Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL514i06ex.5                         60 END     1           1        1                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012768091 Xl3.1-xlk156k22ex.3 - 81 ESTs
                                                                       .......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk156k22ex.3                                      GTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTT
                                                  Xl3.1-CHK-1012685837                                            ATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTTCAAAAA
                                                      consensus depths                                           7    11    19    21    23    26    27    29    28    29    28    29    28    29    29    30    29    30    29    30    29    30    29    30    29    30    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    31    32    32    32    32    33    33    33    33    33    33    33    33    32    33    32    33    33    33    32    33    33    33    33    33    33    33    29    33    31    32    31    32    31    32    31    32    29    31    26    30    24    32    26    33    27    35    26    34    24    34    25    34    24    34    21    33    22    33    23    32    22    31    17    25    18    24    17    22    16    23    18    22    14    21    12    21    13    21    12    17    11    17    11    17    11    17    11    16    11    16    11    17    12    17    12    17    12    18    12    18    12    18    15    20    15    20    15    18    15    19    15    19    14    19    14    20    15    22    21    26    21    26    20    27    19    27    19    27    19    28    19    29    24    32    26    32    25    32    26    32    26    32    27    32    31    35    31    35    31    35    31    34    31    33    31    34    31    34    32    35    33    36    33    35    35    36    35    36    35    36    36    37    33    37    33    38    36    38    35    38    35    37    33    37    35    37    35    37    36    37    34    37    36    37    37    37    37    37    36    37    36    37    37    37    37    37    37    37    37    37    35    37    35    37    36    37    34    35    33    34    33    34    33    34    33    34    32    33    31    32    26    27    17    20    15    17    11    14
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTAGTTTGACAGCAAGCTGAAACACCAGCATTCCCATTGCATTTTGTATTGTTTTTTGTCCTTGTCAGAAAG
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------AA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------T--
                                               BLH ATG      47    1470                                      
                                               BLH MIN      47     178                                      
                                               BLH MPR      35     178                                      
                                               BLH OVR      47      75                                      
                                               CDS MIN      47      28                                      
                                               EST CLI       5      28                                      
                                               ORF LNG      47       4                                      
  5   1   2       bld Oo1  5g                IMAGE:6640447-IMAGp.IMAGp TTAGGTGACGCTCCCCCTTTCCCTCGCTTTCACTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAGTTCTGCCC
  5   1   2       bld Oo1  5g                         IMAGE:6640447.5p  CTTAGGTGACGCTCCCCCTTTCCCTCGCTTTCCTTCGGTCTCCTTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGGTGACAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAGTTCTGCCCACTAAAAGATGCCCTANAAAATGATTGGCGTANTGAAAAAGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAGGNTTTTAATGAAGTTTTCGCACGGACAAGGGGACGGGGATCCCCAACCCAGAATTTATTCGGAAGGATTCCAAGCTGCTCCTTCAAAAACTGGCAGGGGATGGTCCTAAAATTCCCTAAGGGGGCAACCCCCAATCTTCTGCCCCAAAGACTTT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175865.5p                 AATCCCGGCCAATCGTCGACCCACGCGTCCGGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAAGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGGGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATTAAAGTTTTCACTGGTGATGTGTATGGGTACCAA
  5   1   2       bld Ga18 5g   ?                       xlk163i09ex.5p                     TTTCCCTCGCTTTCACTTCGGTCTCCATTGTGAGANCAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGNAGTGATCAGCGAGGAGGAGGCNNNNNNTACGACAGACAGATCCGCTTGTGGGGGCTGGNNNNNAGAAGAGGCTGNNNNTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGNATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGNTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGNTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAANNCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGNNCATTTTGGNTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGANTGGCGNAGTGAAAAGGCAAAGTCTNCTCTGAAGA
  5   1   2       bld DMZ  5g3  in                         xl312a18.5p                           CTTTCACTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTA
  5   1   2       bld DMZ  5g3  in                         xl262h03.5p                           CTTTCACTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGG
  5   1   2       bld DMZ  5g3  in                         xl264a06.5p                           CTTTCACTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTA
  5   1   2       bld DMZ  5g3  in                         xl266k20.5p                           CTTTCACTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTANAAATTGATTGGCGTANTGAAAAGGCAAAGTCTGCTCTGAA
  5   1   2       bld Kid  5g                         IMAGE:7011434.5p                                CCCACGCGTCCGATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGCCAAAGTGACAAAAGCAAACCGTTTATTGAAAATGGTCCAGAGGCTTAGAAAAGCAAGATCGACCCTACAGAGACCTTTTTGGTTAAAAGAAGTACAATCTGCCCCTAAAAGAGGCCTAGAAA
  5   1   2       bld Em10 5g                         IMAGE:8321628.5p                                TCTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTTGAAGATGGTCCAGAGGCTAAGAAAGCAAGATCGACCCTACAGAGACCATTTTGGTTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAAAAAT
  5   1   2       bld Em10 5g                         IMAGE:7982529.5p                                 CTTCGGTCTCCATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACAATTTTGGTTAAAAAGAAAGTACAATTTGCCCCACTAAAGATGCCCTAAAATTGATTGGCTTGTGGAAA
  5   1   2       bld Sp1  5g                         IMAGE:5511229.5p                                           CATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAANAANGAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAAGGCAAGTCTGCTCTGAAGAAGACTCNCCACGACTACTTCCTTTTTGCAGTTTNNATGAGTTTCGCCAGACNAGGNACGGA
  5   1   2       bld Em10 5g                         IMAGE:8317558.5p                                           CATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATGATTGGCGTAGTGAAAGGCAAAGTCTGCTC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4963988.5p                                            ATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCCAAGAAAAAGGCAAAGTGAACCAAAGCAAGCCGTTAGTTGAAAAATGTCCCGAGGCT
  5   1   2       bld Ooc3 5g                         IMAGE:3472447.5p                                            ATTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTT
  5   1   2       bld Em10 5g                         IMAGE:8317603.5p                                            CTTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGACATGAGTTTGTCGAAGAGAAGGCAAGTGACAAAAGCAAAGCGTTAGTTGAGATGGTCCAAAGCTAAGAAGCAAGATCGACCTTCGAGACATTTTGGTAAAAGCTATGCTTTCGAAATGCCCATTCGCCCATATCGAAGATTTGGCCAGAATCTTAG
  5   1   2       bld Em10 5g                         IMAGE:8319840.5p                                            CTTGTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAAAGAAGGCCAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAAAAGCTAAGAAAGCAAAGATCGACCTACAGAGACCATTTGGTTAAAAGAAATACAATCTGCCCACTAAAGATGCCTAAAAATGATTGCGTATGAAAGGCAAATCGCTCTAAAAGACCCCACGACACTCCTTTGCAGTTTATGAGTTCCAAG
  5   1   2       bld Lmb1 5g                         IMAGE:8533974.5p                                               GTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAGAAAGTCAATTCTGCCCACTAAAGATGCCCTAGAAATGATGGCGTAGTGAAAGGCAAGTCTGCTCTGAGAAGACTCCACGACTACTTCTTTGCAGCTACTGCTTCTGAATGCACAGTCTGCCATATCGAGAGTTTGGCAG
  5   1   2       bld DMZ       in                         xl338p02.5p                                               GTGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTA
  5   1   2       chi Ga15      in                       XL520n01ex.5p                                                TGAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGT
  5   1   2       bld Emb1 5g                         IMAGE:6864970.5p                                                 GAGAACAACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCCGACTACTTCCTTTTTGCAAGTTTTTAATGGAAGTTTCGCACAGGACAAGGGGACGGGGATTCCCCAGCCCCAGGTAGTTTACCAAGGAAAGGACTTCTGT
  5   1   2       bld Emb1 5g                         IMAGE:5156613.5p                                                       AACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAGNTTTTAATGGAGTTTTCCCACAGACCAAGGAACGGGATCCCCAGCCCCAGTAGTTTACCAGGAAAGACTCCTGACCTGCTCCCTTCAAATCTTGGAGGGATGTTCCTAAAACTCCTAGGGGGCCAGGCCCCAGATCTCCCTGCCCAAGAACTTTTGCAAGCCTACTGCCTTTTTCTGAAATGGGCACCAGTTCTGCCCAAATAA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4175466.5p                                                        ACCGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAATGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAGAGGTTTTCGCTGGTGAT
  5   1   2       bld Egg1 5g                            PBX0140F08.5p                                                          GCACGAGGGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGA
  5   1   2       bld Ga15 5g3  in                       XL466d06ex.5p                                                          CGACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTANAAATTGATTGGCGTANTGAAAAGGCAAAGTCTGCTCTGAANAAGACTCCCACCGACTACTTCCTTTTGCAAGTT
  5   1   2       bld Emb1 5g                         IMAGE:6636213.5p                                                           GACTGTTGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGGCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAGTTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTTAATGAAGGTTCGCACAGACAAGGGGACGGGGATCCCCCAGCCCAGTTAATTATCAGGGAAAGACTCCCGAGCTGGCTCCCTTCAAAACCTGCAAGGGATGTTCCTAAACTCCCCTTAGGGGTCCAGCCCCAGATCCTCCCG
  5   1   2       bld Ga12 5g3  in                         XL151n14.5p                                                                 GGTAGGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAG
  3  -1   2       bld Bla2      in                    IMAGE:7297267.3p                                                                     GGGAGAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACCGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTCGGAGAACATGAGTTTGTCGAAGAGAAGGCCAGGTGACNNAAGCAAGCCCGTAGTTGAAGATGGTCCAGAGGGCTAGAAGCAAGATCGACCTACAGAGACCATTTTGGTNAAAAGAAGTACAGTCTGCCACTAAAGATGCCTAGAANTTGATGCGTATGAAAAGCAAGTCGCTCGA
  5   1   2       bld Ooc3 5g                         IMAGE:3472622.5p                                                                         GAGATCGGCAGAATGGTGGAGAAGGAGGAGGCAGTGATCAGCGAGGAGGAGGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTC
  5   1   2       bld Ga14                                Ga14-p4h3.5p                                                                                                                          CAGCGGCGCAGTACGACAGACAGATCCGCTTGTGGGGGCTGGAGGCACAGAAGAGGCTGCGCACTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCAGAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTTGTGTGTCTAACGTCTTGCC
  5   1   2       bld Em10                            IMAGE:8320495.5p                                                                                                                                                                                        CCTTCCAGAGTTCTTTTGGTGGGCATGCGAGGACTGGGGGCTGAAGTTGCCAAAAACTTAATTTTGGCTGGAGTGAAGGCATTAACATTGCTGGATCATGAGCAGGTTTCTTCATAAGACTCTAGAGCTCAGTTCCTAATTCCATCTGGGTCCCTGGGCCAAAATAGGGCTGAGGCATCTCTCAATCGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCGCAGCCAGTAGTTACTAGGAAACTCTGACTGCTCTTCAATCTGCGTGATGTCTAGCTCCTAGGGTCAGCCAGTCTCTGCCAAGACTTGCAGCTATGCTTTTGAATGCACATCTGGCAGAGCGGAGATTTGGCAGAATCGTAGTCATCTGAAATCCCCAAACTTCTCTGAGG
  5   1   2       bld Ga15                               XL424o09ex.5p                                                                                                                                                                                                                                                                                                                                                                                  CGGGCACGGAACCTCAATCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACGCAGTTTGATGTCGTGTGCCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGGATAGTTGACTGCCTGGGTTCCAAATGANAGGAAGCACTATGGNCCTGCAAGTCTTACCTGAAGG
  5   1   2       bld Em10                            IMAGE:8321552.5p                                                                                                                                                                                                                                                                                                                                                                                                   TCCAATGGTGTCAGTAGAAGCAGATACTGAAAACATCAATCAGAAATCTGATGATTTTTTCACACAGTTTGATGTTGTGTGTCTAACGTCTTGCCCCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGGATAGT
  5   1   2       bld Int2                            IMAGE:8531049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGTGACCTCTTAGTTAGAGTGAACCATATCTGCCACAAACACAACATAAAGTTTTTCACTGGTGATGTGTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAATGAGAGAGCACTATGGCCTGCAGTTGTACCTGAAGAGAGCTAGCAGTGTACTGCTGCAGCTTACAGAGATGACACATATAGTACTAGACTGAGACAAAGTCATCCTGTTCTGTTCATAGCAAAATGCTATATCTCTCAGAGATCCTAGATCGGCACACTGCTCTCTGCGACTA
  5   1   2       bld Ga15      in                       XL442n24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCGCAACATAAAGTTTTTCACTGNGTGATGTGTATGGGTACCATGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTANGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACCATTCTGCCCACTANAAGATGCCCTANAAATTGATT
  5   1   2       bld Ga15      in                       XL432d03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTATGGGTACCACGGGTCCATGTTTGCTGACCTTGGAGAACATGAGTTTGTCGAAGAGAAGGCCAAGGTGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGAAGCACTATGGCCTGCAAGTCGTACCTGAAGGAGGAGCTAGCAAGCTTTACAAGAGAATGACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAA
  5   1   2       bld Emb4                            IMAGE:4957765.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGAAGGTCTAGGCGACAAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAGGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTCCTGAAAAGGCAAAGCCTGCTCTGAACAATTTTTCCCCCGACTGCTTGCGTTTGCAAGTTTTAAttttttttttCCAAGACCAGGGACAA
  5   1   2       bld FaBN                            IMAGE:8077645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGGCAAGGTGACAAAGCAAAGCCGTTAGTTGAAGATGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGAAGCACTATGGCCTGCAAGTCGTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATGACCACATAATAGTTACATAGACATGAAGACAAAAGTCATTCCCTGTATCATGTTTCATGGCAGAAAATGCTATATCTTCTACAGAGAATCGCTAGATATGTGCACTACATGGCATCTCTTGCTATCATACCATGATAGTAAAATATCTGCCTATGA
  5   1   2       bld Te2N      in                    IMAGE:7202856.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGATGAAGGAAGCCTTAGTTTGACAGCAAGCTGAAACACCAGCATTCCCATTGCATTTTGTATTGTTTTTTGTCCTTGTCAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAAATTTGCATCTTTTGTATTTGCAGGTTTATGGGTGACGTTGCCTTTTTTTCCTTCTGAACCATTTTCAAAAAATTAAAACGGA
  5   1   2       bld Te2N      in                    IMAGE:7203516.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGCCTTAGTTTGACAGCAAGCTGAAACACCAGCATTCCCATTGCATTTTGTATTGTTTTTTGTCCTTGTCAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTCCATTTGTAATTTTGCATCTTTTGGATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCCAGATCAAGTGACCCAATTTAACAAATGGGGGGTTCTGATTCGCAAAAGCCAACTT
  5   1   2       bld Te2                             IMAGE:7393049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAGCCTTAGTTTGACAGCAAGCTGAAACACCAGCATTCCCATTGCATTTTGTATTGTTTTTTGTCCTTGTCAGAAAGTACAATTCTGCCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATGGNCATCATCCTTTGCTGATCATACACATGATTAAGTAAAAATATCCTGCCCTATGTATAGTGACGATAAAAGCACTTCATTGTATTTGCATCTTGATGCAGGTATGTGACTGCTTTACTCGACATTCCGATA
  5   1   2       bld Egg1                               PBX0138A01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACGAGGGGTCCAGAGGCTAAGAAAGCAAAGATCGACCCTACAGAGACCATTTTGGTTAAAAAGAAAGTACAGTTCTTTCCACTAAAAGATGCCCTAGAAATTGATTGGCGTAGTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTATCAGGAAGACTCCGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCCCCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGAAGCACTATGGCCTGCAAGTTGTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATGACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATG
  5   1   2       bld Gas8      in                    IMAGE:3516707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGAAAAGGCAAAGTCTGCTCTGAAGAAGACTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGGTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTNTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAG
  5   1   2       bld Ga18      in                      xlk156k22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAAGAAGANTCCCACCGACTACTTCCTTTTGCAAGTTTTAATGAAGTTTCGCACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTACCAGGAAGACTCTGAGCTGCTCCTTCAGATCTGCAGTGATGTTCTAGACTCCCTAGGGNTCAGCCCAGATCTCCTGCCCAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGNGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGNCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGNATTACTAAAACAAAGGCAGA
  3   1   2       bld Ga18      in                      xlk156k22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTGAAGNAGACNCCNCCGACTNCTNCNTTTTGCAAGTTTTAATGAANNTCGNACAGACAAGGGACGGGATCCCCAGCCCAGTAGTTNCCAGGNAGACTCTGANCTGCTCCTTCAGATCTGCAGTGATNTTCTAGACNCCTAGGGNTCAGCCCAGATCTCCTGCCCAAAGNCTTTGCAANCTACTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGNCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTNTCTTTGTNTTTTTTG
  3   1   2       bld Ga15      in                       XL520n01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCTAGGGGTCAGCCCCAGATCTCCTGCCCAAAAGACTTTGCAAGCTACTGCTTTTCTGAGATGGGCACCAGTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTGTTTT
  3   1   2       bld Te2N      in                    IMAGE:7202856.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGAGTGATTCTAATGCAGATCGATCTAGTCGCAATTCTGCAAGATGCAGTATGTTTGAGAGCACATTGCCATATCGAGAGTTGGCCAGAATCGTAGGCTTATCCTGAGAATGCCCCCACACAACTTTCTTCTTGATGGAAAACAAGCAATGGATAGTTGCTGCCTGGGTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTTTTTTCATTTGAACAACTATGAAN
  3   1   2       bld Ga15      in                       XL432d03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTCCTGCCCAAAGACTTTGGCAAAGCTACTGCTTTTTCTGAGATGGCACCAGTTCTGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGAAGCACTATGGCCTGCAAGTCGTACCTGAAGGAGGAGCTAGCAAGCTTTACAAGAGAATGACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATTGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTCATT
  5  -1   2       bld Sp1                             IMAGE:5506865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGCTTTTCTGAGATGGCACCAGTCTGCGCAGTAGTCGAGGGAGTTTGGNNCCAGGAAATCGTTAAGGCTCTATNCCTGAGAGATGCCCNCCACAACAACTTTTCTTCTTTGATGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTGGGGNNCCANNGAACAAACA
  3   1   2       bld Ga15 5g3  in                       XL466d06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGCAGTAGTNGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTNGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTG
  3   1   2       bld DMZ  5g3  in                         xl312a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGCAGTAGTCGGAGGAGTTTTGGGCCAGGAAATCGTTAAGGCTCTATCCCTGAGAGATGCCCCCCACAACAACTTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACCTGTAAACTGTTTTCTGTATCTT
  3   1   2       bld Te2N      in                    IMAGE:7203516.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATCGTNAAGGCTCTATNCCTGAGAGATGCCCCCCACAACAACTTTTTCTCTTNGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGGTTTTTGTTCTCATTTGAACAACATCAAA
  5  -1   2       bld Em10                            IMAGE:7980999.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACACTTTTTTCTTCTTGATGGNAAAACAAGCAATGGGATAGTTGACTGCCTGGGTNCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGttttttgttttttcattttgtAATAAAAAAAGATCTGTTCAAAAAAAA
  5  -1   2       bld Em10                            IMAGE:7982151.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTTTTCTTCTTTGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGttttttgttttttcattttgtAATAAAAAAAGATCTGTTCAAAAAAAA
  5  -1   2       bld Bla2      in                    IMAGE:7297267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTAGTTATCTGAGGAGCCCCACACACTTTCTCTGATGGAAACAGCATGATAGTGATGCTGGGTCCAATGAAGAGAGCATATGCTGCAAGTCGTCNGAAGGAGGGCTAGCAAGGTTACTGTGCCAGCTTACAGGAGAAGACCACAATAATAGTTACATAGACATGAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATATTGCATATTTTATATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTGTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGCTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTGAATAATTCTAAATGCAACTGTAAACTGttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTTAGATTCGTTTNNAA
  3   1   2       bld DMZ  5g3  in                         xl266k20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTGTT
  3   1   2       bld DMZ  5g3  in                         xl264a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGT
  3   1   2       bld DMZ  5g3  in                         xl262h03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGGAAAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAAGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTGTTT
  3   1   2       bld Ga12      out                        XL179m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAACAAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGTGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACT
  5   1   2      seed Ga15                               XL506d21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGCAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGGAAGCACTATGGCCTGCAAGTCTTACCTGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAActgttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaagatctgttaaaaaacnanaaaaagaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl338p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAATGGGATAGTTGACTGCCTGGGTTCCAAATGAGAGAAGCACTATGGCCTGCAAGTCGTACCTGAAGGAGGAGCTAGCAAGCTTTACAAGAGAATGACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATTGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACNCAATGNTTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCNCTTCCNTTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGNGACGTTGCTTTTTTACTTCTGNCCNTTTCNCAGATCAAAGTGACCCAATTTAACAAATGGGGGGTNTGAATCGCAAAAGCAACTTGAGCCAATCCNTTCTCTGGCCAAAATATTTATAGGAAGAAATACNCNAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACNTTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACNCAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTCATTTGAAAAAAAAAGA
  3   1   2       bld Ga15      in                       XL442n24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAAGTCTTACCGGAAGGAGGAGCTAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACANGTAGATTCAAANGGAACNGGTTNGATACATTCAGGAGTATTACTAAAACAAAAGGCAGANGTATCACACAGCTACTTCNGTTTATGNGATNGGCTACTAAATAATTCTAA
  5   1   2       bld DMZ       in                         xl271n21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGATTCGAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAActgttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaagatctgtttcaaaaaaaaaa
  5   1   2       bld DMZ       in                         xl248o03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGATTCGAGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAActgttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaagatctgtttcaaaaaaaaaa
  3   1   2       bld Ga12 5g3  in                         XL151n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTT
  3   1   2       bld DMZ       in                         xl271n21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTT
  3   1   2       bld DMZ       in                         xl248o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGTGTTACTGCTGCCAGCTTTACAAGAGAATAACCACAATAATAGTTACATAGACATGAAGAACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGTAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGT
  5   1   2       bld Ga15      in                       XL412c14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAActgttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaagatctgtttcanaaaaaaaa
  3   1   2       bld Ga15      in                       XL412c14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AACAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTGTTTTCATT
  5   1   2       bld Ga15      in                       XL492h20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACtgttttctgtatctttgtgttttttgttttttcattttgtaataaaaaaagatctgtttccnaaaaaaaaa
  3   1   2       bld Ga15      in                       XL492h20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAAAGTCAATTCCCATGTATCATGTTTCAGTAGGCAGAAAATTGCTAGTATCTTCATACAGGAGAAATCGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTG
  3   1   2       bld Oo1                             IMAGE:3404814.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCATACAGGAGAAATTGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATAATTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAA
  3   1   2       bld Ga18      in                        xlk5e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNGTCNNNCNNNNNGTCNGNCCACGCGTCCGGCATCATCCTTTGCTGANCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCNCTTCCNTTTGTANTTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTNCTTCTGNCCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGANACATTCAGAGTATTACTAAAACAAAAGGNAG
  5   1   2       bld Ga15                               XL453a08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTAAGATACTGTGCAACTACATTGGCATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGttttttgttttttcattttgtaataaaaaaagatctgtttcgaaaaaaaaaa
  3   1   2       bld Gas8      in                    IMAGE:3516707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACTACATTGGCATCATCCTTTGCTGATCCATACCCAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTTCAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga18      in                        xlk5e15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATCATCCTTTGCTGATCCATACACAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTaaaaaaaagaagaaaaaaaaaaaacaaaaacaaaaaaaaaataagaaaaaaaaaa
  3   1   2       bld Sp1  5g3  in                    IMAGE:4963988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAATGATTAAGTAAAAAAATAATCCTGCCCCTATGTATAGTGACAGATAAAAAAGCACTTCCATTTGTAATTTTGCATAATTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGAAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTTCAAAAA
  5   1   2       bld Bla1                            IMAGE:3381535.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCGTAAAAAAGCACTTCCATTTGTAATTTTGCATCTTTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGttttttgttttttcattttgtaataaaaaaaaTCTGTTTCAAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175865.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCCATTTGTAATTTTGCATAATTTGTATTTGCAGGTTTATGGTGACGTTGCTTTTTTACTTCTGACCATTTCACAGATCAAAGTGACCCAATTTAACAAATGGGGGGTTTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTTCAAAAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4175466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAATTTAACAAATGGGGGGTCTGAATCGCAAAAGCAACTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGTTTTTTCATTTTGTAATAAAAAAAGATCTGTTTCA
  3   1   2       bld Ga18                             rxlk156j20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGCGTGGGTTGAGCCAATCCATTCTCTGGCCAAAATATTTATAGGAAGAAATACACAAACAAAAGTAAGAATTCTCAGTGCGAATATTCACATGTAGATTCAAATGGAACTGGTTTGATACATTCAGAGTATTACTAAAACAAAAGGCAGATGTATCACACAGCTACTTCTGTTTATGCGATTGGCTACTAAATAATTCTAAATGCAACTGTAAACTGTTTTCTGTATCTTTGTGTTTTTTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)