Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 51%

 1012768131 Xl3.1-IMAGE:4682509.5 - 62 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:4682509.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTGAGCACACACCCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAAT
                                                  Xl3.1-CHK-1012686268                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACACACCCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     2     5     5     8     5     8     9    13    11    20    16    25    20    29    27    31    29    33    28    34    29    34    30    34    30    34    30    34    30    35    30    35    30    36    30    36    30    36    30    37    30    37    30    37    31    39    32    40    33    43    33    44    33    44    34    45    34    45    36    45    35    45    35    45    34    45    37    45    37    45    38    45    41    47    42    48    41    47    39    47    36    47    42    50    44    49    44    49    46    51    45    50    46    51    45    49    42    46    43    46    44    47    44    48    44    48    39    46    43    46    43    47    39    46    43    45    40    44    41    45    40    44    39    44    37    43    32    40    31    40    27    39    31    37    28    35    27    33    27    33    27    32    26    31    26    31    26    31    25    31    25    30    25    29    20    28    20    28    19    28    20    28    20    28    19    27    19    27    17    26    17    25    16    25    15    24    14    21    12    19    11    19    10    15
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                               BLH ATG      65      60                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      65      35                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      65      44                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               CDS MIN      65      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI      54      31                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Ag ==== 6e-007     XP_313313.2 AGAP003567-PA [Anopheles gambiae str. PEST] =================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Sp ==== 2e-017     XP_001175971.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =============================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 9e-019     XP_001922680.1 PREDICTED: similar to hepatitis B virus x-interacting protein [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Cf ==== 8e-033     XP_537033.2 PREDICTED: similar to hepatitis B virus x-interacting protein [Canis familiaris] =================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Gg ==== 3e-037     XP_417947.1 PREDICTED: similar to hepatitis B virus x-interacting protein; hepatitis B virus x-interacting protein (9.6kD); HBx-interacting protein [Gallus gallus] ==============================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Mm ==== 5e-039     NP_001106131.1 predicted gene, OTTMUSG00000019442 [Mus musculus] =================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Bt ==== 2e-039     NP_001029689.1 hepatitis B virus x interacting protein [Bos taurus] ==============================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 2e-039     NP_006393.2 hepatitis B virus x-interacting protein; hepatitis B virus x-interacting protein(9.6kD); HBx-interacting protein [Homo sapiens] ---------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Xt ==== 9e-046     A9UL91.1 Hepatitis B virus X-interacting protein homolog (HBX-interacting protein homolog) (HBV X-interacting protein homolog) [Xenopus tropicalis]  =============================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PREDICTED = Xl ==== 2e-047     NP_001084999.1 hypothetical protein LOC432061 [Xenopus laevis] ===================================================================================================================================================================================
                                                 Xl3.1-IMAGE:4682509.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGA---------------------------TAG------------------------TGA---ATG---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------TAA------------------------------------------------------ATG---------------------------------TAA---------ATG------------------TAG------------------------------------------------------------------------ATG------------------------TAA------------TGA---------------------------------------------------------------------------TAA------------------------------------------------------------ATG------------------------------TAG------TAA---------------------TAG------TAA------------------------------------------TAA------------------------------------TAA---------------------ATG---ATG------------------ATG---------------------------------------------------ATG---------------------------TAG---------ATG------------------TAA------------------------------------------------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          [ open reading frame                                                                                                                                                                                                                                                            ]
  5   1   2       chi Eye1                            IMAGE:6945423.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACAACaaaaaagaaaaaggggcaaaaggaaaagaaaaGGACCAACGCCACGAGAAAAAGGGGTAAAAACAGCTGGTACGGTCCGGAATTCTCCGGATGCATTTNGGAAGAATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCCGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGGTATAACAATCTTTTTTATAAAGTAGAATACCTAAAATTTTTGTTAAAAGTCTTGTTTTTTACCCAAAGGTAACTTAATCCACAGGTCACAGTTCCTCCTGGGCACAGTTTGCTGCCATGGTTTAAGCCTTCAAAAAAACAGTTGCTTGGGGCCCTGCCAGAATAAAAATTTGTTAAAAAAGGCCTGGTTTTTGGGGGAACAATTAATGGGCCCCTTGGAAAAACACCTTCaaaaaaaaaaCCCTTAATGAAAATTTGTGCAAAAGCCATTTCAAAAGGGTTCAATTCTTTGCCCCCCCAAAAAAAT
  5   1   2       bld Egg1 5x3                           PBX0127E11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGAGGGGTCACGTGAGCACACACCCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGTTACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATT
  5   1   2       bld Egg1 5x3                           PBX0117A12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAGGGTCACGTGAGCACACACCCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTG
  5   1   2       bld Oo1  5x3                        IMAGE:6638596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGCGTCCGCGTGACCCACACCCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGTCTTTGGAGCAGCATTNTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACANTTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAAGTAATGTTCCCATTACCCTATACTGNAGGAAAATGgcaaaattggggtataaacaatcctttttttataaaaatagaaaatacctaaaaatttttTGGNTTAAAAGTCCTTGGGTTTTTAGNCCAAAGGGTTAAACTTAAATC
  5   1   2       bld Egg1 5g3  in                    IMAGE:4783258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCACGAGGCGGAACAGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTNTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGTTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGA
  5   1   2       bld Te2  5x3                        IMAGE:7392145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGAACTGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAAC
  5   1   2       bld Te1  5x3                        IMAGE:6929886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGGAATATGTGNCTTCAATAACATTTTTTGGCTGGTAATCAATTTATTCACTTTAATA
  5   1   2       bld Te1  5x3                        IMAGE:6929878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGCTTTTAGTTTTGCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCCaaaaaaaaaaaaaaaaaaaaaaaaaaaNANACATGTC
  5   1   2       bld Egg1 5x3                           PBX0030B10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAATAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTGTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACT
  5   1   2       bld Egg1 5x3                           PBX0032B10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTAACAGGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAAAGAGCAAGTGAGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTTGTTAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGGCAGATACATGGTAAAATGCATTGTTTTGGGGAACAGTAATGGCCATGGAAAACACTCAAAAATAACCTATGAA
  5   1   2       chi Li1       in                    IMAGE:3397536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAGAGCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAACCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAGCATCATTCTGCATAGCAAATAAAGTTTGTCCCTAGAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTTACCTTTTTATATTGGTACAGACTCATTAGTGTACCCCTTCCCAGCTTCAACCANANAACGCTGCAGCCCAAATTGCTTGNTTTTTTGTGCATACCATAGCCCTGATGCTATTTNAGAATTGTGTGTNGCTNCCTTCCTTGCTTTTCTGGNCCTTATCNAGGTGTCTTNNNNNTTTGTNNNCTCCCTTCCNNNNCNNNCNCNNCNNTCCNTTCCTNNTCC
  5   1   2       bld Ga15 5g3  in                       XL474i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAAGAGCAAGTGAGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATC
  5   1   2       bld Emb4 5x3               IMAGE:4682509-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCAAGTGAGACATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTTAAGCATCAAAAACAGTGCTGGGCC
  5   1   2       bld Emb4 5x3                        IMAGE:4682509.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGTGAGACATGGAAGCGGCTTTGGAGCAGCANTTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTNAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGGTAAAGTCTTGGTTTAGCCCAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGGTGCTGCAGTGGTAAGCATCAAAAACAGTGCTGGGGCCTGCCGATAACATTGTGAAAATGCATGGTTTTTGGGACAGTAAATGGGCCATTGAAACACTCCAAAA
  5   1   2       bld Thy  5g3  in                    IMAGE:8550383.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTGAGACATGGAAGCGGCTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCTAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACNGGAAGTAAATGTTCCATTACCTATACTGAGGAATGCAAATGGGTATACAATCTTTTATAAATAGATACCTAATTTTGGTAAGTCTGGTTTACCAGGTACTATTCACGTCCATTCCTCTGCCATTGTGCATGTAGTTCAAACTGTTGGCCGCAAACTTGAAATGCGTTG
  5   1   2       bld Ga18 5g3  in                      xlk110f12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGTGAGANATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCNGNNNNATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGNCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTNCTATATAAAGNATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGNAAATGTTCCATTACCTATACTGAGNAAANNNAAAATGGGTATAACAATCTTTTTATNAAATAGANACCTAAATTTTGTNANNNCTTGTTTTAGCCNNG
  5   1   2       bld Eye1 5x3                        IMAGE:6945720.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCGATCATGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATATTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTTAGCCCAAGTAACTAATCCACAAGTCACAGTTCCTCTGGGCACAGTTGGCTGCCAGTGTTTAAAGCATCCAAAAACAGTGGCCTGGGCCCTGGCAGAATAAACATTTGGTAAAAATGGCATTGGTTTTTGGGGAACAGTTAATTGGGCCCATTTGAAAACCACTTCCAAAAAAATATACCCTATAGGAAATTTTGCACAAAAGGCCTATCCAC
  5   1   2       bld Neu4 5g3  in                    IMAGE:3556685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCACCTAACCTTTTTATATGGTACAACACACATTAGTGTAGCCTTTCCCAGCTCaaaacaaaaaaaGCTACAGCCCACATTTACTTGATATTTTTACAATAACAATACACCTAATACCATTTAGAAATTATATATTACAATAATACATTTCTATC
  5   1   2       bld Ga18 5g3  in                      xlk101g11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAGANATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCNGNNNNATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTNATATGGCTTACCGGAAGNAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGNTAAAGNCTTGTTTTAGCCNAGGTAACTAATCCACAGTCACAG
  5   1   2       bld DMZ  5g3  in                         xl301a07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTANCTAATCCAC
  5   1   2       bld DMZ  5g3  in                         xl257m16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACATGGAAGCGTCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGT
  5   1   2      seed Ga15      in                       XL516f18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGGAAGCGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAG
  5   1   2       bld Tbd7      in                         XL066i24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGAGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTCTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTAGCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAAT
  5   1   2       bld Ga12      in                         XL217n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCaaaaaaaaGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGNATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAAC
  5   1   2       bld Gas3      in                      xlnga002b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTTTGGAGCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATTAAGGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTCTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGATGCGCGAAAG
  5   1   2       bld Neu4      in                    IMAGE:3557854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTTTGGNGCAGCATTTGNGAAAATACCAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCCAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAATTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTT
  5   1   2       bld Neu4      in                    IMAGE:3557901.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTGGNGCAGCATTTGGTATGTATACAATGAAAAACCCATCAATTGCTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGTACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTNTTGTNTTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATTTGGGCCAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGGANAAAAAGCTGCAGCCTAGANNGGCTNGGGNTTTTTTGCG
  5   1   2       bld Ga12                                 XL178f15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGCATTTGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAA
  5   1   2       bld Ga12      in                         XL186b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGGGAAGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCANTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGNCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAATGTANCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCANATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGT
  5   1   2       bld Ga12                                 XL154n17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATACAATGAAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGT
  5   1   2       bld Egg1                               PBX0045B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAAAACCCATCAATTGTTGGAGGTTTGTGTCCAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCC
  5   1   2       bld Ga12      in                         XL151c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAACCCTCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATGTTGTGGAAGCCTTTCTGATAAACATGCTGGTGTGATCTCCATTCTTCCCCAGTATGCAGCCAAGCTTACTACAGACCCCACAGATGTGCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGT
  3   1   2       bld Ga18 5g3  in                      xlk101g11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGAAACCCNTNNNNNTGNANTTTTNNGTACAGATTCACAGGGCTGANTCTGGGNNNTNNNGGAANCTTTCTNATAANNNNGCTGNTGNGATCTCCATNCNTCCCCAGTATGNANCNNNCTTNCTACAGNCCCNACAGATGTNCCAGTTGTGTGCCTAGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGNCTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTNNNNTTCGCCTANCCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCANCTCAAAGCAAAAAAANCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATNCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGNTCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTANNCTAANNAAAATAAA
  3   1   2       bld Ga18                             rxlk143e15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCACGCGTCCGGAGACATGGAAGCGTCTTTGGAGCAGNATTTGGAAGATACAATGAAAACCCATCAATTGTTGGAGTTTTGTGTACAGATTCACAGGGGCTGAATCTGGGATAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTNCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGNNNNNCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAANCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATNNANAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAANNCTAANNAAAATAA
  3   1   2       bld Ga18 5g3  in                      xlk110f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNTNNNCCCCAGTATGCANNNNAGCNTACTANNGNCCCCACAGATGTNCCAGTTGTGTGCCTAGAATCTGACAATGNAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGNCGTCGTAACATCATTCTNNAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTNNNNNNCGNCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAANCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAANNNAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGT
  3   1   2       bld Thy  5g3  in                    IMAGE:8550383.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTCGAACAGTGGATTCATTCTAGAGAGCAGTATCGACCCACGAGGCAGTGGGCTGATTGACATGACGTATGATCAAACAGATCTTGACGAGCAGTCCAAAGGACTCGTACATCATCTGCGAGCAATAAGTTTGTCCCTAAAATACTGTATCCCTGTAAGTATTGGCAGGACTGTATGTTGTGCTTTCGCCTACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGGCTCAGTATAACTAGCATACG
  5   1   2       bld Ga12      in                         XL187b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAATCTGACAATGGAACGGTTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCANATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCA
  3   1   2       bld DMZ  5g3  in                         xl301a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATGGAACGGNTATGATTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAA
  3   1   2       bld Ga15                               XL452l18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGGTTATGATTCAAAAAACATGATTCATCTGACCNGTAGCAGTTCACAAAGNGACGTNGTAACATCATTNTGCAGAGCAAATAAAGNTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATNTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATNCNCTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCNGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAA
  3   1   2       bld Ga12      in                         XL217n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAAAAACATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAANA
  3   1   2       bld Ga15      in                       XL516f18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGATCATCGGACTGGTAGCAATTTCACAAAAGTGGACGTCGTANCATCATTCTGCAGAGCAAATAAAGTTNGTCCNTAAAAATACTGGTATCCCNGTAATGTATGTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAAC
  3   1   2       bld DMZ  5g3  in                         xl257m16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AANCATGATCATCTGACTGTAGCAGTTCACAAAGTGACGTCGTAACATCATTCTGCAGAGCAAATAAAGTTTGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTCAAACCATTCTACACAAACA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAAGATCATCTGATTGTAGCAGTCACTAAAGTGACGTCGTATCATCATTNCGCTGAGCAGATAAGTTTGTCCCTACAAATACTGGTATGCTTGTAATGTATTGAGCAGGACTGTATGTTTGTGCTGTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTCTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGATGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTGATCAAACCATTCCACACAAACATGTCAGTGCTCGTATAACACAATTT
  3   1   2       bld Ga12      in                         XL187b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTAACATCATTNTGCAGAGCAAATAAAGTTNGTCCCTAAAAATACTGGTATCCCTGTAATGTATTTGGCAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATA
  3   1   2       bld Ga12      in                         XL186b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGGACTGTATGTTTGTGCTTTCGCCTAACCTTTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAANTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACG
  3   1   2       bld Ga12      in                         XL151c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCGAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGNGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACGA
  3   1   2       bld Tbd7      in                         XL066i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTATATGGTACAAGACACATTAGTGTAGCCTTTCCCAGCTCAAAGCAAAAAAAGCTGCAGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTAGCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGACTTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAA
  3   1   2       bld Ga15 5g3  in                       XL474i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTNCAAGACACANTAGTGTAGCCTNTCCCAGNTCAAAGCAAAANAAGCTGCAGCCCAGGATNTGCTNGGTATTNTTGCAATAACAATACACGTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATNTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAANTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCAGTGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTC
  3   1   2       bld Ga12      in                         XL142k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCGGCACGAGGGCCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCNTGTTTTAGNCAAGGTACCTCATCCACAGTCACAGTCC
  3   1   2       bld Ga12      in                         XL199k15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNCCAGATTTGCNTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTNCCTAACAGGAATATGTGCTTCAATAACATTTNTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATNGAATACNTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTTATGTGCATAACTTCCTNTGTATAAAGATCTT
  5   1   2       bld Ga12      in                         XL142k01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAGNTTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCaaaaaaaaaa
  5   1   2       bld Ga12      in                         XL199k15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCAGATTTGCTTGGTATTTTTGCAATAACAATACACCTGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAATAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCaaaaaaaaaa
  3   1   2       bld Egg1 5g3  in                    IMAGE:4783258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGATGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAA
  3   1   2       bld Neu4 5g3  in                    IMAGE:3556685.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCATTTAGAAATTGTGTGTTGCAGTAATACATTTCTGTCTGAAGCGCGAAAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCCAGGTTAACTAATCCCCAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAAA
  3   1   2       bld Gas3      in                      xlnga002b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTAATACATNTCTGTCTGAAGCGCGANAGAGGTTCTATATAAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTAGCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGACTTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAANGAAGCATTTGTTTTNTGTTATATAGCANTGTGTTTATGCTCGCATAACTTCCTTNNTGTATAAAGATTCTTTTCAAAAA
  3   1   2       chi Neu4      in                    IMAGE:3557901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGTATTGTTTGTGTACCTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAAAAAAAAAAAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTGTATAAAGTCTTTTCAAACCTTCTACACAAAGGGGTTCATGTGCTCAGTTATTCCAAAAAAACAAATAnAAAAAAAAAAAAAAGGTTTTTGCCGCGCAACTATTTGAGANTTTTTTCCACTCGTTTA
  3   1   2       bld Egg1                            IMAGE:3302044.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAACAGGAATATGTGCTTCAATAACATTTTTGCTGTAATCATTTATTCACTTAATATGGCTTACCGGAAGTAAATGTTCCATTACCTATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACGACTTTCTGTTAAAAAAAAAAA
  3   1   2       bld Neu4      in                    IMAGE:3557854.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTATTCACTTAATATGGCTNCCCGNAAGTAAATTTTCCATTACCTATACTAAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGCTAAAGTCTTGTTTTAGCCAAGGTAATTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAACAAAATAAAAA
  3   1   2       bld Ga18      in                       xlk63l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAANNNNNAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATANCTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTNNCCTAA
  5   1   2       bld Ga18      in                       xlk63l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATACTGAGGAAATGCAAAATGGGTATAACAATCTTTTTATAAAGTAGAATACCTAAATTTTTGTTAAAGTCTTGTTTTAGCCAAGGTAACTAATCCACAGTCACAGTCCTCTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCANNNNNCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACGACTTTCTGTTTTTGTGTCACTNANAAAAAAA
  3   1   2       bld Li1       in                    IMAGE:3397536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTTGTTAAAGTCTTGTTTAGCCAAGGTCACTAATCCACAGTCACAGTCCTTTGGCACAGTTGCTGCAGTGTTAAGCATCAAAAACAGTGCTGGGCCTGCAGATAACATTGTAAAATGCATGTTTTGGGACAGTAATGGCCATGAAACACTCAAAAATACCTATGAATTGCAAAGCATCAAGGTCATCTGCCCCAAACTACTTGATTCTTTTAAATATGCAGAAAGAAGCATTTGTTTTTGTTATATAGCATGTGTTTATGTGCATAACTTCCTTTGTATAAAGATCTTTTCAAACCATTCTACACAAACATGTTCATGTGCTCAGTTATTAAACCTAAGCAAAATAAACGACA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)