Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xl3.1-XL416j16ex.3.5                       25 END     1           2        4                (no blast hit)
     2   2.0    0Xl3.1-XL211m22.3                            5 END     4          10       80                PREDICTED: similar to Zgc:73061 protein [Gallus gallus]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7766984.5                      29 PI      93         74      912                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012768060 Xl3.1-IMAGE:6945716.5 - 37 ESTs
                                                                       ...-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6945716.5                                                                          GCGAGCATTTTAAAGTTTGTCGAGCTGGCTATGTGCGCATGAGCGGGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAA
                                                  Xl3.1-CHK-1012687432                                                                                ATTTTAAAGTTTGTCGAGCTGGCTATGTGCGCATGAGCGGGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAAAAAAAA
                                                      consensus depths                                                                               2     3     2     4     3     7     3     8     3     9     5    11     6    12     9    15    10    16    12    16    16    20    18    21    18    21    18    21    19    22    20    23    23    25    25    25    24    25    26    26    26    26    27    28    26    29    29    30    28    30    29    30    29    30    29    30    29    30    29    30    29    29    27    28    28    28    27    28    28    28    28    28    29    29    32    32    33    33    33    33    33    33    33    33    32    33    33    33    33    33    31    31    31    31    31    31    29    30    29    30    27    29    27    29    27    29    27    29    26    28    26    28    26    28    26    28    26    28    25    27    25    27    25    26    22    26    22    24    22    24    21    23    20    23    21    22    20    22    21    22    18    20    18    19    18    19     7     9     6     9     5     7
                                               BLH ATG     191     309                                                                          
                                               BLH MIN     119      79                                                                          
                                               BLH OVR     191     451                                                                          
                                               EST CLI      28       1                                                                          
                                               ORF LNG     191       9                                                                          
  5   1   2       chi Ga12 5g3  in                         XL189g07.5p GTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCAGTCACAGCAGGCAGACTGACATGTGGGGGCCACACAAGGTGTGTggggggggCATCCGGCCCGCCAGTTGGACAGCACTATTACAATTAGGACATTGAGTATGGACGATAGTGTGTGGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGA
  5   1   2       bld Ga12 5g3  in                         XL161d18.5p                                                                          GCGAGCATTTTAAAGTTTGTCGAGCTGGCTATGTGCGCATGAGCGGGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAG
  5   1   2       bld Ga12 5g3  in                         XL161n16.5p                                                                          GCGAGCATTTTAAAGTTTGTCGAGCTGGCTATGTGCGCATGAGCGGGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTC
  5   1   2       chi Lu1       in                    IMAGE:4057610.5p                                                                             ACAACAGAACTAGAAAGCAGGGAGATTGAAGGCCGGTGATCATGACGTGTGTGCTCAGCGGTTCCACCGCCGTGTGCGATGTCATTACAGAGCTAGATACTCAACTGGCTCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCAACTCCCAGTCCTACCTTTTGTCGCCGTCAAACGGGAACCAGGCCATGGGCAAACAGTACCTCCAGTGGGTAAAGGTTCCAGTTGCCAACCAGCTTGGAGGGAGGGCC
  5  -1   2       bld Te2N                            IMAGE:7203404.5p                                                                                          ACCCCTCCTTGAGGGTTAAAATAAGCCCGGGGGAAATGGCGGAACGTAACGTCCGGCTAGCCCGGAAAGCGAACAACAGAACTAGAAAGCAGGAGATTGCTTCTAGGCCCTGGGCTTCATACCCCAAAACAACGTGCTGACGTTCCCGATTGGGGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACAT
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328557.5p                                                                                              CGAGCTGGCTATGTGCGCATGAGCGGGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAAAGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTC
  5   1   2       chi Ga12      in                         XL191c02.5p                                                                                                 GCCACACAAGGTGTGTggggggggCATCCGGCCCGCCAGTTGGACAGCACTATTACAATTAGGACATTGAGTATGGACGATAGTGTGTGGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACAC
  5   1   2       bld Ga18 5g3  in                      xlk105a18ex.5p                                                                                                     CTGGCTATGTGCGCATGANNNGGTGAATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCNNNNNNNTACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTNCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGNTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTNAGAAGAAACTTCATGATCTNNTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGNATCTGCAGCCTGNCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGNTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTNGNTNNAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTNATTNNGAAAACTCAAAAGAAANAAAATCCATTTGTGACTTTGGACTTCTNNNNCCCTTTGCNNNNTGATCNTNA
  3   1   2       bld Ga18 5g3  in                      xlk105a18ex.3p                                                                                                                         CGGGGTGAATNCGTGNCGTAACNNCNCTANCNGGGAAAGCGANACAGANCTAGAAAGCAGGGAGATTNNTTCTAGNCCNNGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGNTGAACTCNNNNNNAAGCGCTCCAGATTATGAACCAGTTTTGGCNCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCANNCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGNAANCCTCTCACTGAGAAAGGGTTAANNNNCNCCTGNCTCCTTTTGTANANACATAG
  5   1   2       bld Te2N 5x3                        IMAGE:7202016.5p                                                                                                                            AATGCGTGACGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTNCAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTTGCACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGGATGGTTGGTGTAAATTAAACATGGGCGTGACTTaaaaaaaaaaaaaaaa
  5   1   2       chi Te1                             IMAGE:6929393.5p                                                                                                                                   GGGGTAACGTCCGCTAGCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAAACATGTGGATTCCAGGGTTTTGGTTCCAAAAGAAAATCCGGCCCCTATAAAAAAAGCTTGTACTACTTGGAGCACACCAACCAGAGGAATGGGCTTTTAATTTAAGAAAACTTCCAAAGGAAATTAAAATCCATTTTGTGAACTTTTGGACTTTCTGCCAATCCCCTTTTGCATTTCCTGATTCCTGAACACCTTTCAAGACTGTCCCCCGAATGAATTGGCAAAGGCCAAACCTTCTTTCAAAGAAAGAAACCTACTTTTTAAGGGGAAAAGAAAATT
  5   1   2       bld Ga12 5g3  in                         XL210l02.5p                                                                                                                                               GCACGAGGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCA
  5   1   2       bld Neu4 5g                         IMAGE:4084452.5p                                                                                                                                                   GCCGGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCANATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGG
  5   1   2       bld Te2N 5x3                        IMAGE:7765943.5p                                                                                                                                                      GGGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAANTAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCCTTCAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCTACTTTTAGGGAGAGAATT
  5   1   2       bld Ga12 5g3  in                         XL209a11.5p                                                                                                                                                       GGAAAGCGACAACAGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCNAGCTGCCACA
  5   1   2      seed Eye1 5x3                        IMAGE:6945716.5p                                                                                                                                                                    AGAACTAGAAAGCAGGGAGATTGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGAATTGTTTGGTGTATTAAAACATGGGCTGACNTN
  5   1   2       bld Ga12 5g3  out                        XL211n02.5p                                                                                                                                                                                       GAGGCTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAA
  3   1   2       bld Te2  5g3  in                    IMAGE:7208259.3p                                                                                                                                                                                          TGTTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGGTGACGTATCGCGATAGGTGAACTCCGAGATATAGCGCTCCAGATTATAAACCAGTTTGGCGCATGTGCACTGATCTACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCTTACTTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTATGAAGAAACTTCATGATATGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACGCAGTCCTGCTATTAAATTAAAACGAC
  5   1   2       bld Ga12 5g3  out                        XL211m22.5p                                                                                                                                                                                           CTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGA
  5   1   2       bld Te2  5g3  in                    IMAGE:7208259.5p                                                                                                                                                                                           CTTCTAGGCCCTGGGCCTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAANTA
  3   1   2       bld Ga12      in                         XL191c02.3p                                                                                                                                                                                                         CNTCATACCCCAAAACAACGTGCTGACGTATCCCGATTGGGTGAACTCCGAGCTAAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATT
  5   1   2       bld Neu7 5g3  out                        XL033b03.5p                                                                                                                                                                                                                                           ATTGGGTGAACTCCGNGNCTAAAGCGCTCCAGNATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGA
  3   1   2       bld Ga12                                 XL148o24.3p                                                                                                                                                                                                                                                              CTAAAGCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTGCGAGCCGCCACAG
  3   1   2       bld Ga12 5g3  in                         XL210l02.3p                                                                                                                                                                                                                                                                   GCGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATT
  3   1   2       bld Ga12 5g3  in                         XL161d18.3p                                                                                                                                                                                                                                                                    CGCTCCAGATTATGAACCAGTTTGGCGCATCTGCATTGATCAACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACA
  3   1   2       bld Ga12 5g3  in                         XL209a11.3p                                                                                                                                                                                                                                                                                                             AACCTGTCCAGTTTCTCTTCCTCTACCACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGAT
  3   1   2       bld Ga12 5g3  in                         XL161n16.3p                                                                                                                                                                                                                                                                                                                                    TACCACTCCCAGTCNTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGAT
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328557.3p                                                                                                                                                                                                                                                                                                                                      CCATTCCCAGTCCTACCTTTGTCGCCGTCAAACAAGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12                                 XL162d18.3p                                                                                                                                                                                                                                                                                                                                       CACTCCCAGTCCTACCTCTGTCGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTNTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCNTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGA
  3   1   2       bld Ga12 5g3  in                         XL189g07.3p                                                                                                                                                                                                                                                                                                                                                            CGCCGTCAAACAGGAACCAGCCATGGCAAACAGTACTCCAGTGGGTAAAGTTCCAGTGCCAACAGCTGGAGGAGGGCGTGCAAGTCCAGAAGCAAACCAAGTTCTTTCTAAGAAGAAACTTCATGATCTGGTTAGAGAAGTCGATCCCAATGAACAGCTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGA
  5   1   2       bld Thy       out                   IMAGE:8550533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAATTACTGTTGTTAGTGAGTCTGTTTGTTCATCCATGGACTCAGTCCAAGTAAAAGTAGTGTTGATGTCATATGGCCTGAGAGAGCTCTCCTGCAGTGAGATTAGGATTGTAATAGAACAGTAAAACTGTCATTTCAAGGCACAATCAACCTCTTGTATTTCTCAACATGTGCACTTTGCTTCTTGCTTTGTCTGCATTTCTTCATTTGTACATAGGCCCCACACAGTCATCGCTGATGCCTGGTCTGTGACGAGCAGCCTGAGCAGTCTCTGCCAAAGCGAAGTGAGCAGACCATACTGCTGTCGGCAGAGTTCTAGTAGGACCCAGA
  5   1   2       bld Ga15      in                       XL503g02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL503g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATGTTG
  3   1   2       bld Ga15                               XL504g02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAAGATGTGGAGGAGATGCTTCTACAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTTGCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATGTTG
  3   1   2       bld Lu1       in                    IMAGE:4057610.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGCTTCTCCAGATAGCAGATGATTTCATTGAGAGTGTGGTATCTGCAGCCTGCCAGCTGCCCCGACACCGCAAATCTAACACATTAGAAGTTAAGGATGTACAGCTTCATCTTGAGAGACAGTGGAACATGTGGATTCCAGGGTTTGGTTCAGAAGAAATCCGGCCCTATAAAAAAGCTTGTACTACTGAAGCACACAAACAGAGAATGGCTTTAATTAAGAAAACTCAAAAGAAATAAAATCCATTTGTGACTTTGGACTTCTGCAATCCCTTTGCATTCTGATCTTGACACCTTCAAGCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAA
  3   1   2       bld Ga12                                 XL163b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCAANCTGCCACAGATGAGTGCAGAGGCAACCTCTTCAGAGAAGAGCGATACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACGGAGAAAGGGTTAAATGAT
  5   1   2       bld Ga15      out                      XL504g01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACCTCTTCAGAGAAGAGCCTACTTTTAGGGGAGAGAAATTTTGCAACCCTCTCACTGAGAAAGGGTTAAATGATCCCCTGACTACCTTTTGTATATACATAGGATTGTTTGTGTAATTAAACATGGCTGACATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)