Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6877839.3                       6 END     4           5       66                peroxiredoxin 6 [Xenopus laevis]

 This cluster: approximate FL confidence score = 94%

 1012768054 Xl3.1-IMAGE:7204009.5 - 71 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                           2     3     5     7     7     9    14    17    23    27    25    35    31    42    39    43    40    44    43    44    43    44    46    46    47    47    47    47    46    47    47    48    48    48    47    49    47    49    49    49    49    49    49    49    49    49    49    49    49    49    48    49    48    50    48    49    48    49    48    49    47    49    47    48    45    48    43    48    35    48    45    48    43    48    43    48    44    48    43    49    42    49    42    50    45    52    44    51    44    51    43    52    45    52    45    51    46    52    46    52    43    50    42    50    42    51    42    50    42    50    43    48    40    49    41    49    37    49    40    49    29    46    31    46    23    42    24    41    24    39    23    35    19    32    21    30    20    27    17    26    18    26    17    28    16    27    18    28    19    24    17    23    17    23    18    23    18    23    16    21    18    21    18    20    18    20    18    20    19    20    19    20    19    20    19    20    18    19    17    18    16    18    16    18    16    18    16    17    15    17    16    17    15    17    14    17    14    17    14    17    13    16    11    15    12    15     8    13     6     9     5     8     3     4     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCGTTACAGTGACAGCAGCAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAATAAATGAATTATCTACTGTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A--T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  C--------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T--------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---G---G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---C-------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A--G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C-------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              C-----------
                                               BLH ATG      84     838                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN      84     128                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MPR      18     128                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR      84      83                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               CDS MIN      84      37                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI      34      37                                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG      84       3                                                                                                                                                                                                                                                                                                                                                                                                                      
  5   1   2       bld Brn2 5g                          Brn2-za50d10.5p                                                                                                                                                                                                                                                                                                                                                                                                                           CAATGAAAAGCAGTTCCCGCCACCTCTCACTCTGGTGTGTGACAGACTTGTGCGCTCTGTGACAGCCGCTGTCGCCGCTATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCC
  5   1   2       bld Gas5 5g3  in                    IMAGE:3749769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGGTGTCTGACAGACTTGTGCGCTCTGTGACAGCCGCTGTCGCCGCTATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTACAACTTGGTATGCTTGACCCTGATGAGAAGGACATGCANGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATT
  5   1   2       bld Gas3 5g                           xlnga001c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGTGCGCTCTGTGACAGCCGTTGTCGCCGCTATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCTTCTGGAGCATGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGTACTGGCTGTGCAACTTGGTATGCTTGACCCTGATGAGATAGACATGCATGGGATGCCAGTGACTGCAAGATGTGTTTTCATC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4174926.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACAGCCGCTGTCGCCGCTATGCCTGGAATCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTGCAACTTGGTATGCTTGATCCTGATGAGAAGGACATGCAGGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGTCCTGATAAGAAAATGAAGCTT
  5   1   2       bld Ga12      in                         XL175j04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCTGCTAGGAGACGTCTTTCCTAACTTCGAGGCGGACACCACCATTGGCAGAATCAAGTTTCACGATTTCCTCGGGAATTCATGGGGTGTCCTTTTCTCACACCCACGGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGNGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTGCAACTTGGTATGCTTGATCCTGATGAGAAGGACATGCAGGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTT
  5   1   2       bld Lu1                             IMAGE:4057906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGCGGACACCACCATTGGCAGAATCAAGTTTCATGAATTCCTGGGGGATAGATGGGGAGTCCTTTTCTCACACCCACGGGATTATACTCCTGTGTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCAGAGTTCAAAAAACGCAATGTTCGCATGATTGCCCTGTCAATAGACTCTGTGGAGGATCATCTTGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCCCAGAGACACTACCCTTTTCTATTATTGGAAGATCCCAAAAAGGGATTCTG
  5   1   2       bld Tbd7      out                        XL082c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCACCATTGGCAGAATCAAGTTTCATGAATTCCTGGGGGATAGATGGGGAGTCCTTTTCTCACACCCACGGGNTTATACTCCTGTGTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCAGAGTTCAAAAAACGCAATGTTCGCATGATTGCCCTGTCAATAGACTCTGTGGAGGATCATCTTGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCAGATCCCAAAAGGGATCTGGCTGTACAGCTTGGTATGCTTGATCCTGATGAGAAGGACATGCANGGGATGCCGGTGACTGCAGAGATGTGTTTTTATCATTGGTCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATATTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTCCATAATGTTGCAACTCCAGTAGATTGGAAGCCTGGTGATCGAGTCATGGTACCCCCAACTGTTCCTGAAG
  5   1   2       bld Ga15      in                       XL440a24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGATTATACCCCTGTCTGCACCACTGAGCTTGGACGTTGTGTAAAGCTGGCTCCGGAGTTCAAAAAACGCAATGTTTCCATGATCGCCCTGTCAATAGACTCTGTGGAGGATCATCTCGGCTGGAGCAAGGACATCAACTCTTATAACTGTGATGAGCCCACAGAGACACTACCCTTTCCTATTATTGCTGATCCCAAAAGGGAACTGGCTGTGCAACTTGGTATGCTTGATCCTGATGAGAAGGACATGCAGGGGATGCCAGTGACTGCAAGATGTGTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGC
  3   1   2       bld Tad1                            IMAGE:6880681.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGTACCAACTTGGTAATGCCTTGCCCCCTGATGAAGAAGGACCATGCAGGGGATGCCCAGTGACTGCAAAGATGTGTTTCCATCATTGGCCCTGATAGGAAAATGAAGCTTTCTATTTGGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTGGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCTTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATAGATCCT
  3   1   2       chi Ga18      in                       xlk58d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGCCAGTGACTNNNNATNNNTTTTCATCANNNNCNTGATAAGNAAATGAANNTTNCTATTTNNNNNCNANNCNCTACTGNNAGNANTTTTGATGNANNTTTGAGAGTNGTGGATTCTCTNCANCTGACTGCAGTTCATANTGTTGCAACTCNGGTGGATNGGAAGCCGGGTGATCGAGTCATGNNACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGCGGCGTCTTCACCAAAGAGCTCCCTNCTGGAAAGAAATNCCTGAGATACACTNNACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGNNNNNATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGNATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAACTTCAGGTATTTTCCTCTAGTGCCTTTCAAGANANCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGNCCGCAGTCTATNNG
  3   1   2       bld Ga15                               XL425j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTTTTCATCATTGGCCCTGATAAGAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGCGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCCATTGGTGC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCATCATTGGCCTGATAGAAAATGAAGCTTTCTATTTGTATCCAGCCACTACTGGAGAAATTTTGATGAAATTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTCCACAGCCACAATAAGCAGCAATGAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTGACCGCAGTCTATATGATCCTATCTTCGATACAGAATCTTCATTT
  3   1   2       bld Ga12 5g3  in                         XL211m05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATGAAGCTTTTNTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGCGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAGTAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTCCTGCTAAATAAAT
  5   1   2       bld Skin                            IMAGE:8643509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAAATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGCGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAACTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAA
  3   1   2       bld Ga12      in                         XL175j04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGAAGCTTTCTATTTTGTATCCAGCCACTACTGGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTNTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTCCACAGCCACAATAAGCAGCAATGAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTAT
  3   1   2       bld Ga12      in                         XL179h19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAGAAATTTTGATGAAATTTTGAGAGTTGTGGATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTCCACAGCCACAATAAGCAGCAATGAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAATTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCTAAATAAA
  3   1   2       bld Ga15      in                       XL440a24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTCTCTTCAACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGGCAAGTAAAATATTTACATGCGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAGGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTA
  3   1   2       bld Ga12                                 XL201l11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGACTGCAGTTCATAATGTTGCAACTCCGGTGGATTGGAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATNTACATGCGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAGTAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCT
  3   1   2       bld Ga12                                 XL164j07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGCCGGGTGATCGAGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACGTGAGATACNCTCCACAGCCACAATAAGCAGCAATGAAACGGATACTTAANGAATTATCTNTTTGTCANCAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGC
  5   1   2       bld Egg1                            IMAGE:4678246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGTCATGGTACCCCCAAATGTTCCTGAAGAAGAAGCAAGTAAAATATTTACATGTGGCGTCTTCACCAAAGAGCTCCCTTCTGGAAAGAAATACCTGAGATACACTCCACAGCCACAATAAGCAGCAATGAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAG
  3   1   2       bld Ga15 5g3  in                       XL476p04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGCAAGTAAAATATTTACATGCGGGCGTCTTCACCAAAGAGCTCCCTTCGGGAAAGAAATACCTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGGTCTAAAACAGTTCAAAAAGCATGTCCTCAANGAGTCTATTAACTTTGAAGCCA
  3   1   2       bld Neu7 5g3  in                         XL006j01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAGCTCCNTTCTGGAAAGAAATACNTGAGATACACTGCACAGCCACAATAAGCAGCAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAACTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATNATTTAATAAAACCAAGTCATGTATGTTGACCGCAGTCTATAGATCCTATTTTTTCCG
  3   1   2       bld Gas5 5g3  in                    IMAGE:3749769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAATAAAACGGATACTTAATGAATTATCTCTTTGTCAACAACAATAGTGATTTATTCATATGCATGATTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAAAAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCTAAATAAATCTTGTACTTGAAATAAAAAAAAAATAGAAA
  3   1   2       bld Ga12                                 XL197n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAATAGTGATTTATTCATATGCATGAGTGATCTTTTTTGATCTTGTGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAGTAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCG
  5   1   2       bld Ga18      in                       xlk69m21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATTTTTTGGGANAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGNCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATNNNNATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGNNNNNNATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCTAAATAAATCTTGTACTNA
  3   1   2       bld Ga18      in                       xlk69m21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATTTTTTGGGACAGCAAATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGNNNNAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGGCATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGANANCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAANCCAAGTCATGTATGTTTGNCCGCAGTCTATA
  3   1   2       bld Bla1 5g3  in                    IMAGE:3380146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCAAAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGTTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAAGTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAAACAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCT
  5   1   2       bld Egg1                               PBX0028C10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGCAAATCTGAAATTCATCTGGAAGGGGGTCTAAAACAGTTCANAAAGCATTGTCCTCAATGAGTCTATTAACTTTGAAGCCAATGGCACATGAAGAGAACTGTTGCCCATGGGAAGTTGACATCCTGTGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAACTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCTAAATAAATCTTGTACTTGAATTATAAAGCTTTTTCCTGCTTTTAATCGGGACACCAAtttttttttAAAAAATGCATCTTGGATTTTGAATTACTNTATTTTGTCTCTTTAAATATGCTCTAGTTAATTACTTTTTTCTCTCCAT
  3   1   2       bld Sp1  5g3  in                    IMAGE:4174926.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGGCAACAAATGCTAGAAAATACCTTCACAATCCAGCATAACTGCGAGAAAATATCTTATGTATTATACTAGATGACTGCATGTTTTGAATTGGCTAGCCTATGAAATATTTTCAATAAACTTCAAAACTTCAGGTATTTTCCTCTAGTGCCTTTCAAGAAAGCCAGCAGGCACATAATCACTTTGCCAAAGACTTCATTGGTGCTGATGATTTAATAAAACCAAGTCATGTATGTTTGACCGCAGTCTATATGATCCTATTTTTTCCTGCTAAATAAATCTTGTACTTGAATTATA

In case of problems mail me! (