Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6880773.3                      43 PI      90         11     1206                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012768159 Xl3.1-XL484n21ex.5 - 46 ESTs
                                                                       ..-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL484n21ex.5                                           CTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGC
                                                  Xl3.1-CHK-1012686868                                                 TTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGCTATTTT
                                                      consensus depths                                               10    12    22    23    23    24    24    26    25    26    25    27    25    28    26    28    26    29    26    30    28    30    29    30    29    30    30    32    29    32    30    32    30    32    30    32    30    33    30    33    29    32    29    33    30    34    30    34    30    36    30    36    30    36    32    36    32    36    32    37    32    37    32    37    32    37    32    37    31    36    31    37    31    37    31    37    31    37    31    37    30    37    32    38    32    38    32    38    31    38    32    40    34    40    34    40    33    40    33    40    30    41    34    42    33    41    32    40    28    40    29    39    26    37    25    35    20    31    20    28    19    27    17    21    15    21    19    23    18    23    14    22    17    21    17    20    17    19    16    19    14    18    14    17    14    17    13    15    13    15    11    14    11    14    11    14    11    14    11    13    11    13    11    13    11    13    11    13    10    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    12    12    12    11    12    11    12    11    12    11    12     8    11     7    10
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----------GT
                                               BLH ATG     106     466                                           
                                               BLH MIN     106      65                                           
                                               BLH MPR      -5      65                                           
                                               BLH OVR     106      97                                           
                                               CDS MIN     106      65                                           
                                               EST CLI       0      70                                           
                                               ORF LNG     106       3                                           
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8531874.5p CCACTCTTNNNNAAGAGACCTAAATAAAATCGCCCATTCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGG
  5   1   2       bld Tad2 5x3                        IMAGE:6936492.5p                   GGGACACTTCGCTTGGGATTCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGGATTACGCTGGGTTGAGGTCCCGATTAAGTCCGCCAAGACTTGGCAAAAGAA
  5   1   2       bld Tail 5x3                        IMAGE:8545005.5p                      GGGAGTATCGATTGAATCGCCCCTAGTCTTTGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAATCGGTGGATACGCTGGTGAGGTCCGATTAGTCGCCAGACTGGCAAGATGTGGCTCTGTGAGCAGAGAGTANGGAGAAACTTTATGGATGATCGCAAAGAAAGATGTGCAGTGGAGCCTCAAGCCTGGGGTCATCTGCC
  5   1   2       bld Thy  5x3                        IMAGE:8551207.5p                       GAGTACCAAAAGAATCGTCCCCTAGTCTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATACGCTGGNTGAGGTCCGATTAGTCGCCAGACTGGCAAGATGTTGGCTCTGTGAGCAGAGAGTAAGGAGAAACTTNNATGATGATTGCGAAGAAGATTGTGCATGTGAGCCTCAAGCCTGGGGTCATCTGCATGATTGAGAT
  5   1   2       bld FaB  5g3  in                    IMAGE:8071198.5p                                     TTCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGAAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATATTATCATGGTGTGTGCACCTGATGGACAGCAGCATCCGAATCGGTGATACGCTGGGTGAGTCGATAGTCGCAGACTGCAAGATGTGGCTCTGTGAGCAAAGATANGAGA
  5   1   2       bld Ga18 5g3  in                      xlk126i13ex.5p                                     TTCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGNGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGNNGGACCAGCAGCATTCCGAAATCGGTGGATTANGCTNGNTTG
  5   1   2       bld Thy  5x3                        IMAGE:8548167.5p                                      TTCTACTAGTCTTTAGCTACTGTGGATATACTTTTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCACTATCACCCTGCCCGAGTGACATCTTTCCTCTACGTAGGTTGTGAATCTCTGCATATTATCATGGGTTGTGCCCTGGATGGACAGCACATTCCGAATCGGGGATACGCTGGTGAGTCCGATTAATCCCAGATGCAAAATGTGGTCTGTGAGCAAAATCAGAGAA
  5   1   2       bld Ga18 5g3  in                      xlk127h17ex.5p                                      TCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGNGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATTCTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGNTGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGANGAAAGCCNNAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGNNAGGNNGTGAAATCTCTGCATTATTATCATGGNGT
  5   1   2       bld DMZ  5g3  in                         xl243g16.5p                                      TCTAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAG
  5   1   2       bld Spl  5x3                        IMAGE:8460763.5p                                       TCTACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATATCATGGTGTTGTGCACCTGGATGGACAGCAGCATTCCGAATCGGTGGATACGCTGGGTGAGTCCGATAGTCGCCAGACTGCAAGATGTTNGCTCTGTGACAAAGATAGGAGAAACTTATGACTGTCTCAAGAAGATGTGCATGGAGCTTCAGCCTGGGGTGTTGCA
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8531980.5p                                        TAACTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTC
  5   1   2       bld DMZ  5x3                             xl339i10.5p                                           CTAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGT
  5   1   2       bld Tail 5x3                        IMAGE:8543557.5p                                            TAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGAATTAGTCGCCAAGACTGGCAAAGATGTTGGCTCTT
  5   1   2       bld DMZ  5g3  in                         xl300d02.5p                                            TAGTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGAAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGT
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8531447.5p                                              GTCTTTAGCTACTGTGGATGTAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTTATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTAGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTC
  5   1   2       bld DMZ  5g                              xl293l04.5p                                              GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTAC
  5   1   2       bld DMZ  5g                              xl294l04.5p                                              GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATT
  5   1   2       bld DMZ  5g                              xl272l21.5p                                              GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTG
  5   1   2       bld DMZ  5g                              xl272n15.5p                                              GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTT
  5   1   2       bld DMZ  5g                              xl270j01.5p                                              GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTA
  5   1   2      seed Ga15 5g3  in                       XL484n21ex.5p                                               TCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTG
  5   1   2       bld Ga18 5x3                          xlk111c15ex.5p                                                CTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGNGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGNCGCAAAGTCTATGANTGGGTTCCCACTATCACNCTGCCCGAGTGANCATCTTTCCTCTACGNTAGGNTGTGANATCTCTGCATNATTATCATGGTGTTGTGCACCTGGNTGGNNNAGCAGCATTCCGAA
  5   1   2       bld Ga18 5g3  in                      xlk154e18ex.5p                                                GTCTTTAGCTACTGTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGNCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGANCATCTTTCCTCTACGTTAGGNTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGNNCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGNNCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTC
  5   1   2       bld Brn1 5x3                        IMAGE:6951811.5p                                                           GTGGATATAATACTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAAATGTTGGCTCTTGTGGAGCAGAAGAGTTAGGAGGGAAAACTTTTAATGGGACTGGATCTGCAAGAAGGAAAAAGATTGGGTGGCCCAGTGTGAAAAGCCCTTCCCAAAAGACACTTgggggggggTCAGGTCCATGGCCCCTTGGAAAATTTTGGGAAGGAAGTTTTTTTGGCATTC
  5   1   2       bld Ga12 5g3  in                         XL144n03.5p                                                                     GCTACTCTCCTTCTTCCGGNACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCAT
  5   1   2       bld Ga12 5g3  in                         XL156h22.5p                                                                       CTACTCTCCTTCTTCCGGACCTTTTGGTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATG
  5   1   2       bld Ga14 5g                           Ga14-p14c11.5p                                                                                               GTGGATATTTGAGAAGTCTCTCGCACTCACATTTTTGTGCGCTTACCCGGAAAATCATGACTCTGGCAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTC
  3   1   2       bld Ga18 5g3  in                      xlk127h17ex.3p                                                                                                         TTTGNNANTCTCTNNNNCTCACATTTTTGTGGCTTACCCGGAAAATCATGACTCTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGNACTGACAGAATGCAAAGTGCTGNNAAATCCCTGCATGAGCTACTGNTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATTCTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTNCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAANCCTTCCAAAGCACTGGGGGGTCAGTCATGCCANGAAGTTGGAGGAGTTTTGCA
  5   1   2       bld Lmb1                            IMAGE:8535378.5p                                                                                                                                  AAATGGNNCCCGCATTGATGAGGGTACCTAATTAAATTCGTCCCGGACAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCTGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGATCATATGAGTAGGGAGGAAAACTTTATGGACTGATCTGCAAAAGAAAGATGGTGCCGTGTGAACCCTCCAATCACTGGGGAGCTATCAGCTATAAGTTGGAGGATTTTGCTGTGTGAGGACTTGGGACTTTGCAAAGAATAAGAGCTTTGTATGGAATAGGCATTACCCTAGTAATGAACTGTCTTTTGTTTGATTTGAAACTAAATATTTAAT
  3   1   2       bld Ga15 5g3  in                       XL484n21ex.3p                                                                                                                                                GAAAATCATGACTTNTGGAAGAAGTTCACGGACAAGAAACCGTTGTTGAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGT
  5   1   2       bld FaBN                            IMAGE:8076581.5p                                                                                                                                                                                               GAAAGCACTGACAGAATGCAAAGTGCTGGCAAATCCCTGCATGAGCTACTGGTCTCTGCCCAGAGACAGGAATGTCTGACCGTTGGAGTCTATGAGTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAAGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGA
  3   1   2       bld Ga18 5g3  in                      xlk154e18ex.3p                                                                                                                                                                                                 TNAAAGNACTGNNNGAATGNAANNTGCNGNNAATCCCTGCATNAGCTACTNNNCTCTGCCCAGANACAGGAATNTCTNNNGTTGGAGTCTATGANTCTGCCAAAGTCATGAATGTAGATCCAGACAGTGTTNCATTCTGCATTTTGNCTGCTGATGNATACGACGNAAGGTGATAGCCCTTCAGATCCNCTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGNCCTNCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGNTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATANCNCCTGACATTTAANCTGCTATNT
  3   1   2       bld Tbd7                                 XL053d12.3p                                                                                                                                                                                                                                                                 TTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATTCTAGGCTTAACTGATGAGTCTGCAGAACCCAAAGGACCTGCACTGCATCCTTATTACGGTAAGTGTCGTGTTCCTGCTTATCTGTGCTGTTTGGCTCCGTGCCCATAGCTCTGACTTGTGCAATTTCTCGTAAGCACAGTGTTCTCATAGTTTCTTCCTCTTCTTTTCCCAGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCTGAGTGAACATCTTTCCTCTACATTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCAGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGGAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTGGAGGAGTTTTGCATGTGTGCAGGACTTA
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8531447.3p                                                                                                                                                                                                                                                                                                     ACCGTTGGAGTCTATGAGTCGCCCAAGTTAGATTAGATCAGAACAGGTTACATCGCATTTAGCTGCTGATGAACGACGAGTGATATAGCTCAGATCACTCACCGATTCAAGCTTTCTGCTGTGAAATGACATCGATATCGTGAGGCTGACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACTGCACTGCATCTTATTACGAATCCATATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTAAACTGCTATTAAGCCATCCCAACAAATTAA
  5   1   2       bld DMZ                                  xl257d08.5p                                                                                                                                                                                                                                                                                                          CATGAATGTAGATCCAGACAGTGTTACATTCTGCATTTTGGCTGCTGATGAATACGACGAAGGTGATATAGCCCTTCAGATCCACTTCACTCTGATTCAAGCTTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGAACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACCTGCACTGCATCCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCANAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCA
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8531980.3p                                                                                                                                                                                                                                                                                                                                       ACATCTGCAATTTTGGGCTGGCTGATGGATACGACGACGGTGATATAAGGCCTCAGATCAATCATCTGAATCCAGCTTTCTGCTGTGGAAAATGACATCGATATCGTGAGGCTGACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCAAGGACTGCACTGCATCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGCTCTTTTCAAGTCATCCCCCCCAG
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8531874.3p                                                                                                                                                                                                                                                                                                                                           CCATGGCATTTTTGGCCTGGGCTGATGAATACGACCGAGGTGATATAGCTCCAGATTCATCACTGGATCCAGCTTCTGCTGTGAAAATGACATCGATATCGTGAGGCTGACGACACAGAAAAAGTCGCTCAAATACTAGGCTTAACTGATGAGTCTGCAGAACCCAAGGACTGCACTGCATCTTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGCTATTTAGTCATCCCACTAAG
  3   1   2       bld Ga18 5g3  in                      xlk126i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                              CCNCTTNNNTCTGNNTCNANNTTTCTGCTGNNAAANGACATCGATATCGTGANGCTGNNCGANACAGAAAAANTCGCTCANTNCTAGGCTTNACTGATGAGTCTGCNNNNCNAAGGACCTNNACTGCNNCCTTATTACGANNCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGNTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGNCCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATANCNCCTGNCATTTAANCTGCT
  3   1   2       bld FaB  5g3  in                    IMAGE:8071198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGCTCAATACTAGGCTAACTGATGAGTTGCAGACCCAAGGACCTGCACTGCATCCTATTACGAATCCAAATGAGGATGCATGGAAAGATCCAGCTCTGGAGAAACTTGCTATATTCTGCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTAAACGCA
  3   1   2       bld FaBN                            IMAGE:8074483.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTATGCAGCATGGAAAGATCCAGATCTGAAGATACTTGCTAATTTCTGAGATGAAAGCCGCAAAGTCTATGACTGGGTTCCCATTATCACCCTGCCCGAGTGAACATTTTTCCTTTACGTTAGGTTGTGAATTCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCTGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAAGATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTAAACTGCTATTTATGCATCATAATCTCTT
  3   1   2       bld DMZ  5g3  in                         xl300d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTNTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCNCCTGGATGGACCNGCNGCNTTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCNAGACTGGCAAAGATGTTGGCTCTTGTGGAGCNGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCNGAAGAAAAGATTGGTGCCNGTGTGAAGCCTTCCAAAGCNCTGGGGGGTCNGTCNTGCCNTGAAGTTGGAGGAGTTTTGCNTGTGTGCNGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCNGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACNCNTATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCNTTGCAGCTTGTTATTGGTCTTTACNGTCAACTACCCNGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGC
  3   1   2       bld DMZ  5g3  in                         xl243g16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCGAGGAAAGCCGCAAAGTCTATGACTGGGTTCCCACTATCACCCTGCCCGAGTGAACATCTTTCCTTTACGTTAGGTTGTGAAATCTNTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCNTTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCNAGACTGGCAAAGATGTTGGCTCTTGTGGAGCNGAAGAGTAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCNCTGGGGGGTCAGTCNTGCCNTGAAGTTGGAGGAGTTTTGCATGTGTGCNGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACNCATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCNTTGCAGCTTGTTATTGGTCTTTACNGTCAACTACCCNGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGCTA
  3   1   2       bld Ga12 5g3  in                         XL156h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAANATGTTGGCTCTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATNTGCANAANAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCNCTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAnAAAAAAAGGAAGCTTTTNAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGNATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCNTTGCAGCNTGTTATTGGTCTTTACAGTCAACTACCCAGAA
  3   1   2       bld Ga12 5g3  in                         XL144n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACGTTAGGTTGTGAAATCTCTGCATTATTATCATGGTGTTGTGCACCTGGATGGACCAGCAGCATTCCGAAATCGGTGGATTACGCTGGTTGAGGTCCGATTAAGTCGCCAAGACTGGCAAANATGTTGGCTNTTGTGGAGCAGAAGAGTAAGGAGGAAAACTTTAATGGACTGATNTGCANAANAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAnAAAAAAAGGAAGCTTTTNAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGNATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTATAACACC
  3   1   2       bld Ga18      in                      xlk105c21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCAAAAAGAAAAAAGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGAAAAAAAAAACTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTNCTTTTCTTGATANCNCCTGNCATTTAANCNGCTNT
  5   1   2       bld Ga18      in                      xlk105c21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAAGAGGAAAACTTTAATGGACTGATCTGCAGAAGAAAAGATTGGTGCCAGTGTGAAGCCTTCCAAAGCACTGGGGGGTCAGTCATGCCATGAAGTTGGAGGAGTTTTGCATGTGTGCAGGACTTATGGGACTTTTTGCaaaaagaaaaaaGGAAGCTTTTGAGATGGATATGAGGCAAATTAAGCAGCTAGCTAAAGGAAAAACCTGTTCTGTATCTGCTTTTGGAGTTTGCTGAGATATGAAAGATGAACTTTATACACATATTGGAAGAGTCTGGGACTATGCATCTCTGGATTGCAAATTGAGACTGAATATTCTGATCATTGCAGCTTGTTATTGGTCTTTACAGTCAACTACCCAGAATACATAGAGGaaaaaaaaaaCTTTCTGTATTTTCAGAATTTTGGCACTGTTGCAAACTGAAGTGCTTTTCTTGATAACACCTGACATTTAAACTGCTATTTTATGTCATTCAATAAATCATTTTGAACTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)