Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012768076 Xl3.1-Lens-W007.5 - 50 ESTs
                                                                       ...-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xl3.1-Lens-W007.5                                                                                                                                                                                                                                                                                                                                    ACTGCTCCGCGACATTAGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGGTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGTCTGCCCTTAGTGACACCAGTGCAACTTTTGTGTCTTGCAATTCAAACAAAAC
                                                  Xl3.1-CHK-1012686667                                                                                                                                                                                                                                                                                                                                          CCGCGACATTAGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGGTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGTCTGCCCTTAGTGACACCAGTGCAACTTTTGTGTCTTGCAATTCAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                         3     4     3     5     7     9     8    11    12    14    15    16    17    19    18    19    20    23    22    23    23    23    23    23    22    23    24    24    23    23    23    23    23    23    23    23    23    23    23    23    22    23    23    23    21    22    22    22    23    24    23    24    23    24    22    24    23    24    23    24    23    24    22    24    22    24    21    24    19    24    19    23    19    23    18    23    18    23    18    22    17    22    17    21    17    21    17    22    17    23    18    24    18    24    19    25    19    25    19    26    18    25    19    26    19    25    17    23    17    22    18    23    19    23    19    23    17    22    18    22    19    23    19    24    20    24    21    25    19    22    18    21    17    19    17    18    16    17    16    17    16    18    17    18    16    18    17    19    17    19    18    20    18    20    18    19    18    19    18    19    18    19    19    20    19    20    18    20    21    21    21    21    22    23    23    24    22    24    23    24    23    24    22    24    22    23    21    23    22    23    22    23    22    23    21    23    21    23    20    23    20    23    20    22    16    20    17    20    17    20    17    18    17    18    11    17    11    17    11    15     8    10     7     9     7     9     6     8     6     8     6     6     5     6     4     4     4     4     4     4     4     4     4     4     3     4     2     4     2     4     2     4     2     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                C-----------
                                               BLH ATG      67     821                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN      55     173                                                                                                                                                                                                                                                                                                                                    
                                               BLH MPR      31     173                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR      67     176                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI      14       5                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG      67      13                                                                                                                                                                                                                                                                                                                                    
  5   1   0       add Tbd7      in                         XL095a04.5p GCGCAGTCTCAGGTTCCCCGGCTCCTGTGGATTTATAACTCCCACCCGGGCGTCGGGGGATGCTGGGAGCTGCTCAGCTGTCACTCACCTTTAGCCGGAGAGCCGAGGCGTTACAGCCCATCTGGTCACTAAGCGCTGTGCCCACAACCTATTACACACCGCCCCTCAAGCCCCATTAAATCCATTACTCACTCAGCCCTGCTATCCCTTCACCAAACACCCCCACATACTTTCCAGGCTAAGCAGGAACACGTTCTTCTCCGGGGAACTACAATTCCCGTCATACAT
  5   1   0       chi Ov1                             IMAGE:6316515.5p                                    CCACGCGTCCGCTCCCACTCGGGCGTCGGGGGATGCTGGGAGCTGTCACTCATCTTTAGCCGGAGAGCCGAGGCGTTACAGCCCATCTGGTCACTAGGCGCTGTGCCCACAACCTATTACACACCGCCCCTCAAGCCCCATCAAATCCATTACTCACTCAGCCCTGCTATCCCTTCACTAAACACCCCCACATACTTTCCAGGCTAAGCAGGAACACATTCTTCTCCCGGGAACTACAATTCCCGTCATACATCGGGTTAACAAAGTGGTGTCGCGTGGGTTTACGTCACTGCTCCGCGACATTAGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTANGACAGCATATTCTGAAGAATCCCTGATTGTGAACAGCATTATTGGATAAGGCTGCGAATAAGACCTACAGAATGGGGTGCTTTGGAAGTTGGGGCCCCGGTAACTTGGTAAACATTGACCCATGGAAGCTTGGTTaaaaaaaaggccaaaaaaaGGGGGGAATTTGCTTTGGGGGAAAATTTTGAGACCCCACCCCCCTTTTGGTTTTGCCAAAAAAGCCTCCCCACaaaaaaaaaaGAGAGTCCCCCCAAAGGGGGCTC
  5   1   2       bld Emb1 5g                         IMAGE:6631419.5p                                                                                  CACTCATCTTTAGCCGGAGAGCCGAGGCGTTACAGCCCATCTGGTCACTAGGCGCTGTGCCCACAACCTATTACACACCGCCCCTCAAGCCCCATCAAATCCATTACTCACTCAGCCCTGCTATCCCTTCACTAAACACCCCCACATACTTTCCAGGCTAAGCAGGAACACATTCTTCTCCCGGGAACTACAATTCCCGTCATACATCGGGTTAACAAAGTGGTGTCGCGTGGGTTTACGTCACTGCTCCGCGACATTAGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCAGGGGTTGGCGATGTTTTGAAGACAGACCTGNCCttttttttGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAAATGTGCCGGGGCTGATGTTTCCAGAGAAGAATTTGCTATGCGGCTTGGGTGGCCAAACCAGGGAGACAAAACTGGTACTGCAAGACTTTTCCATTAAACACTTCAGCCTCCTTTGGGGTCGCGGGTTGG
  5   1   2       bld Em10 5g                         IMAGE:7978919.5p                                                                                       CTCACCTTCAGCCAGAGAGCCGAGGCGTTACAGCCCATCTGGTCACTGGTGCGCTGTGCCCAAACCTATTACACACCGCCCCTCAATCCCCATTAAATCCATTACTCACTCAGCCCTGCTATCCCTTCACCAAACACCCCCACATACTTTCCAGGCTAAGCAGGAACACATTCTTCTCCCGGGAACTACAATTCCCGTCATACATCGGGTTAATAAAGCGGTGTCGCGTGGGCTTACGTCACTGCTCCGCGACATTAGGCCGACACCACGTTGGGATCTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAACTCCTTCT
  5   1   2       bld Tad2      in                    IMAGE:6873378.5p                                                                                                                                                                                                                                                                                                                                    ACTGCTCCGCGACATTAGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAAATTAACTTTCAAGGAATGGGGATGGGCCTGTGTGCGGGATTTGCGGTTGGTTCGGaaaaaataaaaaCCCCTTGGC
  5   1   2       bld Emb4 5g                         IMAGE:4680720.5p                                                                                                                                                                                                                                                                                                                                           CACGCGTCCGGGCCGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTACACAAGTCACAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGGCTTTTTTGGATCTGTCCCAGGCTGACTTGCCTTATCGGATTTCCTCCCCATGGGGTTTCAAACTCGTTCTTCACCGCGCGTTGGTGAGATGTGGC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074627.5p                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGCCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCGAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGAC
  5   1   2       bld Te1  5g                         IMAGE:6929364.5p                                                                                                                                                                                                                                                                                                                                                       GGGACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAAACAGGAGACTGACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTTCACGCCCCCCTCCGAAAAGTGGAAACCCGTTGTAAGTCCCGGGATAGAAACCCAAAAAATCCTTCCACCCTTCTCATTTAAACTTTCCAGGGAATGGGGAAGGGGCCTGGGTGCCTAATTTGCGTTTTTGGTTCGGGaaaaaataaaaaaCCCCTTTGGGACGCCATT
  5   1   2       bld Te2N 5g                         IMAGE:7205796.5p                                                                                                                                                                                                                                                                                                                                                         ATGACACCACNGTTGGGATCTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCNGAAAAATAAACCCTTGCAGCATCTTTCAATTCACAGCCGTGCCAGACTGCTTGAGAAAATTACAGAATCCCTGCTCACTGCATAACTTTTCGTACCAAAAAACTTCGTATGCAAAAAGAAGAAAGGAACCTCCAGAAACCGGGTTTCGGGAAAACGGGCCCGTTTCAGGGATTTTGATGAATT
  5   1   2      seed Lens 5x3                            Lens-W007.5p                                                                                                                                                                                                                                                                                                                                                          ACACCACGTTGGGATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Neu7 5g3  in                         XL033g09.5p                                                                                                                                                                                                                                                                                                                                                                    GATCTTGTTGTAAGTGCCACAGTAAACAGGGNAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCATTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCT
  5   1   2       bld Ga15 5g3  in                       XL506j17ex.5p                                                                                                                                                                                                                                                                                                                                                                       ATCTTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGA
  5   1   2       bld Te2N 5g                         IMAGE:7204149.5p                                                                                                                                                                                                                                                                                                                                                                          TTGTTGTAAGTGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCCATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGGACTGGTAACATGACCATGAAGCTGTTAAAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACCCCTTGTTGCAAAACTCCCaaaaaaaaTCCAAGGGTCGGCAGTTGCCAGTAAACTCCCAGTCATGGTTGGCGAAGTTTTGAAAAACGAACTGCCTTTTTTTGATTTCCGTGTGGGTAACTTGGCCTATCAAAATTCCTCCCCCttttttttccaactccctcctccccgtccctttttAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGTATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCNAATCCACAGCCCGTGCAGAACTGCTTTGAGAAAAATTACAGAAATCAC
  5   1   2       bld Neu7 5g3  in                         XL036d06.5p                                                                                                                                                                                                                                                                                                                                                                              TGCAGGNAATTCGGCACGAGGGGAAAATGCCGAAGTCNGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCC
  5   1   2       bld Te2N 5g                         IMAGE:7767883.5p                                                                                                                                                                                                                                                                                                                                                                                    TGCCACAGAAACAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCANGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAG
  5   1   2       bld Ov1  5g                IMAGE:6318280-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                               CAGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGTATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAAT
  5   1   2       bld Ov1  5g                         IMAGE:6318280.5p                                                                                                                                                                                                                                                                                                                                                                                                AGGGAAAATGCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGTATTGCGTTTGTTCGGAANAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTTCAGTACAGAAAACTTCAGTATTGGCAGAGGAAGATAGGAAGGAAATCCTCACNAGAAACCGGGGGTTCAGTGGAAAAAACGGTGGCCCGGTTTCCATG
  5   1   2       bld Ov1       in                    IMAGE:5048953.5p                                                                                                                                                                                                                                                                                                                                                                                                       GATATCGTCGACCCACGCGTCCGGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAAC
  5   1   2       bld Neu5                             Neu5-123J15A.5p                                                                                                                                                                                                                                                                                                                                                                                                         GCCGAAAGTCAGAGCTGAGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGT
  5   1   2       bld Tbd7                                 XL109m07.5p                                                                                                                                                                                                                                                                                                                                                                                                            AAGTCAGTAGCTGAGGAAGAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGC
  5   1   2       bld Tbd7      in                         XL052p11.5p                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACGCGGGAGGACACCAGGAAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCttttttttGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCANACTTTCCATTAACACTCANCTCTTGGCTCGTGTTGACCACCTNATGAAAGTNGGGAAGAACAATTTCAGGCCCCCTNCNA
  5   1   2       bld Tbd7      in                         XL075c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                            NAAAACGCGGNGCACACCAGGNAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCA
  5   1   2       bld Ga12                                 XL154m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                              AAAACGCGGNGACACCAGGNAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTC
  5   1   2       bld Ov1                    IMAGE:5048953-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                              GAAAACGCGGAGACACCAGGAGGTTAAGAGTCAGGGGGTTTTGTTCAACACTGGACTAGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGTAACATGACCATGAAGCTGTTAGAAAAGTCAAAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTCTGTGTGGCTAACTTGCCTTATCAGATTTCCTCCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGTATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCC
  5   1   2       bld Ga12                                 XL149g24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACACTGGACTAGGGACAGCATATTCTGAAGAATCCCCTGATTGTGAACAGCATTATTGATAAGGCTGCGATAAGACCTACAGATGTGGTGCTTGAAGTTGGGCCCGGTACTGGCAACATGACCATGAAGCTG
  5   1   2       bld Tbd7      in                         XL060p02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAAGGGTGATTGCTTGTGAACTTGACACACGCCTTGTTGCAGAGCTCCAAAAAAGAGTCCAAGGCTCGGCAGTTGCAAGTAAACTCCAAGTCATGGTTGGCGATGTTTTGAAGACAGACCTGCCTTTTTTTGATCTNTGTGTGGCTAACTTGCCTTATCAGATTTCCTNCCCATTTGTTTTCAAACTCCTTCTTCACCGTCCCTTTTTTAGATGTGCGGTGCTGATGTTTCAGAGAGAATTTGCTATGCGCTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGNAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTNCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAG
  3   1   2       chi Tad2      in                    IMAGE:6873378.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGGTGTAAAATTTTCCCAAAGTTCACAGGTTTGGGGCAATAGTTTTTGAAAAGAAAAGGACCCTGGCCCTTTTTTTTGAAAAACCTCCGGGGGGCGGCTAAAACCTTGCCCCTTATTCAGATTTTTCCCTCCCCCCATTTTGGTTTTTCAAAATTTCCTTTTTTTCCCCCGTCCCTTTTTTTAGGATTTTGCCGGTGCCTGATTTTTTAGAAGAGAATTTTGGTTAGGCGCTTGGGGGGCCCAAACCCCGGGGGGACAAAGCTGTACTGCAGACTTTTCCCATTACCAATCAGCTCTTGGCTCGTGTTGACCACTTCCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAAGTGGAATCCAGTGTAGGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTCTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGTTTTGGAATCTTATAGATACTGCTGGCCGGTATGGGTGGAAGTTATGGGCTCAGACGGAGGGACTCATGT
  5  -1   2       bld Bla2                            IMAGE:7297706.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTCATCTCCATGTTCATCTTCACGTCCTTTGATGCGGCGAGTCAAGGATGTATGGCTGTGCAACCAGAGCAATGTATGCGACTTCATAACATCAGTCTGGCTCGGTGACACTCATGAAGTAGGAGACAAATTCAGCCCCCTCGAAAGTGAATCCAGTGTAGTCCGATAGACCCAAAAATCCTCCACCTCCAATAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTCTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTGCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTATACATTTCTAAACCGATATGCATAAAAAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCCTTATATATGTATTTATTTAAATGTGTGGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGATaaaaaagaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL488f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCGCTTGGTGGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGT
  5   1   2       bld Ga15      in                       XL488f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTGGTGGCCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGT
  3   1   2       bld Ga15 5g3  in                       XL506j17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAAACCAGGAGACAAACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAAAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTGAA
  3   1   2       bld Te2N                            IMAGE:7764291.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGTACTGCAGACTTTCCATTAACACTCAGCTCTTGGCTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCAGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTTTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTTTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga18                               xlk68k18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGNTCTTGGNTCGTGTTGACCACCTCATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTNNGGNNNNNNTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCaaaaagaaaataaaaaaaaataaaaaaaaaa
  3   1   2       bld Tbd7      in                         XL095a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAAAGTAGGGAAGAACAATTTCAGGCCCCCTCCGAAAGTGGAATCCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAANGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGCAATAATGAAATATTACGTGAACGGAGTACATGNATATTGTATTTACAAA
  3   1   2       bld Tbd7                                 XL072d20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCAGTGTAGTCCGGATAGAACCCAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTATTCATCCAAAGATTTAATAAAACAACGTCCCAGAGGGCNGATTGTA
  3   1   2       bld Tbd7      in                         XL052p11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAAAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTNATTCATCCAAAGATTNAATAAAACAACGTCCCAG
  3   1   2       bld Neu7 5g3  in                         XL036d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATCCTCCACCTCCAATTAACTTTCAGGAATGGGATGGGCTGGTGCGGATCGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTNCCCCGTTTGTAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074627.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAATGGGATGGGCTGGTGCGTATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTG
  3   1   2       bld Tbd7      in                         XL060p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGGATTGCGTTTGTTCGGAAAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTAAAACACGAGGGTAACAG
  3   1   2       bld Tbd7                                 XL109e10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATAAAACCCTTGCAGCATCTTTCAAATCCACAGCCGTGCAAGAACTGCTTGAGAAAAATTACAGAATCCACTGCTCACTGCATAACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTNATTCATCCAAAGATTNAATAAAACAA
  3   1   2       bld Ov1                             IMAGE:4055309.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACATTTCAGTACCAGAAAACTTCAGTATTGCAGAGAAGATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTG
  5   1   2       bld Ga18      in                      xlk127e03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATAGAAGGAATCCTCACAGAAACCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCACTCCTTCATGGATTTAATTCGCAAGGAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGNTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGNTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGTCTGCCCTTAGTGACACCAGTGCAACTTTTGTGTCTTGCAATTCAAACAAAACATGTGCCTTNNCCCGAG
  3   1   2       bld Ov1       in                    IMAGE:5048953.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGTTCAGTGAAAAACGTGCCCGTTCCATGGATATTGATGACTTCATGGCCCTCCTTCATGGATTTAATTCGCAAGGAATCCCCTTTACATAAGTGCCGAGAGTTTCCCCCCCTTTTTGTACAACTGGCAGTTTGGTCCCAAAGAATTTGTCCCAGGGAAGGGGGGGGAATCCGTCCCTGATTTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTTTACCCTACTTGCCCTAACATTTTTTAACCGATATGCATGAATAATGAAATATTTCGTGAACGGGGACATGATTTTTTATTTTCAAATAGTAAAATTTTCCAGCCGGGTTTTCAAAAAAGTATTTATTTAAAAGTGTCGGAGGTGCCATACCTTCTGATATGGGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCCGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                      xlk127e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGNCTTCATGGNNNNCTTCATGGATTTAATTCGCAAGGAANCCNCTTTACATAAGTGCCGANNNNNCCNCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGGTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGTCTGCCCTTAGTGACACCAGTGCAACTTTTGTGTCTTGCAATTCAAACAAAACATGNNCTTGCCCCGAGCCAGGTATAAAGATGTGTTTAATGTCTAAAGCAGGAGGGCCCATAATTTACTATTGCAAAGTCTACTTTTAGTGATGTTGTCCCTTGAGGATCTACATCCATAAAAGCATTGTTCCAATTCTGTTCAATGGAAAATATTACTTTATTATATTGATTTGACAGAATTTATATTGCTATATTTAACAANNAACTNNNNTAT
  3   1   2       bld Gas8                            IMAGE:3516304.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATCCACTTTACATAAGTGCCGAGAGTCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Egg1                               PBX0034E06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCCGCCCCTTTCTGTACAACTGGCAGTTTGGTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGATTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGGTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGCCCTTAGTGACACCAATGCAACTTTTGTGTCTTGCAATTCAAACAAAACATGTG
  3   1   2       bld Neu7 5g3  in                         XL033g09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCACAATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTACCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTNATTCATCCAAAGATTNAATAAAACAACGTCCCAGAG
  5   1   2       bld Ga15      in                       XL475j05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCCGATGAATTTGTCACAGGGAAGTGGGTGGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTTGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATTTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGaaaacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL475j05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGAATTTGTCACAGGGAAGTGGGTNGAATCCGTCACTGATCTGGCAGTTTGTGTAGAATATTTCCCCGTTCGTACAGTTTCCCTTCTACACTACTTGCACTAACATTTTTAAACCGATATGCATGAATAATGAAATATTACGTGAACGGAGACATGATATTGTATTTACAAATAGTAAAATCTACCAGCAGGCTTCTCATATATGTATTTATTTAAATGTGTCGGAGCTGCCATACCTACTGATATGAGGTTGATTCATCCAAAGATNTGAATAAAACAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTAAGGCT
  3   1   2       chi Tbd7      in                         XL075c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACGTCCCAGAGTGGCTGGATTGTAATGAAAATTGTATTTTAAGGCTTTTAATAGAAATTATGTTTAAAACAGTAATTCTGAAAACACGAGGGTAACAGTTTGAATTATTTGTGAAGTGTGTTTCAATCATTGACCCTGAAACAGTCACATAACAGCCTGCACTCCTAAGGGCAGAGACACACGTGGATATTTAGTCGCCTGCCGACAAATCGCCTCTTCGGGCGACTAATATCCCCGAACTGTTTTCCCGCCAGCAGGACGGCACTCTGAACGCTTTGTTTTCCCGAAGCAGAGCGACTTTCCACGTGTGTCTCTGCCCTTAGTGACACCAGTGCAACATTTGTGTCTTGCAATTCAAACAAAACATGTGCCTTGCCCCGAGCCAGGTATAAAGATGTGTTTAATGTCTAAAGCAGGAGGGCCCATAATTTACTATTGCAAAGTCTACTTTTAGTGATGTTGTCCCTTGAGGATCTACATCCATAAAAGCATTGTTCCAATTCTGTTCAATGGAAAATATTACTTTATTATATTGATTTGACAGAATTTATATTGCTATATTTAACAAACAACTATTTCTATTNACCACAACAAATAAATATGNAATAAAAGCATAAATAGGGNATTAGACAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)