Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6871386.5                     131 PI      91          1     2340                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012768093 Xl3.1-XL405h14ex.3 - 119 ESTs
                                                                       ........-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL405h14ex.3                                                                                                   GGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGT
                                                  Xl3.1-CHK-1012685461                                                                                                         GAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCC
                                                      consensus depths                                                                                                        5    11     6    12    22    25    31    36    33    39    35    42    35    43    36    43    37    43    39    44    39    44    34    44    39    44    39    45    41    46    40    46    41    46    41    46    42    47    40    45    40    45    40    46    42    48    41    47    41    47    41    47    41    47    40    46    39    46    40    46    40    46    40    46    41    46    41    47    41    47    41    47    41    47    41    47    40    46    40    46    44    47    44    47    45    47    45    47    44    46    37    45    41    46    43    47    43    47    40    46    38    46    39    45    38    43    36    42    34    42    32    41    30    40    29    39    25    37    22    34    20    33    21    35    22    35    18    31    16    30    17    29    18    30    13    29    11    28    10    27    10    27    10    24    10    22     9    21     9    20    10    20     9    16     9    15     9    15     9    14     9    13    10    14    10    13    10    13    10    13    11    14    11    14    11    14    11    14    11    14    10    14    10    14    10    14    10    14     9    15    11    15    13    15    13    15    13    16    13    15    13    15    13    15    12    15    12    15    12    15    11    13    11    13    11    12    11    12    11    12    10    12    10    12     8    10     8    10     8    12     8    14     8    13     9    13     8    12     9    12     8    12     8    12     8    15     7    15     8    17     8    18     8    18     8    18    12    20     8    21    11    21    14    24    20    27    20    27    21    28    21    27    18    28    18    29    22    31    22    33    23    34    25    35    27    35    29    37    23    37    27    37    29    39    30    39    30    41    32    42    32    45    34    45    38    47    39    48    38    48    40    49    40    49    41    49    39    49    43    49    43    49    43    49    43    49    40    51    37    49    44    49    45    49    45    49    44    49    45    48    45    48    44    47    44    47    46    49    45    49    45    49    45    49    45    49    45    49    44    49    45    49    44    49    44    48    44    48    46    50    44    50    45    50    43    50    29    49    26    49    27    49    17    45    11    35     7    21     7    19
                                                                   VAR                                                                                                                                                                                                                                                               AGCTTTAATAGC
                                                                   VAR                                                                                                                                                                                                                                                                                       CTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                       TAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAAC
                                                                   SNP                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                           --T---------
                                                                   SNP                                                                                                                                                                                                                                       ----------T-
                                                                   SNP                                                                                                                                                                                                                                                               ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                               G-------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                           ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                   A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                               BLH ATG     178    1540                                                                                                   
                                               BLH MIN      58     350                                                                                                   
                                               BLH OVR     178      47                                                                                                   
                                               EST CLI      23      37                                                                                                   
                                               ORF LNG     178      12                                                                                                   
  5   1   2       bld Oo1  5g                         IMAGE:5084960.5p TGGACCGGTCCGGAATTTCCGGGATCAGGTTTGGATTTTTAAATCGCATCGGCCAATCAGGGGCGTGCATTCTGCTTTAAAATCAACGGCGGCTGCAGGGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTCGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCCGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGGCAGAATCTCCATAGCAACCGAGTCATTTCCAGAGACCTTCCAGCTCGGAAAATTTGGTTCCCTTAATGAAGAAAATGGGAGGGTCACAAATAAGGGGGACTTTTGGGGCCTGGGGCAACCCAAAGGGGGGAATTATTTATTGGGCGCAAGACGCCAATAAAAAGAAACCCCTTCTGTGGTGGGCAACCTCTCCAAAAACTTAACATTGTGTGACC
  5   1   2       bld Oo1  5g                         IMAGE:6640879.5p                           AGGTTTGGATTTTTAAATCGCATCGGCCAATCAGGGGCGTGCATTCTGCTTCAAAATCAACGGCGGCTGCAGGGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTCGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGNTCCTTAATGAATGGAATGGAGGTCAAAATAAGGTGACTTTGNGCTGGGCACCAAAGNTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCCTGAAGTGGTTGGGCAAAAAAGGCCCACAGTTTTTGAAGTGGACTAATGGGTCA
  5   1   2       bld Egg4 5x3  out                   IMAGE:3744170.5p                                                                                         GCGGCTGCAGGGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073726.5p                                                                                         GACCCACGCGTCCGCCCACGCGTCCGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGC
  5   1   2       bld Oo1  5g                         IMAGE:5084076.5p                                                                                         GCGGCTGCAGGGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGGTTCCCTCAGTCTCGGATAACCTGCCACGTCCGGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAGTAGCCGTCACCCCGCACTATGGGTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCGGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGGCGGCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAAACCGAGTCATTCACAGAGACCTCGAGCTCGGAAAACTTGTTCCTTAATGAAGAAAATGGAAGGTCAAAAATAAGGTGAACTTTTGGGGCTTGGGAAACCCAAAAGTGGAAATTATGAATGGGGCCAAGGCCGCCAAAAAAAGAACCCTTCCTGTTGGGGCAACTTCCCAAAACTAACCATTTGGAAACCCCGTGAAGGTGGGGTTA
  5   1   2       bld Ov1  5g                         IMAGE:5074738.5p                                                                                           GATATCGTCGACCCACGCGTCCGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGTCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAA
  5   1   2       bld Em10 5g                         IMAGE:8319149.5p                                                                                           GGCTGCAGCGCCGGGAGGAGTGGAATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTACCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073877.5p                                                                                            CCACGCGTCCGCGGACGCGTGGGATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGTCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCG
  5   1   2       bld Ov1  5g                         IMAGE:6317928.5p                                                                                            CCACGCGTCCGCCCACGCGTCCGATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGNGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGGNCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGAACCATTTNCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGAAATGAAATGGAGGTCAAAATAGGTGGACTTTGGGCTGGGCACCANAGNTGGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAATAANTGTCNNCCCCTCGGAGTGGTTGTGGGCAAAAGGGGCCCCAAATATTTTTTGAAAGGGGGACATTATGGGGTCAATTAGGGATGGCATCATGTACACCCCCGGGTGT
  5   1   2       bld Oo1  5g                         IMAGE:6643535.5p                                                                                              AGGCTGGACCGGTCCGGAATCTCGGGATGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGGATGTCAGTATCTCCATAGCAACCGGAGTCATTCACAGAGACCTCAAGCCTCCGGAAAACTGTTTCCTTAATGATGAAATGGAGGGTCAAAATAAGTGGACTTTGGGCTGGCAACCCAAAGGGGGAATATTAATGGCGAGCGCAAAAAAGACCCTTCTGGGGGACCTCCCCAACTAACATTGCACACTTGAAGGGGTTGGGCCAAAAAGGGCCCCC
  5   1   2       bld Oo1  5g                         IMAGE:6643955.5p                                                                                               GCTGGACCGGTCCGGAATCTCGGGATGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCNGCAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGGAGTGTTTGGGCAAGAAGGGCCACAGTTTTTGAAGTGGACATATGGGTCAATAGGAA
  5   1   2       bld Ov1  5g3  in                    IMAGE:5049058.5p                                                                                                          TCGACCCACGCGTCCGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGTCGCAATATTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATT
  5   1   2       bld Kid  5g                         IMAGE:7009973.5p                                                                                                                  AATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTATGATGAAATGGAGGTCAAAATANGTGACTTTGGGCTGGCAAACAAGTGGAATA
  5   1   2       bld Ov1  5g                         IMAGE:8331128.5p                                                                                                                  AATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCA
  5   1   2       bld Emb4 5g                         IMAGE:4930653.5p                                                                                                                   ATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTACTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGGAGTCATTCACAGAGACCTCAAGCTCCGGAAACTTGTTTCCTTAATGATGGAAATGGAGGGCAAAATAGGGTGACTTTGGGGGCTGGCAACCAAAAGTGGGAATATTGATGGGGGAAGCGGCAAAAAAGACCCCTCTGGGGGCACCTCCCAAACCTACCAATGGGCACCCTGGAAGGTGGTTGGGGGGCAAAGAAAAGGGCCCCACCAAGTTTTTTGGAAAGAGGGGGACACATTATGGGGGCACAATATAGGGAATGTGCATTTCATTGGGTGACACACAACTCTGGGCCCTCGTGGGTGTNAG
  5   1   2       bld Ov1  5g                         IMAGE:6318388.5p                                                                                                                   ATTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAAGTGACTTTGGGGCTGGCAACCAAAGTGGGAATATGATGGGCGAGCGCAAAAAGACCCCTCTGGTGGCACTCCCAAACTACATTGGCACCCTGGAGGTGTTGGGGGCAAGAAAGGGGCCCATAAGGTTTTGAAGGTGGGGACATATTGGGTCAAATAGGGATGGCA
  5   1   2       bld Egg3 5g                         IMAGE:6870809.5p                                                                                                                   GAATTCCCCGGGGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCCTCTGTGGCACTCCAAACTACATTGCACCTGAAGGTGTTGGGCAAGNAGGGGCCACAGTTTTTGAATGGGACATATGGGTCCAATAGGGATGCCATCATGGTACCACCCTGTGCTGGGGG
  5   1   2       bld Ov1  5g                         IMAGE:5048058.5p                                                                                                                    TTAAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAAGAAAAGCGGTACAGAAGCAGAAGCTCGCTACTATTTGGAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATT
  5   1   2       bld Oo1  5g                         IMAGE:6638719.5p                                                                                                                      AAAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGGCGAGCGCAAAAAGACCCCTCTGTTGGCACTCCAAAACTACATTGCCACCCTGAAG
  5   1   2       bld Ov1  5g                         IMAGE:8330463.5p                                                                                                                       AAGGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGTCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGGTCATATANGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATG
  5   1   2       bld Oo1  5g                         IMAGE:5085103.5p                                                                                                                         GGGACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAAGAGGGCCCACAGTTTTGAAAGTGGACATATGGGTCAATAGGGATGCATCATGGTACACACTGCCTGGNGGGGGNAAAACCTCCCCTTTTNAGAACAT
  5   1   2       bld Oo1  5g                         IMAGE:5084821.5p                                                                                                                          GTGGACCGGCCGATTCCCGGGATCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTCGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGNGCAAGAAGGGCCACAGNTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGGTGGGGAAAACTCCCCTTTGAGACATCATGCCCTGAAAGAAACCTACCATGAGGAATTAAAAAGAATG
  5   1   2       bld Oo1  5g                         IMAGE:6642303.5p                                                                                                                           GACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTTACAGAGCCCGAAAGCTCGCTACTAATTTGAAACAGACCATTTTCGGGGATGTCCAGTATCCTCCCATAGGCAACCCGAGTTCATTTCACAGAGGACCCTCCAAGGCTCGGAAAAACTTGGTTCCCTTAAATGATGGAAAATGGAAGGGGTCAAAAAATAGGGTGGACCTTTTGGGGCCTGGGCCAAACCCAAAAGTTGGGAAAATATGGAATGGGGCCAAAGCGGCAAAAAAAGGAACCCCTTCTGGGTGGGGCACCTTCCC
  5   1   2       bld Oo1  5g                         IMAGE:6857253.5p                                                                                                                           GACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCANGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAAGTGACTTTTGGGCTGGCAACCCAAGTGGAATATGATGGCGAGCCGCAAAAAGACCCTCCTGGGGCACTCCAAACTACATTGGCACCTTGAAGTGTTGTGGGCAAAAAAGGGCCCACCAGTTTTTAAAAGGGGAACATATGGGTCCATAAGGATGGCATCATGGTACACCCTGGGCGGGTGGGGGGAAACCCTCC
  5   1   2       bld Oo1  5g                         IMAGE:6862141.5p                                                                                                                           GACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCGTCAGCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCCTGAAGTGTTGGGGCAAGAAGGGCCACCAGTTTTGAAGTGGACATATGGGTCAATAGGATGCATCATGTACACACTGGCTGGTGGGGGAAACCTCCCTTTGAGACATCATGCCT
  5   1   2       bld Oo1                             IMAGE:5079969.5p                                                                                                                            ACTGAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAANGGTGGATTTCGCCAGTGCTACGAGATCACCGACCTGNAGAGCCGGGAGGTATTTGCTGNGAAGATGTGCCCAAGACCATGGTGCTCNAGCCCCCACAGAANGGATAGATGACCATGGAGATCGNCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACATGAACCTCGTGGATGNGGTACTCCAGCTGGGCAAGAAGGAGTCTCCTGTTGGAACTGGCCAAGAAGGAAAAAAGCGGGTAACGAAGCCCAAAACTCGCTTACATTTTGAAACCAAAACCTTTTCGGGATGGGCAGGATCTCCCTAAGCAACCCGAATCTTTTTCACAAAAACCCCCAAGCTTCGGAAAACTGGGTTCCCTaaaggggggaaaagggagggccaaaaaaaggggggccttttgggctgtgggaaaccccaaagggggaaaattgaggggcggggacggccaaaaaaaaacccccctgtggggggctctccaaaaaaaaattttggcccccgtagggggggtggggggaaaaaagaggcgcccccatttttttgaaaggggggacaaattgggggcccaaggggagaggggCTCTTGTGGTGACCACCCCGTGGGTGGTGGGGGGAGAAAACCCACCCCCTTTTGGAAA
  5   1   2       bld DMZ  5g3  in                         xl259d01.5p                                                                                                                              GAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGATCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGNGCCGNAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCATGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAA
  5   1   2       bld DMZ  5g3  in                         xl273d06.5p                                                                                                                               GAGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGG
  5   1   2       bld Tbd5 5g                         IMAGE:3580878.5p                                                                                                                                 GCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACAGGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTACTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402525.5p                                                                                                                                  CAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCA
  5   1   2       bld DMZ  5g3  in                         xl222a11.5p                                                                                                                                  CAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATA
  5   1   2       bld DMZ  5g3  in                         xl303l06.5p                                                                                                                                  CAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGA
  5   1   2       bld Ga18      in                       xlk81d11ex.5p                                                                                                                                    AGCAGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGNNNNGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGNGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCNNNGNNGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTNNAGGAGGAGNNCTCTGNTTGGAGCTGCACAAGAGGAGAAAAGCGGNTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGANCATTTCGGGATGTCAGTATCTNCATAGCAACCGAGTCATTCACAGAGNNCTCAAGCTCGGNAACTTGTTCCTTNAATGATGAAATGGNGGTCAAAATANGTGACTTTNGGCTGGCAACCAAAGNGGANNATGATGGCNAGNNNNAAAAGACC
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3437126.5p                                                                                                                                     CAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGAACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGCTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGACCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAACAACCGAGTCATCCACAGAGACCTTAAGCTCGTAAACTTGTCCTTA
  5   1   2       bld Ga15 5g3  in                       XL405h14ex.5p                                                                                                                                     CAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGA
  5   1   2       bld Ga18      in                      xlk121n22ex.5p                                                                                                                                       AGCAGAAGGAGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGNGNGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCNNNTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGNACTGGAGCTGTNNAGGAGGAGGNCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGNTCGCTACTATTTGAAACAGACCANTTCGGGATGTCAGNATCTCCATAGCAACCNAGTCATTCACAGAGA
  5   1   2       bld Ga18      in                      xlk122o07ex.5p                                                                                                                                               ANNGTAGCAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGCNCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGNNNGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGNATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCNNNNGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTNNAGGAGGAGGNCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAANCTCGCTACTATTTGAAANAGACCATTTCGGGATGTCAG
  5   1   2       add Ga18      in                      xlk109e12ex.5p                                                                                                                                                GAGTAGNAGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCNNNTACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCANNNNNNCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGNGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGNATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCNNNGNNGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGNACTGGAGCTGTGCAGGAGGAGGNCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGNNTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTANCTCCATAGCAACCGAGTCATTCACAGAGANCTCAAGNNCNGAAACTTGTNCNTAATGATGAAANGGNNGTCAAAATAGGTGACTTTGGGCTGGCAANCNAAAGTGNATNTGATnnnnnnnnnAAAANNC
  5   1   2       bld Ov1  5g3  in                    IMAGE:5048027.5p                                                                                                                                                  AGCTACACGGCTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAAGAAGTCTCTGNTGGAGCTGCACAAGAGGAGAAAG
  5   1   2       bld Oo1       in                    IMAGE:3405446.5p                                                                                                                                                         CGGCTTCCCTCAGTCTCGGATAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCA
  3  -1   2       bld Egg3      in                    IMAGE:3379315.3p                                                                                                                                                            CTTCCCTCAGCCTCGGACAACCTGCCACGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCA
  5   1   2       bld Ga12 5g3  in                         XL151e15.5p                                                                                                                                                            GCTTCCCTCAGCCTCGGACAACCTGCCCGTCCTGCCCCATCGATCTCCCCTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCTCAATACTCGAGCTTTAATAGCCGTCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAG
  5   1   2       bld Tbd3      in                    IMAGE:3548808.5p                                                                                                                                                                   AGGGTCGGATGACCTGGCACGTGCTGCCCCATCGATCTCCGGCTGATCTGCCCAGCACTTGCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGAACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTCGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAAGAGAAAAGCGGNTACAGAGCCAGAAGCTCGCTACTATNTGAAACAGACCATTTCGGGATGTCAGTATCTNCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTTATGATGAAAATGAGGTCAAAATAAGTGACTTTGGGCTTGCAACCAAAGTGGGATATGATGGC
  5   1   2       bld DMZ  5g3  in                         xl324g10.5p                                                                                                                                                                                                             CTGATCTGCCCAGCACTTCCCCATTCATCAGGCGCCGCAATACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGG
  5   1   2       bld Ga18      in                      xlk110l24ex.5p                                                                                                                                                                                                                                                          TACTCGAGCTTTAATAGCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGCNNTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGNGNGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGNATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCNNNNNNGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTNNAGGAGGAGGNCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTACCTCCATAGCAACCGAGTCATTCACAGAGANCTCNAGCTCGGAAANTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGNNTTTGGGCTGGCAACCAAAGTGGANNATGATGGCGAGNNNNAAAAGACCCTCTGTGGNACTCCNAACTACATTGCANCTGAGGNGTTNGGCAAGANGGGCNA
  5   1   2       bld DMZ  5g3  in                         xl255e09.5p                                                                                                                                                                                                                                                                     GCCGGCACCCCGCACTATGGCTCAAGTGGCCGGTAAGAAACTGACTGTGGCCCCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTACCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACT
  5   1   2       bld DMZ       in                         xl224g05.5p                                                                                                                                                                                                                                                                                                                         CCAGAGGCCGCTAAACCCCCAGGAATTCCCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTTGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTCGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCT
  5   1   2       bld Emb1                            IMAGE:6635772.5p                                                                                                                                                                                                                                                                                                                                                     CCGGGAGCTCCTCGGCCGTCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGAGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAAGTGTTGGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGCCAATAGGATGCATCATGTACACACTGGCTGGGGGGAAAACCTCCCTTTTGAACTTCATGGCCTGAAAAGAAACCTACATGGAGAATTTTAAGAATGGAATTACTCCCATTCCCCCAGGCACATTTAAACCCTGGGGGCCAATCAGGCACTTATTTACAAAAGAAAGGCCTCCCCGTTCTTGAACCCAACCCCTCAAGGGGCCCCCCATTTAGACCCACCTTTGGCTTGGAATGGAACCCAGCTTCCTTTTACATTTTTCTGGGGTTTAACAATTTCCACTTTTCCCCAT
  5   1   2       bld Oo1                             IMAGE:3403768.5p                                                                                                                                                                                                                                                                                                                                                                   GCCGCCAAAGAGATCCCAGAGATTCTAGTGGATCCCCGAACCCGGAGGCGATACCTGAGAGGTCGGTTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGTATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCATGAAGAGGTCTCTGTTGGAGCTGCACAAGAAGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATCTGAAACAGACCATG
  5   1   2       bld Oo1                             IMAGE:5078874.5p                                                                                                                                                                                                                                                                                                                                                                    CTGGACCGGTCCGGAATTCTCGGGATTGTGGATCCCCGAACCCGGAGGTGATACCTGAGAGGTCGATTCCTGGGCAAAGGTGGATTCGCCAAGTGCTACGAGATCACCGACCTGGAGAGCCGGGAGGATTTGCTGGGAAGATTGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTTCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGGANGGNGGGGNNGGGCGACGCAGCAACggacgcccgcccccggaatgaggacccctacccccgcccccTCGGCGTCGATTATAGATCGCCGCCGGCGTGACGCCCGACTCGCGGGGGCCTCTTTCACTAATCGAGGTATTGTCCGCCCCGCTTATGCCGCAGTTGTCCGCCCCCTGCGTTCCTACGGATGCACGCCGCCCACATATACTTCAGCCCCGCCCCCCACAGTAGCGAACTGCTACGGTGTCCCGGCCTCGCCTCTTTGCTCGATCCTCCCTGAGCCACCGCACTACAAGCCACCGCAAGAGCTACACTNTGTCTGAAGCGCGCCGAGAAGCACCTGGCCCGAGTNTCGCCCGTCCGTACTCGAAGGTACAGCCCCCTTGTCTCGCCGGGAACAGACGATAACGNCTCCGGNCCCCGCGCCTCGTACACCTAGCCGGTGTCTGGCACAAACGCATCGGTCCCATCCCCGCGCC
  5   1   2       bld Oo1                             IMAGE:6861917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGATGTGCCCAAGACCATGTTGCTCAAGCCCCACCAGAAGGATAAGATGACCATGGAGATCGCCATCCAGCGCAGCCTGGACCACCGGCATGTCGTGGGCTTCCATGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCCNTGCAAGGAAAGAAGAGATGCCACCAGCCCGGAGNTTCAT
  5   1   2       bld Oo1                             IMAGE:6857031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCGATCCACCGGCATGTCGTGGGCTTCCTGGCTTCTTTGAGGACAATGACTTCGTGTATGTGGTACTGGAGCTGTGCAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGGAGCCCCTTTACTGCAATTAATAAAGGGCAAGAATCTCCCCCTGGTTGGAAAGCAGGGGGGTTCCCTGCAAAGGGAAGAAGAGAATGCGCCAGCCCGGGAGTTCACAAAAGCCCGGGCAAATTGGTTAACCCTAATCTGAAAAAGTCCACTACTGTGATGCCACTTAAAGCTTCCAGAAGCGCTCATGCAGGTCAACTACTGACGGCTCCGTAGACCTGCCGGGCCnnnnnnnnnnGC
  5   1   2       bld Oo1                             IMAGE:6639007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGGAGGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGCCGGAGTTCACAGAGCCTGCAGATTGTTACTTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAAGCAGAGGAATCCGGGCATCCCATTTCCCCATTATTCTGGGATCAGCCAAAATggggggggA
  5   1   2       bld DMZ       in                         xl312a24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGAGGTCTCTGTTGGAGCTGCACAAGAGGAGAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGCCGGAGTTCACAGAG
  5   1   2       bld Ga18      in                      xlk132g22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAAAGCGGTTACAGAGCCAGAAGCTCGCTACTATTTGAAACAGACCATTTCGGGATGTCAGTATCTCCATAGCAACCGAGTCATTCACAGAGACCTCAAGCTCGGAAACTTGTTCCTTAATGATGAAATGGAGGTCAAAATAGGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCNCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGNCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGNTCTTTACTTCTGGCTACATNCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCNCCCANNACTATTGATCAAAGCNTAAGGGAGCCNCTTACTGCAATNNNNAAGGGCAA
  5   1   2       bld Ga12                                 XL175o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGTTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTAT
  5   1   2       bld Ga12                                 XL178j23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTGACTTTGGGCTGGCAACCAAAGTGGAATATGATGGCGAGCGCAAAAAGACCCTCTGTGGCACTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGTTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTAT
  5   1   2       bld Em10                            IMAGE:7980816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCCAAACTACATTGCACCTGAGGTGTTGGGCAAGAAGGGCCACAGTTTTGAAGTGGACATATGGTCAATAGGATGCATCATGTACACACTGCTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGCCGGAGTTCACAGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCAGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACNGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAAT
  5   1   2       bld Ga18      in                      xlk141b15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGGATGCATCATGTACACACTGTTGGTGGGGAAACCTCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGNCTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATANCAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCNCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCNC
  3  -1   2       bld Bla2      in                    IMAGE:7295712.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCCTTTGAGACATCATGCCTGAAAGAAACCTACATGAGAATTAAAAAGAATGAATACTCCATCCCCAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGCCGGAGTTCACAGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCAGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATACAGTGTANGGGTGCTCTTCATGACTCACACGGTGATATGTACATGATGGAACAGCTGCATACATGAGCGGACATACAGATCTACTCACGTGCGCTCTACCTACTACTAACAANATCACTGCT
  5   1   2       bld Ga15      in                       XL407i14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAGCACATTAACCCTGTGGCAGCAGCACTTATACAGAAGATGCTCCGTTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGA
  5   1   2       bld Ov1                             IMAGE:8330321.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTGACCCAACCTCAAGGCCCACAATAGACGACTTGCTGAATGACGAGTTCTTTACTTCTGGCTACATTCCTTCCCGGCTCCCCACAACCTGCTTAACTGTGCCCCCAAGGTTTTCCATTGCGCCCAGCACTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCCACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCACCTGAAGCATGGAACTGTTCAGATCAACTTCTTC
  5   1   2       bld Ga18      out                     xlk143i04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCCATTGCGCCCNGNCTATTGATCAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAGGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGNNCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCNCTTCTTGCGCACCTGGTTCCGGACACGCAGGCCATTATCCTTCACCTGAGCAATGGANCTGTTCAGATCAACTTCTNCCAGGATCACACCNAGATAATCCTGTGCCCCCTTATGGNTGCGGNGTCCTACATAGATGAAAAGCGTGAGTNCNNNACGTACAAGCTGAGCCTGATTCAAGAATTTGGNTGCTGCAA
  5   1   2       bld Neu7                                 XL032j19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCCAGCACTATTGATAAAGCTTAAGGAAGCCACTTACTGCAATTAATAAAGGGCAAGACTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGCCGGAGTTCACGGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCCGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACAATGAGCGGAACAATACAGAATCCTACCTCAATGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATT
  5   1   2       bld Ga18      in                      xlk159f17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATTAATAAAGGGCAAGNCTCTCCACTGGTTGAAAAGCAGGTGGTTCCTGCAAAGGAAGAAGAGATGCAGCAGNCGGAGTTCACAGAGCCTGCAGATTGTTACCTATCTGAGATGCTCCAGCAGCTGACATGTTTGAATGCAGTCAAGCCTTCTGAGAGAGCGCTTATCCGCCAAGAGGAAGCAGAGGATCCGGCATCCATTCCCATATTCTGGATCAGCAAATGGGTGGATTACTCGGACAAATACGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATAGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGNNCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACNAGCTGAGCCTGANTCAAGAATTTGGCTGCTGCAAAGAGNTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGNNATAGCNGNCAAGCAAACTATGGNCTCCCCAGAAACAAANCCATATTCNTGGGNTNNTGGAANCA
  3   1   2       bld Ga18      in                       xlk81d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGAAGCNGANGATCCGGNNTCCNTTCCCANNTCTGGATCAGNAAATGGNTGGNTTNCTCGGNNAAATNNGGNTTAGGATATCAGCTGNGTGANAACAGNGTAGGGGTNCTCTTCAATGNCNCNCACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGNGGAACAATACAGAATCCTACCTCANCGNNNGCTCCTACCCTACTACCTTAACCAAAAAGATCACNCTGCTGAAGTNCTTCAGAAACTACATGAGTGAGCACCTATTGANNNNNGTGCCAACNCGACTCCTCGGGAGGGTGATGAACTGNCTCNTCTCCCCTTCTTGCGCACCTGNTTCCGGACACGNAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTNNNNACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGNCCTCAGNATAGCNNNNNAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTNCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCANCGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAATNCTTTTGTANATTNNCAGNT
  3   1   2       bld Ga18      in                      xlk132g22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ANCGAGGATCCGGNNTCCNTTCCCNNNTCTGGATCAGCAAATGGGTGGATTACTCGGANAAATNNGGATTAGGANNTCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGACTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATNGANNGGAACAATACAGAATCCTACCTCAACGTGNGCTCCTACCCTACTACCTTANNCAAAAAGATCACACTGCTGAAGTNCTTCAGAANCTACATGAGTGAGCACCTATTGAAGNNCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCNTCTCCCCTTCTTGCGCACCTGGTTCNGGACACGNAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAANNNTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGNCNNNNATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAANNNTTTTGTANNNNNCAG
  3   1   2       bld Ga18      in                      xlk141b15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CNNCCNTTCCCATNNTCTGGATCAGNAAATGGNTGGANTACTCGGANAAATNNGGATTAGGANNTCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGNCTCCACACGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATTGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTNCCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAANCTACATGAGTGAGCACCTATTGAAGNCCGGTGCCAACACGACTCCTCGGGAGGGTGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTNNCNACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAATACTTTTGTATATTANC
  3   1   2       bld Ga18      in                      xlk159f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TNCCCATNNTCTGGATCAGNAAATGNNTGNATTACTCGGANAAATNCGGATTAGGATATCAGCTGTGTGATAACAGTGTAGGGGTGCTCTTCAATGNCTCCACACGNTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATAGANNGNAACAATACAGAATCCTACCTCAACGTGNNCTCCTACCCTACTACCTTANCCAAAAAGATCACACTGCTGAAGTACTTCAGAANCTACATGAGTGAGCACCTATTGAAGNCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCNTCTCCCCTTCTTGCGCACCTGNTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCNNNNATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAATNCTTTTGTATNTANCAGNT
  3   1   2       bld Ga18      in                      xlk109e12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANGGGNNGCTCNTNANTGNCTNCNCNNNNTNGATNATGNANAATGATGNNNACAGCCTGCAGTANNTTGANNNNANCAATANAGAATCCTACNNCAACGTNNNCTCCTNNCCTACTACCTTAACCNAAAAAGATCACACTGCTGAAGTNCTTCAGAAACTACATGAGTGAGCNCCTATTGAAGNCCGGTGCCAACACGNCTCCTCGGNAGGGCGATGAACTGNCTCNTCTCCCCTTCTTGNNCACCTGNTNCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCNTTGCACACGTAAAGGNNNNNNATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAANNCTTNTGTATAT
  3   1   2       bld Ga18      in                      xlk121n22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTANGGGTNNNNTNAATGNCTCNNNNNNNTNANANTGTACNATGATGNAGNNAGCCTGCAGTACATTGAGCGGNACAATACAGAATCCTACCTCNACGTGNNCTCCTACCCTACTNCCTNANCCAAAAAGATCACACTGCTGAAGTACTTCAGAANCTACATGAGTGAGCACCTATTGAAGNNCGGTGCCAACACGNCNCCTCGGGAGGGTGATGAACTGNCTCNTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTNNCNANGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGNCCTCAGNATAGCNNNNAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAANNC
  5  -1   2       bld Egg4                   IMAGE:3743314-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCTCTTCAATGACTCCACACGGGTTGATAATGTACAATGATGGAGACAGCCTGCAGTACATAGAGCGGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTAT
  5  -1   2       bld Oo1                             IMAGE:6641651.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                NAGACCAGCCCTGGCAGTACCATTGAGCGGGAACAAATCCAGGAATTCTTCCCTTCAACGTGCGGCTCCTTACCCTTATTTCCCTAACCCAAAAAAGATCACACTGCTGAAGTACTTCAGAAACTTACATGAGTGAGCACCTATTGAAGGGCCGGTGCCAACACGACTCCTTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTAT
  3   1   2       bld Ga18      in                      xlk122o07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGANAATGNNNANGATGGNNNNCAGCCTGCAGTACATNAGCGGAACAANNCAGAATCCTACCTCAACGTGNGCTCCTACCCTACTACCTTNACCNAAAAAGATCACACTGCTGAAGTNCTTCAGAANCTACATGAGTGAGCACCTATTGAAGNNCGGTGCCAACNCGNCTCCTCGGGAGGNTGATGANCTGNCTCNTCTCCCCTTCTTGCGCACCTGNTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGCCNCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTNNCNANGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGNCCTCAGNATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAANNCTTTTGTANANNNNCAGNT
  3   1   2       bld Ga18      in                      xlk110l24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNNNAATGANGNNNACAGCCTGNAGTACATNGAGCNGAACAATACAGAATCCTNCNNCAACGTGCNCNCCTACCCTACTACCTTAACCNAAAAAGATCACACTGCTGAAGTNCTTCAGAAACTACATGAGTGAGNNCCTATTGAAGNCCGGTGCCAACNCGNCNCCTCGGNAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGNGCACCTGGTTCCGGACACGNAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCANCTTCTTCCAGGATCACACCAAGATAATCCTGTGNCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGNCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCNNNNNATAGCNNNNAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAANNCTTTTGTANNT
  5   1   2       bld Ga15      in                       XL430d14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAACAATACAGAATCCTACCTCAACGTGCGCTCCTACCCTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCC
  3   1   2       bld Ga15 5g3  in                       XL405h14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATACAGAATCCTACCTCAACGTGCGCTCCTACCNTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATATCAGATA
  3   1   2       bld Ga15      in                       XL407i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATACAGAATCNTACCTCAACGTGCGCTCCTACCCTANTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATATCAGA
  3   1   2       bld Ga15      in                       XL430d14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACGTGCGCTTCCTACCCTANTACCTTAACCAAAAAGATCACACTGCTGAAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTA
  3   1   2       bld DMZ       in                         xl224g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGCTCCTACCNTACTACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATC
  3   1   2       bld Ga15                               XL408i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TANTACCTTAACCAAAAAAGATCACACTGCTGAAGTACTTCAGAAANTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTNGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATNATCCTTCACNTGAGCAATGGANCTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCNTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGNTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTGCAAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATAT
  3   1   2       bld DMZ       in                         xl312a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTA
  3   1   2       bld DMZ  5g3  in                         xl303l06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACCTTAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGTGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTT
  3   1   2       bld DMZ  5g3  in                         xl324g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGT
  3   1   2       bld DMZ  5g3  in                         xl222a11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTT
  3   1   2       bld DMZ  5g3  in                         xl255e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCAAAAAGATCACACTGCTGAAGTACTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTT
  3   1   2      seed Ga15      out                      XL410h12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TNCTTCAGAAACTACATGAGTGAGCACCTATTGAAGGCCGGTGCCAACACGACTCCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATATC
  3   1   2       bld Tbd3      in                    IMAGE:3548808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACCTATTAAGGCCGGTGCAACCCACCTCCTCGGAAGGGGGATGAAATGGCTCGTCTCCCTTCTTGGGCAACTGGTTCCGGACACGCAGTGCCATTATCCTCCACTTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAAAGCTCGCAAACCGTTTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGGTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGG
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3437126.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATTGCAGGTCGGGTGCCACCAGACTCCTCGGGAGGCTGATGAACTGGCTCGTCTCTCATTCTTGCGCACCTGGTTCCGCACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCNTGTGCCCCCTTATGGTGCGGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTTTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCTGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGTAAAAA
  5  -1   2       bld Bla2      in                    IMAGE:7295712.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCCTATGAGGCCGTGCCACACGACCCTCGGGAGGGCGTGAATGGCTGTCTCCCTTCTTGCGCACCTGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCCGTGTaaaaaaaaaaaaaaaaagaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCCAATAATCGGGTTAAAA
  3   1   2       bld DMZ  5g3  in                         xl273d06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATC
  5   1   2       bld Egg4      in                    IMAGE:3744412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCGGGAGGGCGATGAACTGGCTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTC
  3   1   2       bld Egg4      in                    IMAGE:3744412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATGTCGATGATCTGGCTCGTCTCACCTTTTTGCGCACCTGGTTCCGACACGCCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAAAAAAAAA
  5  -1   2       bld Egg3      in                    IMAGE:3379315.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCGATGAACTGGCTCGTCTCCCCATCTTGCGCACCTGGTTCCGAACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCACCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTAACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTCCCGG
  3   1   2       bld DMZ                                 rxl330i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCGTCTCCCCTTCTTGCGCACCTGGTTCCGGACACGCAGTGCCATTATCCTTCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTG
  3   1   2       bld DMZ  5g3  in                         xl259d01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTTCTTGCGCACNTGGTTCCGGACACGCAGTGCCATTATCCTCCACNTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGNGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCCTGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAATCCTGTGTCCTCCTGTTTTTCTCTGTCAATCGTTGTCTGGTTTTTAANGTAAAAATATAATC
  3   1   2       bld Ga12 5g3  in                         XL151e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGACACGCAGTGCCATTATCCTCCACNTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAG
  3   1   2       bld Ov1                             IMAGE:8328864.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGCAGTGCCATTATCCTCCACCTGAGCAATGGAACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGATTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGAAAAAAAAAAAAAAAAG
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402525.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCCACTTGAGCAATGGAACTGTCCAGATCAACTTCTCCCAGGATCACACCAGAATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATAGTAAAANATATAATCTTTAANTACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAAAAA
  5   1   2       bld Ga15      in                       XL519f01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL519f01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTGTTCAGATCAACTTCTTCCAGGATCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTT
  3   1   2       bld Ooc1                             Ooc1-db31g07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCAATTTTTTCAGGGATCACACCAAGATAATCCCGGTGCCCCCTTATGGCTCGGGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTTTTGGGTTTTTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATTTTAAGTGCCACTCGTTGCGTTTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTTTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5049058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCACACCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18                             rxlk104c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNCCAAGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCNCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGNCGTTGCACACGTAAAGGCCNCGNATAGCCGNCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGNCCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGNCTGTACAGNACTCGCGTGACGTTTCNATAAAAATATATCTTAANTNCCNCNCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATNCCTGCTGGGCTCTGTATGAACCTNNNCCTCCTGTTTTTCTCTGTCANCGTTGTCTGGTTTTTAATGTAAAANTNNTCTTTAANNNTTTNGTA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073877.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGATAATCCTGTGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCAGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGTAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1  5g3  in                    IMAGE:5048027.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCCCCCTTATGGCTGCTGTGTCCTACATAGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGATTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGTAA
  5   1   2       bld Egg3      in                    IMAGE:3377988.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGCCCGGGGCCCGGGGGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAAT
  5   1   2       bld Egg3      in                    IMAGE:3377989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGCCCGGGGCCCGGGGGATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTCTAATACTT
  3   1   2       bld Egg3      in                    IMAGE:3377988.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCGTCTGTATGAACCCTGTGTCCCTCCTGTTTTTCTGCTCAACAGTTGTCTGGTTTTTAAATGTAAAACATATAATCTTTAATACCTTCTTGTATACTTATCAGAATTAAACGTTCTTGTGTATAAAA
  3   1   2       bld Egg3      in                    IMAGE:3377989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GATGAAAAGCGTGAGTTCCGCACGTACAAGCTGAGCTTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGCTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACATGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATAT
  5   1   2       bld Oo1                             IMAGE:6859345.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAGTTCCGCACGTACAAGCTGAGCCTGATTCAAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGCACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATaaaaaaaaaaaaaaaaGG
  3   1   2       bld Oo1       in                    IMAGE:3405446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGATTCAAGAATTTGGCTCCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGG
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073726.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAGAATTTGGCTGCTGCAAAGAGCTCGCAAGCCGTCTCCGGTACGCACGCACAATGGTGGAGAAACTTCAGAGCTCAAAGTCAGCCGTTGCACACGTAAAGGCCTCGGCATAGCCGGCCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGATTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAAAAAA
  3   1   2       bld Ga18      in                      xlk129c06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGTTGCACACGTAAAGGNNNNNNATAGCCGNNCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGATTTTAATGTAAAAATANTCTTTAANNCTTNTGTANATNNCA
  5   1   2       bld Ga18      in                      xlk129c06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGTTNNACACGTAAAGGCCTCGNNTNNNNNCAAGCAAACTATGGACTCCCCAGAAACAAACCCATATTCTTGGGTTTCTGGAAGCACAAGACCTTGTTTCAAGTCCTAGGAGAACCCGTCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCATTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGATTTTAATGTAAAAATAATCTTTAATACTTTTGTATATTATCAGATTAAAGNTCTTTGTATAGCCGTaaaaaaaaaa
  3   1   2       bld Ga18      in                       xlk78i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTTTTAATTTTAAGCCGAAGCTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGNCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATANTCTTTAATACTTTTNTATNTANCAG
  5   1   2       bld Ga18      in                       xlk78i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTTTTAATTTTAAGCCGAAGNTGACATGTTCTAGGGTGAGATGGTTCGTTAAGCTTGCCAAGACTGTACAGTACTCGCGTGACGTTTCCATAAAAATATATCTTAAGTGCCACTCGTTGCGTCTGGGTAATCATGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCCGTGaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL453p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCGTGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATTATCAGATTAAAGTTCTTTGTATAGCTGTGTACCTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL453p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATATGTGATGTAGATACCTGCTGGGCTCTGTATGAACCTGTGTCCTCCTGTTTTTCTGTCAACGTTGTCTGGTTTTTAATGTAAAAATATAATCTTTAATACTTTTGTATATATCAGATAAATC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)