Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Nov 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6859906.5                      11 END     1           1        9                c-mos oncogene [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:3401846.5                       3 END     1           1       33                novel protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 95%

 1012768074 Xl3.1-IMAGE:6639550.5 - 79 ESTs
                                                                       ........-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6639550.5                             TCAAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGGGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685864                                   ATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGGGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAAAAAAAAAAAAACAAA
                                                      consensus depths                                  3     5     7     8     9    10    11    12    16    21    22    27    26    28    30    33    30    33    32    33    35    36    36    36    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    37    36    37    36    37    36    37    36    37    36    37    36    37    37    38    38    39    37    38    37    38    37    38    37    38    37    38    37    38    37    38    37    38    37    38    37    38    37    38    34    35    33    34    33    34    29    30    28    29    27    28    26    28    28    29    27    28    27    28    27    28    27    28    27    28    26    27    25    26    23    25    22    25    21    25    19    24    16    24    16    24    14    23    12    22    12    22    12    22    10    22    10    22     9    21     8    21     8    20     8    21     8    19     7    19     8    17     5    15     5    15     5    14     5    12     4    10     4    10     4    10     5    10     6    11     6    10     6    10     7    11     8    10     8    10     8    10     8     9     8     9     8     9     8     9     8     9     8     9     6     9     6     9     8    12     8    11     8    11     8    11     8    10     8    10     8    10     8    10     9    11     9    11     8     9     8     9     8     9     8     9     9    10    10    10    11    11    10    12    13    14    12    14    13    14    15    17    16    17    16    17    16    18    19    21    20    21    21    22    22    24    24    25    24    26    26    27    24    27    25    27    27    29    27    28    26    30    28    31    28    32    25    32    27    32    28    32    26    32    25    33    30    32    29    32    29    32    29    32    28    32    30    32    30    31    29    31    29    30    28    29    27    28    27    28    23    28    27    28    27    28    27    28    27    28    24    28    27    28    26    28    25    28    25    27    24    26    24    26    24    25    24    25    24    25    23    24    22    23    21    21    17    21     8    14     4     5
                                                                   SNP                                                                                                                                                     ----------G-
                                                                   SNP                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------A
                                               BLH ATG     112     890                             
                                               BLH MIN     112     305                             
                                               BLH MPR      -5     305                             
                                               BLH OVR     112      38                             
                                               CDS MIN     112      28                             
                                               EST CLI      36      28                             
                                               ORF LNG     112       9                             
  5   1   2       bld Oo1  5g                         IMAGE:5079208.5p TGGACCGGTCCGGAATTTCCGGGATCAATTCAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCCTGTCTACAGAACAATCCCTTGGTGTTGGACACAGGTTCTCAGTGGGGAGGAAACGTCTTCCTTCACAGGGCAGTGCCAGGGCACAGGGAAAGTCTTTATTTTATTAAAGGACGGATTAGTTGGGAGGCTCCTCCCACCCCAAAAGGTACTTTACCGCC
  5   1   2       bld Egg3      in                    IMAGE:3378471.5p                 CCGGGGGCAAATTCAAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGTGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGATAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGA
  5   1   2       bld Egg1 5g                            PBX0069G09.5p                         CACGAGGAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGAACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTC
  5   1   2       bld Oo1  5g                         IMAGE:6860963.5p                          AGGCTGGTCCGGTCCGGAATTCTCCGGATCGCTGCTGTCACTGATTGTTGTATCACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGAACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAAGCCCACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTTCTTCACGGCAGTGCAGGCACAGGAAAGTCTTATTTATTTAAAGAGGATTGTTGGGAGCTTCTCCCACCAAAAGTACTTTACCCCA
  5   1   2      seed Ov1  5g3  in                    IMAGE:8328039.5p                           ATTCAAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATG
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437368.5p                               AAAAATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGGCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACANAGGAGTGAA
  5   1   2       bld Egg4 5g3  in                    IMAGE:3744838.5p                                   ATACAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCGCGTATGTTCGAAACCATCAGCCCAGTG
  5   1   2       bld Ooc2 5g                         IMAGE:3745934.5p                                      CAACTTGTGTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCC
  5   1   2       bld Ga12 5g3  in                         XL164a01.5p                                              GTAGCTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCG
  5   1   2       bld Ooc3 5g                         IMAGE:3437370.5p                                                  CTCTCGCTGCTGTACACTGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGGCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACATGCTAATGAGATGCG
  5   1   2       chi Ga15 5g                            XL481l19ex.5p                                                      GCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGTAGGAGCCACGGGCAGCTGATGTGCAAGGAAAATGATGTTGGGCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074248.5p                                                       ACCCACGCGTCCGGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGT
  5   1   2       bld Oo1  5g                         IMAGE:6638129.5p                                                                   TGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTTGGTGTTGAACACAGTTCTCAGTGGGAAGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCCAAAGTACTTACGGCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGGGGGCACCACTCTACATGG
  5   1   2       bld Oo1  5g                         IMAGE:6856875.5p                                                                   TGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCCTTGGTGTTGAACACAGTTCTCAGTGGNGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTTATAAAAGAAGGATAGTTGGGAGCTTCTCCCACCCAAAAAGTACTTTACGNCCACAAGCAAGGTACTGGGAGTTAACCAGCATTGGTCAC
  5   1   2       bld Oo1  5g                         IMAGE:6856901.5p                                                                   TGATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTTAAGGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCA
  5   1   2       chi Oo1                             IMAGE:5079302.5p                                                                     ATTGTTGTATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAANGCAGAATNNNCCAACNTTNTTTCCACCCCCGGTTTTTTATCCCGAGATGGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAATATCCAGCTTTTTATATCGAAATGGCCCCGACGACAAGTTAAAGGACTTTTTGAAAAACCCTCCTAAATAAACATGGAAAACTTGGGGaaaaaaaaaaaaaaaacccggggggaaaaagaaaacacacacccccccccccTTTTATTATTATTGNNNNNTGGCGGCACCGTTTTTTTTAAAAAccccccccccccgcgggaaaaaaaaaaagaaaaattggcgccgccccctggtnnnnnnaagggnnnnnnaagagnngcggcagcggnggncnggaggnnnnntcnnnnnnnnnnnnnnnncccnncccccggggggnnnnggggncntnnnngnagggggttnagggcgacacgtcgagggggAAGAGCGGCACCCCGTGAGGGGGGCTTGGGAGGAGGCGGCNGGAGGTGGGGACTTTATGTATCCCCCCTCGTGGGAGGGAGGGGGAGGGAGCACNNNTNNTAGGCGGCCNNNNNNTTAGGGCGAGCTNGGTGAGGGGAGGTGTGGGGGGANNNCCGGCTANCCNNACCCNCCNTCACGCGGAGGGGNNTggggagggggggggggggNCGTNNNNNNTCACTTAGG
  5   1   2       bld Egg3 5g                         IMAGE:6871385.5p                                                                         GATTCCCGGGAGCGATTCCTCGGTCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAAAAATCCTTGGTGTTGAACACAGTTCTTCAGTGGGAGGAACGGTCTTCCTTTCCAGGGAAGGGCAGGGCACAAGGGAAAAGCCCTTATTTTATTAAAAGAAAGGATTAGGTTGGAAGGCTCTCCCCAACCCATAAAGGTACCTTACGGCCCCACAGCGCAAGGTAACGGTGAAGGTAGACACCCATGGTTCCAACATATTGGGTGGGGGACCACACTTTCCTTACAATGTGTGGATGTTAG
  5   1   2       bld Egg3 5g                         IMAGE:6871011.5p                                                                         GATTCCCGGGAGCGATTCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGGCAG
  5   1   2       bld Oo1  5g                         IMAGE:6643245.5p                                                                           CTGGACCGGTCCGGAATTCCCGGCATCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTTCACATTGGTGGCACCACTCTACTGCGTTTGGCAGGGTAATGGGTTCTGGAAAAAGCCTCTCTAGAGCAATGCATT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404594.5p                                                                            TATTACAGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAA
  5   1   2       bld Oo1  5g                         IMAGE:6638674.5p                                                                             GCATCAGCGATTCCATCGGGCTCCCGGTGTCTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAAGATCCGGCTGTCTACAGAACAATCCCTTGGTGTTGAACACAGTTCCTCAGTTGGGGAGGGAACGGTCTTCTTCACCAGGCAGTGCAGGGCACAGGGAAAGTCTTTATTTTATTAAAAGGAGGGAT
  5   1   2       bld Oo1  5g                         IMAGE:6638457.5p                                                                                CACGCGTCCGCATCGCGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAAGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGNAGCTCTCCCACCCAAAAGTACTTACGCCACAGCCAAGTACTGGGAGTAGCAGCATGGTCACATTGGGTGGGCACCCACTCTACATGGCGTTTTGGCAGGGTATTGGGGTTCCTGGGA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5047576.5p                                                                                 CAGCGATTTTCTCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGG
  5   1   2       bld Oo1  5g                         IMAGE:6639550.5p                                                                                  AGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGGCACACTCTACATGCGTTTGGCAAGTATTGGGTTCTGGGAAAAGCCTCTCTAGAGCAATGCATTGAATTTGGCCAAAGAGACCTGGGGNTACGCCCAGCACTGGAACAAGC
  5   1   2       bld Oo1  5g                         IMAGE:6640470.5p                                                                                  AGCGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTACCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGAACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGGAGTAGCAGCATGGTCACATTGGTGGCACCACTCTACATGCGTTTTGGCAGGGTATTGGGTTCTGGGAAAAGCCCTCTCTAGAGCATGCATTGATGA
  5   1   2       bld Oo1  5g                         IMAGE:5084695.5p                                                                                    CGATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGGAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGGCCAGCAAAAAGCCAACACTGGCAATGCCTAAACAAGATCCCGGCTGTCTACGAAACAATCCCTTGGGGTTGAACACAGGTTCTCAGTGGGGAGGAACGGCCTTCTTTCAAAGGCAAGGGCAGGGACCAGGAAAAGGCTTATTTATTAAAAGAGGGAAATTTTGGAACCTTCTcccccccaaaaggaacttaccccccccAGCAAGGTAACTGGAATAAACAAACTGGTCCACAATTGGGGG
  5   1   2       bld Ooc1 5g3  in                      xlnoc003g02.5p                                                                                     GATTCCATCGGGCTCCCGGGGTTTTGTCAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGAATCCACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCA
  5   1   2       bld Egg3 5g                         IMAGE:6323290.5p                                                                                                   CCCCGGGGTTTTGCAGTCTGATGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGNAGTAGCAGCATGTCACATTGGTTGGCACCACTCTACATGCGTTTTGCAGGTATTGGGTTCTGGGAAAAGCCCTCTCCTAAAGCAATGCATTTGAATTTGGCAAAAGAGAACCTGGGGGGTACGCCAAGCA
  5   1   2       bld Ov1  5g                IMAGE:6318023-IMAGp.IMAGp                                                                                                              GGGGGGAATCCCGGGCTTCCAACTGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTT
  5   1   2       bld Ga12      in                         XL175p22.5p                                                                                                               GGTNGTCTGAGGATCGGCTTCACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCGCGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCAGATCTCAGGCCCAGCAAAAAGCC
  5   1   2       bld Oo1  5g3  in                    IMAGE:5077968.5p                                                                                                                CAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGA
  5   1   2       bld Ov1  5g                         IMAGE:6318023.5p                                                                                                                CAGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTANACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAAGGACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTTATTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACCATGGTGGCACCACTCTACATGCGTTTGCACGTATTGGTTCTGGAAAGACTCTCTAAAGCATGCCTTGAAATGGCCAAGAGACCTGGGGTACCCCGCACTGGACAGCTGCCAACTCCAATCATGGATGAAAACTCCAAGGTTAAAAGAAAATTTCCTTGAAAAACCTTGAGGCTGTTGCTAAGGGCTGGGCGTGGAAAAAATGAACA
  5   1   2       bld Ooc2 5g                         IMAGE:3745789.5p                                                                                                                 AGTCTGAGGATCGGCTTCAACGAGCGGTACAGGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATTCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTTATTAAACATGAAGCTGGGAAGAAAG
  5   1   2       bld Oo1  5g                         IMAGE:3403308.5p                                                                                                                                          GGTACAGGAAAATGATGCTGGCCGAACAGCTGTCTCCAGAAATCCACAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAG
  3  -1   2       bld Egg3      in                    IMAGE:3379357.3p                                                                                                                                            TACAGGAAAATGATGTTGGCCAAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCA
  5   1   2       bld Tbd7 5g3  in                         XL055a18.5p                                                                                                                                                GGAAAATGATGTTGGCCGAACAGCTGTCTCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCAGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGA
  5   1   2       bld Oo1                             IMAGE:5080027.5p                                                                                                                                                                            TCCAGAAATCCAGAGCAGCATCACTATAGAGTATCTTAATTCTTCTGGGCAGGCTCTGAAGCGCAAAGTAATCCGTAATTCTTTCATCTCCCTTGGACGCAATGAATTCCGCGACCTTGTCTTGAAGGTTAGCGATGGAAAACTTCAACAGAACTTTGTCATAAAGCAGATCCAACTTTTCACCCGTTTTATCCGAGATGGGAAAGCTTCAGTTGTGCTGCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTANAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGGGGCACCACTCTACATGCGTTTGGCAGTATTGGTTCTGCAAAAGCCTCTCTAGAGCAATGCCTTGAAATTGGCAAAAGAAACCTGGGGGTACGCCAGCCATTGGGACCAAGCTGCAAAAATCCTATTCAT
  5   1   2       bld Oo1                             IMAGE:6642569.5p                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCCAGAAAATATCCAGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGAACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGTGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAGAACAAAGTTCTGGTTTCAGGGGCAGAAGCTGGAAGGAAATGCATTCATGCTGACCATGGNAANTTAACTGAAGG
  5   1   2       bld Oo1                             IMAGE:6642219.5p                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTTTTAATATCGAATTGCCCCGCAGACAAGTTAAAGCACTTTATGAAAACCCTCCTAATTAAACATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAAGTTGGGAGCTCTCCCACCCCAAAAGTACTTACGCCCACAGCAAGGTACTGGGAGTTAGCAGCCATGTCCACATTTGGTTGGGAACCCACTCTTACATGGCGTTTGGCAGGGAATTGGGGTCCTGGGAAAAAGCCCTTCTCCTAGAAGCCATGGCCATTGGAATTTGGGCCAAAAGAAAACCCTGGGGGGGAACGCCCCAGCACTTGGGGAAAAAGCTTTGCCAAACCCTTCCTAAAATCCTttggagggaaaaatctccaatggggaaaaaaaggggaaaaagggtccctttggaaaaaaGACCTTTTTAAGGGCCTGTTTGCCCAAAGGGCCCTTGTGGCCCCTGGGGGTAAAAAAGGATGTGAAACCCCGGGTTTTGGGGG
  5   1   2       bld Oo1                             IMAGE:5079572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGAAGCTGGGAAGAAAGAGAAGCCGGTGAATGAACGCACTCGCCTTCTATCTGGGCTGCCACGTATGTTCGAAACCATCAGCCCAGTGCAGAAAAAAGATGTGGAACAGGCTAATGAGATGCGGGCCAAGGCCAACTCTGAGACTCCAGTAAAGGGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGGGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTTCTCCAGTCACTCAGGCCTCAAGCCAAAACAAAGTTCTGTTTTCCAGGGCAAAGAGCTGGNAGGAAATGCATTCATCCTGACCANTGGAAATTANCCTGAAAGTCAGGGAGAACAAACTGGATAAAAAACTTTCTTTTCTTCTGCTTGCAAGCTTATTCCGACCTTGGGA
  5   1   2       bld Ooc1                   IMAGE:3746238-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGAAGGGACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTCTTCACAGGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGGGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGGAAATAACCAATGAGCGTC
  5   1   2       bld Ooc2      in                    IMAGE:3746262.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTGAGTCACAAAGGAGTGAATGGAGGTAACAGATGCCAGCAAAAACGTACACGCACAGAATCTTCTAACAGCCTAATTGCGGATCTCAGGCCCAGCAAAAAGCCAACACTGTCAATGCCTAAACAGATCCGGCTGTCTACAGAACAATCCTTGGTGTTGAACACAGTTCTCAGTGGGAGGAACGTCTTATTACAAGCAGTGCAGGCACAGGAAAGTCTTATTTATTAAAGAGGATAGTTGGAGCTCTCCCACCCAAAAGTACTTACGCCACAGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGATCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGACAAAGAGACCTGCGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTATTTGATAAGCTTGAG
  5   1   2       bld Neu7      in                         XL038o09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCAAGTACTGGAGTAGCAGCATGTCACATTGGTGGCACCACTCTACATGCGTTTGCAGGTATTGGTTCTGGAAAAGCCTCTCTAGAGCAATGCATTGAATTGGCAAAGAGACCTGGGGTACGCCAGCACTGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCACTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCC
  3   1   2       bld Egg3      in                    IMAGE:3378471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGACAAGCTGCAAACATCTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGC
  5   1   2       bld Tbd7      in                         XL072k08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGCAAACATCTAATCATTGNTGAGNATCTCTATGGTAGAAGGAGNAGTTCTTTGNTAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGTTTGGTGAATGGAGCACGTGGCCGTCGTTATCAAGTTTGAAGA
  5   1   2       chi Tad2      in                    IMAGE:6872796.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAATCATTGATGAGATCTCTATGGTAGAAGGAGAGTTCTTTGATAAGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTATATGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAAGATCTAGATGTGTCTCGTGGGCTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACCTACCAGTAGTTTCGGGTTTCTGTGGTGGTGTCCCCTGAAGGGTATTAAAGCCCTGAACCGGCTGGGGTTGTTTCCAAGGGACCCCGGGTGGGAAATATTTCCTGGAAGCCCGAACAGCCCAGCCTGGCCCTTCCTAAAAGCCTGGGGCACATGGGGGCA
  5   1   2       bld Egg3                            IMAGE:6870491.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCCCGGGGCTTGAGGCTGTTGCTAGGGCTGTGCGTGGTAAAGATGAACCGTTTGGTGGCATTCAACTTATTGTATGTGGTGACTTCCTTCAGCTTCCTCCAGTCACTCAGGCCTCAAGCCAAACAAAGTTCTGTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGGCAAGCTTACGTTGCTCTCTCCAGAGCTGAAAATCAGAGGGTCTCCGAATTATGGACTTGACCCCAGGTTGTTCAAGCCATCCTATGTTCTACATTCCGCCTCAATGGaaaaggaaaaaattggcaaaaattcccttgagaatcccggaccaaaaaatgctgaatggggaaaatTGAAC
  5   1   2       bld Egg1                               PBX0129A04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCCAGGGCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTG
  3   1   2       bld Tad2      in                    IMAGE:6872796.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGGAGGAAAGGCCCATTCCTTCCGACCCATGGAAATTATATGAAGTCCGGGAGACAAACTTGATAAAAAACTTCCATTTCTCTGCTGCCAAGCTATCCGACTTGGGCAGATTACCAGATGATGTCGCAAGGCCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGGCTACGAGGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTACCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTGTAATAAGCTGTAAATAGTGCCCGTATTTGGAA
  5   1   2       bld Egg1                               PBX0080H07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAAGAGCTGGAGGAAATGCATTCATCTGACCATGGAATTAACTGAAGTCAGGAGACAAACTGATAAAAACTTCATTTCTCTGCTGCAAGCTATCCAACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTACAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATCAAGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAACAGATTCAGCTGAAGAAAGGGGCTC
  5   1   2       bld Egg1                               PBX0099F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTATCCGACTTGGCAGATGTACAGATGATGTCGCAAGGCAGCTTCTCCAAACCACTAACCATAAAGTTGAGCGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTC
  5   1   2       bld Oo1                             IMAGE:6642572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAGATGGAATTCTGGCTACGAGGCTGTGCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGTTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATAtttttttttttttttaataaagattttaaaaccccccctatcactctacccccccTCGCGCACACGTTCACCCCAAAAAAGGGCGGCCCCGCCTCTTAGAGAAATCCCCTCCCCAGGGGGCCCCAAACGCTTTAACCCGGAACCCCCACCA
  3   1   2       bld Ga12 5g3  in                         XL164a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACTCACAAAGATGATGTGGAAATAACCAATGAGCGTCGTNTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGNTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATNTGAGCCGACAGCAGCTGCCTNTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATNTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTNTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTA
  3   1   2       bld Egg4 5g3  in                    IMAGE:3744838.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGATGTGGAATACCCAATGAGCCGTCGTCTTCAGCAGTTACCTGAAGAATCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGTTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAAAA
  3   1   2       bld Egg4                            IMAGE:3744839.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAATTAGCCATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCATTTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAGAACTATATATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGATAGGGCCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGTTTGGTGAATGTAGCACGTGGCGTCGTTATCAAGTTCGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGCGTCACTGAGGTCATATAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAAGATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATCAAAGCCAGGGAATGTCTTTGGACTGTGCGGGAATCTCACTGTCTCGTG
  3   1   2       bld Tbd7      in                         XL072k08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAACCAATGAGCGTCGTCTTCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTANATGTGTCTCGTGGTTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATNTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTANAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTTAAATAAAGATTTTAAAAA
  3   1   2       bld Egg4 5x3  out                   IMAGE:3744911.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGAGCGTCGTCTCCAGCAGTTACCTGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATANATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGCCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAAAAA
  5   1   2       bld Egg1      in                    IMAGE:4783256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAATCCCATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGCCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATTTTTTTTTTTTAAATAAAGATTTTAAAAATTAAAAAAAAAAAAAAAAA
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3437368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTCATATGAGGCTCTGGACAGTGACCCTATGCTGGTGAAAACTATAAATGCTCAGTGTCCTGTACATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATTAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATTTTTTTTTTTTAAATAAAGATTTTAAAAATGACAATAAA
  3   1   2       bld Gas7                            IMAGE:4083553.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGTGAAAACAATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATTTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGGGGCCCAA
  3   1   2       bld Tbd7 5g3  in                         XL055a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAA
  3   1   2       bld Neu7      in                         XL038o09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAA
  5  -1   2       bld Egg3      in                    IMAGE:3379357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTATAAATGCTCAGTGTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATAttttttttttaaataaagattttaaaaaaaaaaaaaaaaaaaaaaacaaaaaaataacaaaaaaaaaaaaaaaaaaGCGGCCCCCGG
  3   1   2       bld Ga12      in                         XL175p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCCTGTAAATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTANATGTGTCTCGTGGTTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATNTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATNTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTNTACCATCAAATGCAGAAGNAGAGAGCATTGCNNCAGACTTTCCCTTGA
  3   1   2       bld Egg1      in                    IMAGE:4783256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCAGCAGATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5047576.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCAGCTGAAGAAAGGGGCTCAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGAA
  3   1   2       bld Ooc1 5g3  in                      xlnoc003g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGAGAAAGGGGCTCAGGGTGATGCTGGCAAAGAATCTGNATGTGTCTCGTGGCTTGGTGAATGAAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGAAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGAAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGATGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAATGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAAAAAAAAAAAAAA
  3   1   2       bld Oo1                             IMAGE:5077985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGCTCAGGTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTTTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGAAAAAAAAAA
  3   1   2       bld Ooc2      in                    IMAGE:3746262.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGTGATGCTGGCAAAGAATCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTAGGTTTCTGTGTGGTGTAACTGAGGTTATAAAGCCTGACCGAGGGGTGTTCAAAGGACTCGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAGAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCAAGCCAATCCATATGTTCTACAGTTCTACCATCCAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTAAATAAAGATTTTACCCATCCCAA
  3   1   2       bld Oo1  5g3  in                    IMAGE:5077968.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGATGCTGGCAAAGAATCTAGATGTGTCTCGTGGCTTGGTGCATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGAAAA
  3   1   2       bld Egg4                            IMAGE:3743293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGGATGTGTCTCGTGGCTTGGTGAATGGAGCACGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGACAAAAAAAAA
  3   1   2       bld Oo1  5g3  in                    IMAGE:3404594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGGCGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGCCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTAGCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074248.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGTCGTTATCAAGTTTGAAGAAGGCAACAAAAACTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGA
  3   1   2       bld Egg2                            IMAGE:5278847.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCCGAGGCTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCCCTGAGGTTATAAAGCCTGCCCGCTGGGTGTTCAAAGGACCCGGTGGAATATATTTGAGCCGACAGCAGCTGCCTTTAAAGCTGGCATGGGCTATTTTTTTCCATAAAAGCCAGGGAATGTTTTTGGACTGTGTGGAAATCTCATTGTTTCGTGTCTTTGAGAGTGGCCAAGCTTTCGTTGCTTTTTCCAGAGCTAGAAATTTAGAGGGTTTCCGAGTTATGGACTTTGCCCCCAAGGTTGTTCGAGCCAATCCATATGTTTTCCAGTTTTCCCATCAAATGCAGAAGGGGAGAGCCTTGCGCCAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGGGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTCCAGAATTTTATATATTTTTTTTTTAAATAAAGGTTTAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg1                            IMAGE:3301024.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACGAGGCTTGCCAGTAGTTCGGTTTCTGTGTGGTGTCACTGAGGTTATAAAGCCTGACCGCTGGGTGTTCAAAGGACACGGCGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTA
  3   1   2       bld Egg6                            IMAGE:4412579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCCAGTAGTTCGGTTCTGTTTTGGTGTCATTGAGGTTTATAAAGCCTGCCCCCTGGGGTGTTCAAAGGGACACGGTGGAATATATCTGAGCCGACAGCAGCTGCCTCTAAAGTTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGNACTTCCCTTGATGACTTTCCTGGACAAAAGAAAATTGCTGACNTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAA
  3   1   2       bld Oo1  5x3  out                   IMAGE:3403298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCGGTCTCTGTGCGGCGTCACTACGGTTATACAGCCTGTCCGCTGGGTGTACACAGGACCGGTCGCCATATATCTGAGCCTACAGCAGCTGCCTTTAAAGGTGGCATGGGCTATTTCTATCCATAATAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGCTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTCATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATATTTTTTTTTTAAATAAAGATTTTAAAAATGA
  5   1   2       bld Oo1                             IMAGE:5084872.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAATATANTCTGAGCCGACAGCAGCTGCCTCTAAAGCTGGCATGGGCTATTTCTATCCATAAAAGCCAGGGAATGTCTTTGGACTGTGTGGAAATCTCATTGTCTCGTGTCTTTGAGAGTGGCCAAGCTTACGTTGCTCTCTCCAGAGCTAGAAATCTAGAGGGTCTCCGAGTTATGGACTTTGACCCCAAGGTTGTTCGAGCCAATCCATATGTTCTACAGTTCTACCATCAAATGCAGAAGGAGAGAGCATTGCGACAGACTTCCCTTGATGACTTCCTGGACAAAGAAAATTGCTGACTGTGTGATATTTGTATTAATGTTTGGTCTATTAAGCTGTAAATAGTGTACAGAATTTTATATAtttttttttaaataaagattttaaaaattaaaaaaaaaaaaaaaaaaaaaaaGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)