAAGCAGCTNTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGNACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTGGATTTTGTTATTTACATACNCAGTCTAATATAAG
  3   1   2       bld Neu7 5g3  in                         XL011c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACTAAGCAAGGATGACATTGAGAATATGGTAAAGAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCCACAAAGGATAATTAAAAACAATCCACTGTCCGTCGCTCTCACATTNGGCCTTTNTTCTCNCTGTTTATTGCTTGGCATTTTGTTATTTACA
  3   1   2       bld Egg6                            IMAGE:4434699.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTAAAGAATGCAGAAAAGTATGCAGAAGAGNATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTT
  3   1   2       bld Sp1                             IMAGE:4964388.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAATGCAGAAAAGTATGCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGTAAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCA
  3   1   2       bld Oo1  5g3  in                    IMAGE:3405032.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGAAGAAGATAGAAGAAGAAAGGAGCGTGTGGAGGCAGTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCAAAAA
  3   1   2       bld Ooc2      in                    IMAGE:3747241.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAAACAATGCTGAAGGTATTATTCATGACACAGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCCCGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAAAAGCAGCTCTGAAAGTGGCCACCAAAAAGAGGATCAGAAGGAAGAAAAGC
  5   1   2       bld Egg1                               PBX0140B02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTGAAGTATTATTATGACACAGAGTCAAAAATGGAAGAATTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTACATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATT
  3   1   2       add Tbd7 5g3  in                         XL106k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGNTGATGAGTGCAACAAACTAAAAGAAGAGATNAGCAAGGTAAAAGAACTNTTGGCACGAAAANACGAANAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTTTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATTTGAAANAANCAGCTNTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGNGCTTGGGAATTAACTNTTCAGAACTTTTCATGAGAATTTACCANAGTCCTGAGCAAAAANAACCATAAATCTTTTACTGNATTTTTGCAGGACTCTTTGTCTTTTGNTGCTGNTGTTTTAGTTGGATGTTGTAAGTTNNNTTTTTTTTTTTTNTACAAATGATAATTAAANANANTCCACTGTCCGTCG
  3   1   2       bld Neu7 5g3  in                         XL035d04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAANAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTNTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAANAAGCAGCTNTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGNATTTTTGCAGnACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTGGATTTTGTTATTTACA
  3   1   2       bld Tbd7 5g3  in                         XL095o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAGTCAAAAATGGAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGNTTCATCAACTNTCCAACAGGCTTCCCTTNAATTATTTGAAATGGCTTACAAAAAGATGGCATNTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTNCCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCNTTTGNTGCTGTTGTTTTAGTTGGATGTTGTAAGTTNAATTTTTTTTTTTTCTACAAANATAATTAAAAAAAAT
  3   1   2       bld Oo1  5g3  in                    IMAGE:5078102.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGAATTTAAGGATCAGCTGCCAGCTGATGAGTGCAACAAACTAAAAGAAGAGATCAGCAAGGTAAAAGAACTCTTGGCACGAAAAGACGAAGAAACTGGCGAGAGCATCAGAAATGCTTCATCAACTCTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAAGATGGCATCTGAAAGAAGCAGCTCTGAAAGTGGACAACAAAAAGAGGATCAGAAGGAAGAAAAGCAATAATTATTTTCGGTGTAAACGGCGCTTGGGAATTAACTCTTCAGAACTTTACATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGTTGTTTTAGTTGGATGTTGTAAGTTGAATTTTTTTTTTCTACAAATGATAATTAAAAAAAATCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTTGGATTTTGTTATTTACATACACAGTCTAATATAAGTGCAGACAAATTAAATCTATTTTAAAAAAAAAAAATAAAAAAAAAAAA
  3   1   2       add Neu7 5g3  in                         XL019e17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AANTAAAAGAAGAGATCAGCAAGGTAAAAGAACTTTTGGCACGAAAANACGAAGAAACTGGCGANAGCATCANAAATGTTTNATCAACTTTCCAACAGGCTTCCCTTAAATTATTTGAAATGGCTTACAAAAANATGGCATTTGAAANAAGCAGCTTTGAAAGTGGNCAACAAAAAGAGGATCAGAAGGAANAAAAGCAATAATTATTTTCGGTGTAAACGGNGCTTGGGAATTAACTNTTCAGAACTTTTCATGAGAATTTACCANAGTCCTGAGCAAAAANAACCATAAATCTTTTACTGNATTTTTGCAGGACTCTTTGTCTTTTGNTGCTGNTGTTTTAGTTGGATGTTGTAAGTTNNNTTTTTTTTTTTTNTACAAA
  5  -1   2       bld Ga12                                 XL220p12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTGGGAATTAACTCTTCAGAACTTTTCATGAGAATTTACCATAGTCCTGAGCAAAAATAACCATAAATCTTTTACTGTATTTTTGCAGTACTCTTTGTCTTTTGTTGCTGCTGTTTTAGTTGGATGTTGTAAGTTGAAttttttttttctacaaatgataattaaaaaaaaTCCACTGTCCGTCGCTCTCACATTTGGCCTTTTTTTCACTGTTTATTCTTGGATTTTGTTATTTACATACACAGTCTAATATAAGTGCAGACAAATTAAATCTATTTTaaaaaaaaaTCAGTAAATCAGAAGCCTTGTTACTTGGACTTCATTTTTCACCTTTTTCATTTCACTTCTTTAATCTTGTTCACTTCTGGGAATTCCCTCTAAAAAGTTCTCATACTTATACAGTAATCTGGGCAGTACACGAGAGTACAGAGTACACCTCTGTCTTGAAGTGCTGGTTTAAGTCCGGCTTGGCCATTATTTGCAAGGAGTTTGTATTTTCTTCCAGTGCCTGCTTGGTTTCCTCCAGTACTCCAAAAACAGACCAGTAACATaaaaaaaaaTCTTTTTAACGAATAAAAAAACAACACAAGGACAGTTTTTTAACTTTTAAATCGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)