Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8463348.3                      30 END     14         11       46                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:8463348.3                      30 PI      84       1972     2273                (no blast hit)
     3   0.0    0Xl3.1-XL460j08ex.5                         15 PI      75        117     1404                (no blast hit)
     4   0.0    0Xl3.1-PBX0140D01.5                         11 PI      76        773     1446                LOC549212 protein [Xenopus tropicalis]
     5   0.0    0Xl3.1-IMAGE:6317059.5                       6 PI      77        330      707                phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform [Xenopus laevis]
     6   0.0    0Xl3.1-xl322j20.5                            5 PI      76       1144     1446                protein phosphatase 2, regulatory subunit B, delta isoform [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012768178 Xl3.1-IMAGE:5156677.5 - 123 ESTs
                                                                       ......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5156677.5                                               CCGTGCCAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATTAGTCGAGCCTAAATTCATAACCCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTACTGAATAAAAACCATGGAGAAAAAAAAAA
                                                  Xl3.1-CHK-1012685437                                                     CAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTGGCCCCTAGxxxxxCCxxxxTCCAATxxxxCxxxCxxxAATTCAxxAxCCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTACTGAATAAAAACCATGGAGAAAA
                                                      consensus depths                                                    5     6     7     9     8    12    12    19    22    28    21    28    22    30    24    31    28    35    29    36    31    37    32    37    34    38    36    38    36    40    35    40    38    40    40    40    40    40    38    41    39    41    37    41    39    41    39    40    38    40    40    41    40    41    40    41    39    41    39    41    40    41    39    43    41    43    40    43    42    44    43    45    45    46    45    46    44    46    45    47    45    47    45    46    42    44    44    44    43    45    45    46    45    46    41    45    42    45    44    45    40    44    38    42    36    41    39    41    38    42    34    40    35    38    34    39    33    37    34    38    33    39    34    37    30    38    32    38    29    36    31    35    28    33    27    32    23    31    25    31    23    28    22    30    21    29    21    29    22    29    22    29    22    27    22    27    21    27    21    27    20    25    20    23    20    23    20    23    21    23    21    23    21    23    20    23    20    23    18    22    18    20    17    19    18    20    18    20    19    21    20    22    19    21    18    21    20    22    21    22    21    23    20    24    21    24    20    24    20    24    17    22    18    21    17    21    16    21    16    21    16    20    16    20    16    20    15    20    15    19    15    20    14    20    13    19    14    19    13    18    12    19    13    21     7    21     9    26     9    25    10    27    14    27    14    29    17    30    16    33    22    32    23    32    25    34    24    34    25    35    28    40    27    42    36    41    37    44    38    45    38    46    32    47    31    47    31    48    32    48    37    51    35    51    40    52    38    52    41    53    41    53    39    53    37    52    37    52    37    52    37    52    36    52    38    53    37    53    37    52    37    52    38    52    35    52    38    52    37    51    38    52    35    50    37    48    34    48    33    48    34    48    34    48    34    47    33    47    31    46    28    46    29    45    28    44    27    42    27    41    23    40    24    40    24    39    22    39    19    37    18    37    11    27     7    20     7    14     4     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAACGGGACAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTCCAGCCTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTCCAAATCTGAGGAGAATTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AACGTTTTTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACCCCCCTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTCCCCGTACAAAGGTGTCTTTGTTTAATTTTTTATCCACTAGATTTTTTTTCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCT
                                                                   SNP                                                                                   --T---------
                                                                   SNP                                                                                               ---C--------
                                                                   SNP                                                                                                           --AC--------
                                                                   SNP                                                                                                                                               ------CC----
                                                                   SNP                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                               ---G--------
                                                                   SNP                                                                                                                                                                                                                                                           --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                   --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                               -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                       -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --A--A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T-----G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --A--------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----T-----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --G--------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----G-A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --A--------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       --C--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --C-----C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -T----G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -----------C
                                               BLH ATG     121    1949                                               
                                               BLH MIN     121     349                                               
                                               BLH MPR      10     349                                               
                                               BLH OVR     121      44                                               
                                               CDS MIN     121      21                                               
                                               EST CLI      24      21                                               
                                               ORF LNG     121       4                                               
  5   1   2       chi Neu7      in                         XL035d15.5p TGCAGGNAATTCGGCACGAGGCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAG
  5   1   2       bld Thy  5g                         IMAGE:8550073.5p                                   CCAGTGACGTCACCGTGCCAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCACCACTGTGACCCACTAAGGTGCCGGTTTTCCCCCCATGGACTGAGGTTGAACGAGTCGCGAGGATTTCGCCATGCCACACTTCCATCACTCCTCCTGCACAGTGATATGAACTACTATCACGAGACTAGATCACTGTGCACTGATACGACGACTTAATGAATTAACGCACTGAGACTAGATCTCTGTGGATCACTCCCTGACCTGATCCACCAGCCTCCTTGATGCATACTGCATCTCATATAGCAG
  5   1   2       bld Ga15 5g3  out                      XL477k15ex.5p                                     TGTGACGTCACCGTACCAGCGGCCTCCATCTTGAAGCCGTGGTCTGAGTGTCCGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGC
  5   1   2       bld Tail 5g                         IMAGE:8545020.5p                                           GTCACCGTGCCAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATCCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGTCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAGGCGAGTCCGCGACGGATATTTCGCAATGCCCACACGTATCACATNCACTCCATCTCTGTCACAGTGACTATGAGACCTACTATCAGCGATGACCTAGAGTCACTTGTGCACTTGAANTNNACGATCGAGCTTATATGTAGATATAACCTGCACATGAGACTGACGAGTCTCCTGCTCAAGTCCACTCCACGTACATTTGTCACACACAGGCCTCCCTGG
  5   1   2       bld DMZ  5g3  in                         xl252e22.5p                                           GTCACCGTGCCAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGC
  5   1   2       bld DMZ  5g3  in                         xl277g23.5p                                           GTCACCGTGCCAGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTANGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCA
  5   1   2       bld Ga12 5g3  in                         XL202j08.5p                                                  CGAGGGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACA
  5   1   2       bld Ga18      in                       xlk64g16ex.5p                                                     ACCGTGCCAGCGCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCNGNNNNGGNCTCCCCCGGTATCCGCCTCCATCCGGNGCCCGGATTAACAGTGGCCANNNNNNCATGNNGNNNNNNGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTNCTACAGGAGATANAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGNTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGNCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGNATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGANATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGANCTNAGAGTCAACTTGTGGCACTTNGGAA
  3  -1   2       bld Neu4                            IMAGE:4084670.3p                                                      AGCGGCCTCCATCTTGAAGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCTTCCGCTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCCATGCCCACACGTATCACATTCACTCC
  3  -1   2       bld Tbd4                            IMAGE:4058819.3p                                                                ATCTTGAAGCCGTGGTCTGAGTGTCCGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTNTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTNTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCCACAGTGACTATGAGACC
  5   1   2       bld Ga12 5g3  in                         XL197f14.5p                                                                  CACGAGGCCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCANGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCANCAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTACAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGG
  5   1   2       bld FaBN 5g3  in                    IMAGE:8074746.5p                                                                  CCCTCGTGCGCACTAGAGGTATGGTCCAGTATTCCCGGGATGTGGCCTCCGCCNGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCGTGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGCTGTTTGTCTCATGTCAAAGGAGCACTGGGGGATGATAGTGTCTGAAGCTGATATTATTTCTACGGTAGAATTCGATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCC
  5   1   2       bld Tbd7 5g3  in                         XL090k02.5p                                                                         GCGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAAC
  5   1   2       bld Ga15 5g                            XL508o10ex.5p                                                                          CGCGGTCTGAGAGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGNTTCCACCCTCACCACTGTAACACTTTTGTATA
  5   1   2       bld Tbd7 5g                              XL078b10.5p                                                                              GCACGAGGGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACT
  5   1   2       bld Ga12 5g3  in                         XL197e23.5p                                                                              GCACGAGGGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGA
  5   1   2       bld Ov1  5g                         IMAGE:6318484.5p                                                                                CTGAGTGTCCGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTTATATTGTAGATATTTAACCTGCCCACATGGAGGAGCTGACGGGAGTTTATCACAGCTGCCGAGTTTCACCCCTCACACTGTAACACCTTTTGTATACAGCAGCAGCAAAGGGCACCATCCGGCCTGTGTGAACATGCCGAGAAGTCGGGCCCTTGTTGTGGAA
  5   1   2       bld Spl       in                    IMAGE:8463175.5p                                                                                  GNGNGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGATAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAATGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGTAGTCTCGATCGATATTCGCCAATGGCCCACACTTTCACATCAACTCCATCTCTGTTAACTGTGACTATTACACCTACTTATAGGCGGATGACCTAAAATTCAACTTGTGGCACTTGGAAATAACGGATCGGACCTTGATATTGTAGATTTTAACCCGGCACTGGAGAGAG
  5   1   2       bld Ga18      out                     xlk149j10ex.5p                                                                                   TCTGAGTGTCCGGTCCTCCCGCCCCGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGNNNCATNNNNNCGNNGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGNATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGNNATCACAGCTGCCGANNNNNNCCTCACCACTGTAACACTTTTGTATNCAGCAGCAGNAAGGGCACAATCCGNCTGTGTGANATGCGAGAGTNGGCCTTGTGTGATCNCCACTNCNAGTTATTTGAGGNGNCAGAGNTCCCAGCANAGGTCATTCTTCTCAGAGATCNT
  5   1   2       bld Ga12 5g3  in                         XL171m02.5p                                                                                     GGTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACAC
  5   1   2       bld Neu7 5g3  in                         XL043n04.5p                                                                                      GTCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTG
  5   1   2       bld Ga14                              Ga14-p14f11.5p                                                                                      GNCCTCCTGCCCCGGNCANTGNTCTCCCCCGGTATCCGCCTCCATCCGGNGCCCGGGATTAANAGTGNGCCANNGGGCATCANGGNGTGGAGCTAGTTGGAGGCAATGATATTCAGTGGTGTTTTTCTCACCGTCAAAGGAGCANTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGNNGAGTTGCTTGCTACAGGANATAAAGGAGGAAGAGTG
  5   1   2       bld FaBN 5g                         IMAGE:8078093.5p                                                                                      GTCCGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTATATTGTAGATATTAAACCTGCCNACATGAGAGCTGAACGAGTTATACAGCTGCGAGTTCC
  5   1   2       bld Ga18      out                     xlk107g06ex.5p                                                                                      TGAGTGTCCGGTCCTCCCGCCCCGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGACCAACAGTGGCCAGGGGNGCATNNNNNCGNNGNGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGNTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGANCAGAGGGNTACAACCTAAAGGAAGAAAATGGGAGGNATAGGGATCCAACCACTGTGACCACACTAAGGGNNCCAGNATTNCGCCCCATGGACTTGANGNNTGAAGCGAGNCCACGACGGATATTCGCCNATGCCCACACGTATCACATCAACTCNATCTCTGTCAACAGTGACTATGAGACTTACCTGTNAGCAGACGACCTTAGAGTCAACTTGTGGNNNCTGGAAATAA
  5   1   2       bld Oo1  5g                         IMAGE:6861826.5p                                                                                       TCCGGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCCTCACACTGTAACACTTTTTGTATACAGCAGCAGCAAGGGGCACTATCCNGCCTTTTGTTGACATGCGCCGAAGTCAGCGTTTGTGCCGATCCGC
  5   1   2       bld Ga12 5g3  in                         XL193p13.5p                                                                                       AGGGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCA
  5   1   2       bld Ga15 5g3  out                      XL520d13ex.5p                                                                                       TCCGGTCCTCCCGCCCCGGGCAACGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCCTCACCACTGTAACACTTTTGTATACAG
  5   1   2       bld DMZ  5g3  in                         xl335k04.5p                                                                                          GGTCCTCCTGCCCCGGGCAGTGGCCTCCCCCGGTATCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCC
  5   1   2      seed Emb1 5g                         IMAGE:5156677.5p                                                                                                                   CCACGCGTCCGCCGCCTCCATCCGGAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCCAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGAA
  5   1   2       bld Ga12 5g3  out                        XL142d01.5p                                                                                                                       GCCGGTATCCGCCTCCTCCGGNGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCAC
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402370.5p                                                                                                                                CACTCCATCCGGAGCCCGGGATTAACAGTGGCCAGTGGCAGTATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCATGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCACTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACAGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGNCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCGCTTGGAAATTACGGATTCGAAGCTTTATATTGTAGATATTAAACCT
  5   1   2       bld Oo1  5g3  out                   IMAGE:3404727.5p                                                                                                                                    CCATCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAAGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTG
  5   1   2       bld Emb4 5g                         IMAGE:5572374.5p                                                                                                                                       TCCGGAGCCCGGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGGAACACTTTTGGATACAGCCGCAGCAAGGGGCACAATCCCCCCTGGGGGACATGCGCAGAGTCCGGCCCTGGTGGGGATCCCCCACTCCCAAGGTTTTTGAAGGAGCCCGAAGGGATCCCCCCCAAATAGGGGCATTCCCTTCC
  5   1   2       bld Emb3 5g                         IMAGE:3400140.5p                                                                                                                                           GAGCCCGGGATTAACAGTGGCCAGGGGCAGCATGGCGGGAGCTAGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCANCAAGAAAAGTAAAACCCTTTATCACCGGGGGGAATATAGTGTTTACAGGACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGG
  5   1   2       bld Ga12 5g                              XL164d14.5p                                                                                                                                              CCCGGGACCNACAGTGGCCANGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCANTGGTGTTTTTCTCAGGTCAAAGGAGCAGNGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACC
  5   1   2       bld Kid  5g                         IMAGE:4031402.5p                                                                                                                                                 GGGACCAACAGTGGCCAGGGGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATGTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAAGTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAAGGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTTCCACCCTCACCACTGGTAACACTCCTTGTATACAGGCAGCAGCAAGGGGCACAATCCCGCCCTGGTGTGAACATTGCCGAGAAGTCGGGCCTTTGTGGTTGAATCGCCCACCTCCAAAGGTTTAATTTTTAAGGGAAGCCCACGAAAGGATTCCCCCCAAGCAAATTTAGGGGGTCCATTTTCTTTT
  5   1   2       bld Ga15 5g3  out                      XL427g09ex.5p                                                                                                                                                                    GGCAGCATGGCGGGAGCTGGTGGAGGCAATGATATTCAGTGGTGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAG
  5   1   2       add Egg6                            IMAGE:4435532.5p                                                                                                                                                                                     TAGTGCTCGCGCTGATATTCAGGGGCGTTTTTCTCATGTCAAAGGATCAGTGGAGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCGATCATTCTGGCGAGTTGCTTGCTACAGGACATGAAGGAGGAACAGTGGACGTTTTCCATCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGCTTACAACACCTTTTTTATCCGCTAGCCAGAATTTGATTACTTGAAAAGCCTAGAAATAGAAGAAAAGATCTACTAGATCCGGTGGTTACCGGAAAACAATGCATCACAGATCCTGTTGTCTACAAATGATAAGACTATTAGACTGTGGAAAATCAATGAACGTGACAAGAGGCCAGAGGGCTCCAACCTAAAGGAAGAAAATGGGATGTATACGGATCCAGCCACTGTGACCACACTAAGGGTGACGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCCAGTCCGCGACGGATATTCGGCAATGGCCACACATATCAGATCAACTCCATCTCTGGCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCCACTTG
  5   1   2       bld Neu7      out                        XL004k24.5p                                                                                                                                                                                                              TGTTTTTCTCAGGTCAAAGGAGCAGTGGAGGAAGATGTATCTGAAGCGGATATTATCTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACTGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACG
  5   1   2       bld Emb1                            IMAGE:6864387.5p                                                                                                                                                                                                                    CCACGCGTCCGCCCACGCGTCCGGGATGATATATCTGAAGCTGATATTATTTCTACGGTAGAATTCAATCATTCTGGCGAGTTGCTTGCTACAGGAGATAAAGGAGGAAGAGTGGTCATTTTCCAGCAAGAGAGTAAAAGCCCTTATCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGGCACTATCCCGCCCTTTGTGACATGCGCGGAGTCAGCGTTTGTGCCGATCGCCCACTTCCAAGTTTATTTTGAGGGAGCCCAGAGGGATCCCCCAGCAAATAAGGGTCATTT
  5   1   2       bld Tail                            IMAGE:8542219.5p                                                                                                                                                                                                                                                                             AAGANNNNNTCATGGTTCNGNNGNNGAGTACCTAAATAAATTCGTCCCGGAAGAGTGGTCATTTTCCAGCAAGAGAGCAAAAGCCCTTATCACCGGGGGGAGTATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTCGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACAATCCGCCTGTGTGACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCAGCNATAGGTCATCNTCTCAGAGACATCTCTTCATATCGATGTTGAATCAGCACAACGTCGATCTGATGACTAGGACATCGTCATCAGATCTGGACTGAAATGAGACAGTCATGGAACTTCAGTANTGATACTCAGAAAACTTG
  5   1   2       bld Sp1                             IMAGE:5511975.5p                                                                                                                                                                                                                                                                                                                                                    AGAGAGTAAAAGCCCTTTTCACCGGGGGGAATATAGTGTTTACAGCACCTTCCAGAGCCACGAGCCAGAATTTGATTACTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCCACACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAAATATGAAANGCAGGCCGTGAANCATATCANG
  5   1   2       chi Int2                            IMAGE:8527668.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 ATAGGGGNNCCAGATATCNNNGGAGAACATCGATACGAATTCGTCCCCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATAATGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAACATATCAGTACATGAATACTCANGAGTAGCTCTGCTCCTATAGAAATGACTGCTCTCGACAGTTCAGTGCTGTGATGGCAGACACGTGTCTGATGCTCTCACACTCTTCGAGTTACGCACACACTGCTCCCTGAGCTCCGGAATACACTCCCGGCTAACGCAGTGCCACGACGAAGAATCGGGACTT
  5   1   2       bld DMZ       out                        xl329c13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTGAAAAGTTTAGAAATAGAAGAAAAGATCAACAAGATCCGGTGGCTACCGCAAAAGAACGCAGCACAGTTCCTGTTGTCTACGAATGATAAAACTATTAAGCTGTGGAAAATCAGTGAACGTGACAAGAGACCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACAATCCGCCTGTGTGACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCCGATGTGAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTC
  5   1   2       bld DMZ       in                         xl303k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCAACAAGATCCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAAC
  5   1   2       bld Egg1                               PBX0019E11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGGTGGCTACCGCAAAAGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTG
  5   1   2       bld Egg1                               PBX0018E12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAATGCAGCACAGTTCCTGTTGTCTACGAATGATAAGACTATTAAACTGTGGAAAATCAGTGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTA
  5   1   2       bld Oo1                             IMAGE:6638397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGATAAGACTATTAAACTGTGGAAAATCTGCGAACGTGACAAGAGGCCAGAGGGTTACAACCTAAAGGAAGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGAACACGTTGTCATGACTGGCTCATACAACAATTTCTTTCGGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAAGGCGTCGCNGGGAGAATAGCAAAACCTCGCACGGGTGCTGAAACCCCCGCAAGGTGGTGCGCCNAGTGGGCCAAGCGGNAAGAAAGGAACGAAATTCACCGGGTGGAAACGGTC
  5   1   2       bld Tbd7      in                         XL073e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACAAGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGT
  5   1   2       bld Ga15                               XL480b15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATGGGAGGTATAGGGATCCAACCACTGTGACCACACTAAGGGTGCCAGTATTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCACGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACAATCCGCCTGTGTGACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCCGATGTGAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAAACGCGACATCACCCTGGAGGCGTCACGGGGAGAACAGC
  5   1   2       bld Em10      in                    IMAGE:7981972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCTGTGACCCACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCNACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGTGCTGAAACCCCGCAAGTGTGCGCAGCGGCAAGCGAAGAGGACA
  5   1   2       bld Lmb1      in                    IMAGE:8531692.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACTAAGGGTGCCGGTTTTCCGCCCCATGGACTTGATGGTTGAAGCGAGTCCGCGACGGATATTCGCCAATGCCCACACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCG
  5   1   2       bld DMZ       in                         xl307d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCG
  5   1   2       bld DMZ       in                         xl306d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACGTATCACATCAACTCCATCTCTGTCAACAGTGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCG
  5   1   2       bld Te2N      in                    IMAGE:7203684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACTATGAGACCTACCTATCAGCGGATGACCTAAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTNACCATAACCTGTACATATTCCANGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCATAGTCGAGCTTAGAAATCATAACCCTGTTTCAAATCCCAGGAAAATTCCCACAGTAACGGAAAACttttttttCCCGTTCCTTC
  5   1   2       bld Spl       out                   IMAGE:8463348.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGACTATGAGACTTACCTGTCAGCAGACGACCTTAGAGTCAACTTGTGGCACCTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACAATCCGCCTGTGTGACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCCGATGTGAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAAGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAGGAGAACATCATCGCG
  5   1   2       bld Em10                            IMAGE:8320853.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAGTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTTCACAGAAGATCTTGCACACGGCCTGGCACCCTAANGAGACATCATCGCAGTGGCTACTACCNATACCTGTACATATTCAGGACGAGTCAATAGCACTGTAACGGGACGCCCTAGTTCATATCGAGCTAGATCATACC
  5   1   2       bld Kid                    IMAGE:4031306-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGT
  5   1   2       bld Kid                             IMAGE:4031306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAACTTGTGGCACTTGGAAATAACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCAACATGGAGGAGCTGACGGAAGTCATCACTGCTGCAGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGNGAGAATAGCAAACCTCGCACGGTGCTGAAACCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAAGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTTCAGGAACGAGGTCAATTAACACTTTGTAACGGGGACCAGCCCCTAAGTTCCATTAAGTCGAGCCCTAGAATTTCATAACCCCTTGTTTCCAATCCCGAAGAAAAAATTTCCCAACAGTTAACGGGAAACGttttttttttCCCAGGCCCCCTCCCTGGGCCTGGAACTTTTTTCCCCAGGTGTTTTAAAGGGGGGCAACTTTGGAAATTTCCCTTTTTTAAAAAACCTGGCGCCGG
  5   1   2       bld Emb1                            IMAGE:6865306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGGATCGGAGCTTTAATATTGTAGATATTAAACCTGCCCAACATGGAGGAGCTGACGGAAGTTATCACAGCTGCCGAGTTCCACCCTCACCACTGTAACACTTTTGTATACAGCAGCAGCAAGGGCACAATCCGCCTGTGTGACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCCGATGTGAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTTCAAATCTGAAGAAGAATTTCCAACAGTACGGGAAACGttttttttGCCCAGTCCCCTCCCTGGGTGTGGACTTTTTA
  5   1   2       bld Em10                            IMAGE:8321536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTAACACTTTTGTATACAGCAGCAGCAAGGGCACTATCCGCCTTTGTGACATGCGCGAGTCAGCGTTGTGCGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGTGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAATCCGAGGAAAATTTCCCA
  5   1   2       bld Tbd7                                 XL078a20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            acgaggcctcgtgccgaattcggcacgagggNACATGCGAGAGTCGGCCTTGTGTGATCGCCACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCCGATGTGAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCCGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGGAAACGTTTTTTTGCCAG
  5   1   2       chi Em10      in                    IMAGE:7980293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCACACCGTGTGTTTCACCCTTTGCATTTTAACCAGTGGGAAGGAAACAAAGAACATTTTGTTGTCTGTGATAGCCAAGACTTATCGCAGGCGATGAAATGTCCCATTACCCTAAAGGTGTCTGGAGATTATCCAGACTAAATAGAGATCTGAGGTAAGGTTTTGATCTCGGATGCAGCTATTTATACCTCCACTTTCCATGACCAATTCAGTTTTCCCATAATTTGAGCAGCAGCCTGAGCTTGTATATAATAATAATAATGCAGGTGTAGCACATTCACCCTGGTGTGGAGTATTCACCTCCTACCTCCCACACTATCTCCACAGCGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGTGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTT
  5   1   2       bld Lu1                             IMAGE:4633963.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACTCCAAGTTATTTGAGGAGCCAGAGGATCCCAGCAATAGGTCATTCTTCTCAGAGATCATCTCTTCCATATCTGATGTGAAATTCAGCCACAACGGTCGCTATATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGATCTGAATATGGAAAGCAGGCCCGTGGAAACATATCAGGTACATGAATACCTCAGGAGTAAGCTCTGCTCCTTATATGAAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTG
  5   1   2       bld Em10      in                    IMAGE:7981255.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATTCAGCCACAACGGTCGATACATGATGACTAGGGACTATCTGTCAGTCAAGATCTGGGACCTGAATATGGAGAACAGGCCAGTGGAAACTTATCAGGTACATGAATACCTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTACGCTGGGTTTCTGTATCTCTATTAttttttctttttaacatctcgctgactgtagattnatatgtattttttttATTTGTGATGCAATGCATACAGCTTTATGTTTAGATGTACTGTA
  5   1   2       bld Thy       out                   IMAGE:8546534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCAGGAGTAAGCTTTGCTCCTTATATGAAAACGATTGCATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAtttttttttttATTTTGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTACGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTATATATTTTTTTCCCCGTACAAGGTGTCTTGtttattttttatccactagattttttttCCATCTATAGCTTTATCAGTCATTGCATCCGTTTTTGTCCGTTCCTCTCTCTCTGGGGCATATTGATTCGGGGGAAGGTGAGC
  5   1   2       bld Brn3                            IMAGE:8539675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATGACTGCATCTTCGACAAGTTCGAGTGCTGTTGGAATGGGCCAGACAACGTTGTCATGACTGGCTCATACAACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTAttttttttctttttaaccatctcgcctgacttgtagatttaatgttttttttattattattttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCTACAGTACTAATGAATGAATTTGTACCTTGTATATTTTTTCCGTACAAGTGTCTGTTATTTTTATCACTCTAGATTTTTCATTTACGCTGCACAGTCATTGCACCCTTTCTGTCTTCCCCGCGTCACTTGTTGCTCGCCTT
  5   1   2       bld Emb1                            IMAGE:6864501.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCTTCGACAAGTTTGAGTGCTGTTGGAATGGGCCTGACAACGTTGTCATGACCGGCTCCTACAACAACTTCTTCCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGTACAAAGGTGTCtttgtttaattttttatccactagattttttttCATTCTATAGCTTTTATCAGGGTTCATTTTGCCATCCCCCTTTTT
  5   1   2       bld Int2                            IMAGE:8527652.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCTGACACGTTGTCATGACCGGCTCCTACAACAATTTCTTTCGGATGTTCGACCGCAACACCAAACGCGACATCACCCTGGAGGCGTCACGGGAGAACAGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGTGATGTNCAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTACGGTGCCCCCTGCAGTACTAATGAAAAGAATTTGTTACTTCTTATAttttttttCCCCGTACAACGTGTCTTGTTAATTTTTATCACAGATTTTTTCATCTACGCTTTCAGTCATTGCACCCCTTTTGTCTTCCTCTCCTGGTATGATAGATGAGTGAATCCGTCCTGTGGATCGACTCCTCTCTCGTTA
  5   1   2       bld Tbd7      in                         XL070j11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATACAACAACTTCTTCCGGNATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCGTCGCGGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGTGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTAttttttttatttttaaccatctcgcctgacttgtagatttaatgttttttttATTATTATTTTGNGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACA
  5   1   2       bld Ga18      in                      xlk151e04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAACTTCTTCCGGATGTTTGACCGCAACACCAAACGTGACATCACCCTGGAGGCNTCNNGGAGAATAGCAAACCTCGCACGGTGCTGAAACCCCGCAAGTGTGCNCNANNNNANNGGNAAGAAGGACGAGATCACGGTGGACAGTCTTGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGNGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCNNGGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGNTTACTGTATCTTTAttttttttctttttaaccatctcgnctgacttgnagatttaatgttttttttattattattttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGNACGGGTTACCCCCTACAGTACTAATGAAANGAANTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGtttatttttttatccactctagattttttttcattttACAGCT
  3   1   2       chi Lmb1      in                    IMAGE:8531692.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTCCGGAGTTGACCGCAACCAACGGACTAACCTGGAGGTTCGGGATTGCACTTGCCGTGCTAACCCGCAGGTTGGCACGGCAGCGAGAGACGAGATCACGTTGACAGTCTTGATTCACAGAGATCTTGCACACGGCCTGGCACCTAAGAGACATCATCGCAGTGGCTACTACCATAACCTGTACATATTCAGGACCGAGTCAATTAGCACTGTAACGGGACAGCCCCTAGTTCAATAGTCGAGCGTAGAATTCATAACCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCTTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGCGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTGTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCTTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTCATCACTTCTTGCCTTCTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGCAACCGTACTCCGCCCCACAGGTACAACACTACACTGTTAAAGTAATATCTCAGC
  5   1   2       bld Spl                             IMAGE:8460048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCAAACCCCGCACGGTGCTGAAACCCCGCAAGGTGTGCGCCAGCGGCAAGCGGAAGAAGGACGAGATCACGGTGGACAGTCTCGATTTCAACAAGAAGATCTTGCACACGGCCTGGCACCCTAAGGAGAACATCATCGCGGTGGCTACTACCAATAACCTGTACATATTCCAGGACCGCGTCAATTAGCACTGGCCCCTAGTTCCGCCTAGTTCCAATAGTCCAGCCTAGAATTCATAACCCTGTTCCAAATCTGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttattttGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTtactttcttatattatttttttccccgtacaaaggtgtctttgtttattttttatccactagattttttttCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCTCTCTCTGGGGCGTATTGATCGGGGAGTGAGGCTGGAGATCNACCGTCACTAGTGTGAGTTCCGAAACTCTCATCATTTCATCGGTTTTTAAAGACT
  5   1   2       bld Tbd7      in                         XL092n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGCCTGGCACCCTAGGNAGNAACATCATCGCAGTGGCTACTACCAATAACCTGTACATATTTCAGGACCGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTAtttttttttctttttaaccatctcgcctgacttgtagatttaatgttttttttattattattttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGtttatttttttatccactctagattttttttcattttACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGT
  3   1   2       chi Spl       in                    IMAGE:8463175.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTACAGATTGCCCGCGGCCCTAGAACTATGAGGTATCCATACTTCTATCCAGACGATCATACACTGTACGACGCCCTGTCAATATGAGCTAGATCATACCTGTTCAATCGAGAAATTCCACAGTAGGAACATTTTTCCATCCCTCTGGTCTGATTTTCCAGGTTAAGGTGCCATGATATCTTTTATAGCTGCGGGGGAAAATCCCCTGCAACTGTCATTTTCTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGCTGTAAGGGGCTATCCTGCCTTTCCCTCGCTACATAAGAATCCTAACCTAAGTCCCAGCGCACGG
  3   1   2       bld DMZ       in                         xl307d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAGTCAATTAGCACTTGTAACGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGNGGGNGGNAAGGTACTGTGGCAGAAAGTTGTCTCGGTCACAC
  3   1   2       bld Ga18      in                      xlk151e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGTCANTTNGNNCTNGNAACNGGGACAGCCCCTAGTNCCNATAGTCGANCCTAGNANTCANNNCCCTGTTTCAAATCCGNGGAAANTTTCCAACAGTACGGAAACNTTTTTTTCCAGTCCCNCCTGNTCNGACNTTTNCNAGTGTTTAAGGTNNCATTGATATNCTTTTNAATNNNGCGCGGGGNAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTnTTTTTTTnnTTTTTnACCATCTCGCCTGACTnGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCNNNCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAnCCAAAAAAGGAAGGAT
  5   1   2       bld Egg1                               PBX0149A08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTAttttttttctttttaaccatctcgcctgacttgtagatttaatgttttttttattattattttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAAGCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGtttatttttttatccactctagattttttttcattttACAGCTGGCATCAAGTTTATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTT
  3   1   2       bld DMZ  5g3  in                         xl335k04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGNTTGACCTNGGCAGGANNGGTGGGAG
  3   1   2       bld DMZ       in                         xl306d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACAATTNAAAGACAACNTGNCGTGTAATCNC
  3   1   2       bld FaBN 5g3  in                    IMAGE:8074746.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGGGACAGCCCTAGTTTCAATAGTGGAGCCTAGAATTCATAACCCTGTTCAAATCCGAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCNTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTNTGTGGCAGAAAGTCCTGTCGGTCACACACCATAAAGCACAACCCGCACTGTCACGACTTCATGCCTATCCTGCCACGAACAGGGGGTGGGACAAACAGGATATCAGGCGAAACGTACAACTGCGCGACAGCTAGCACAGCAAAGCCTGAGCTCCATCGTCAGTTTTTG
  3   1   2       bld Em10      in                    IMAGE:7980293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACAGCCCCTAGTTCCAATAGTCGAGCCTAGAATTCATAACCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACACACACATCCCAAAAAGCCACATCAGGAGAGCCGTTAAAGCCATTAGTGCAA
  3   1   2       bld DMZ       in                         xl303k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCGAGCCTAGNATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAA
  3   1   2       bld DMZ  5g3  in                         xl252e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTAGAATTCATAACCCTGTTTCAAATCCGAGGAAAATTTCCAACAGTACGGAAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTATTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTNTTNGCCACTGAAGGGGGTGGGACAAAAGGACATAAGGAGA
  3   1   2       bld Ga12 5g3  in                         XL193p13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGAGAATTTCCAACAGTACGGAAACGTTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTATTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATATGTATATTTTTTTTATTTTGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGTACAAAGGTGTCTTTGTTTAATTTTTTATCCACTAGATTTTTTTTCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCTCTCTCTGGCTTCGCTCTTTGCTAAATATACCCCTCTCTTTATCTCTCTCTGTTCTACTTTTGTTCGTCTCCTGCCCTTCCCTCTTCCTGCGCTGGTATAAATCCAACAGCTATAAAGCACACAGGGAATTGGGTTGACCTTGGCAGGGTTGATGGGATTGGTGGGAGGGGAAGTTCTATGGCAGAAAGTTGTGCATCGGTCACACTTTTTAATGACAACCTGACTGTATTCACTTCTTGCCTTCTCTGGGCACTGAAAGGGGGTGGGACAAAAGGAT
  3   1   2       bld Em10      in                    IMAGE:7981972.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGAGGAAAATTTCCAAACAGTACGGAAACGTTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGTGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTCTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACTGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCCGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATACTCAACAGCCAAACATCATAGGCCAGCTTTATATATCTGAACTGCAAC
  3   1   2       bld Te2N      in                    IMAGE:7203684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAATTTCCAACAGTACGGAAACATTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTTATTATTATTCAGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCGGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATATGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTAGCTTTTGTTAGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTAGGTCACACTTTTTAAAGACTACCTGACTGTAATCACTTCTTGCCTTTTTTGCCCCTGAAGGGGGTGGGACTAAAGGATATAAGGAGAAAACAAACCTACTACCGCGCCACAGGACAATCCTGAACGTAAGGCTCAGCCGCAGCCC
  5   1   2       bld Te2N                            IMAGE:7768356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGAATTTCCACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttaaccatctcgcctgacttgtagatggttaaaaaaaaaaaaaaaaaaaGGG
  3   1   2       bld Em10      in                    IMAGE:7981255.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTATTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATATGTATTTTTTTTTTATTTTGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGTACAAAGGTGTCTTTGTTTAATTTTTTATCCACTAGATTTTTTTTCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCTCTCTCTCTAGCTTCACTCTTTGCTAAATATACCCCTCTCTTTCTCTCTCGCTCTGTTCTACTTTTGTTCGTCTCCTGCCCTTCCCTCTTCCTGCGCTGGTATAAATCCAACAGCTATAAAGCACACAGGGAATTGGGTTGACCTTGGCAGGGTTGATGGGATTGGTGGGAGGGGAAGTTCTATGGCAGAAAGTTGTGCATCGGTCACACTTTTTAATGACAACCTGACTGTATTCACTTCTTGCCTTCTCTGGGCACTGAAAGGGGGTGGGACAAACAGGATTTAAGGAGAAAAAAAAAACAAACAAACACATAATAAAAAGCCCAACCCAAACATATAAAAGCTCTCTAGTGCAG
  5   1   2       bld Skin      out                   IMAGE:8640974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CACAGTACGGAAACGTTTTTTTGCCAGTCCCTCCTGGTGTGACTTTTTCCAGTGTTTAAGGTGCCATCGATATTCTTTTTATAGCTGCGCGGGGAGACCCCCCTGCTCCTGTCATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttttttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGTACAAAGGTGTCtttgtttaattttttatccactagattttttttCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCTCTCTCTGGGGCGTATTGATCGAGGAGTGAGGCTGGAGATCGCCGGTCCACTGGTGTGGAATTCCGAACTCTCCATTCATTTCTATCGGTTTTTTGAAAGACTATCAATGGGTGAAAGTTCATCCTTTGATAAATAGGCCTTTCAACATCCCATGGAGATGGAGGGAGTGGCGGAGTTTCGCTCTGGTGGACTGTGGTGGTCTCTGGCTTCACTCTTTGCTAATATACCCCTCTCTTTCCTCTCGCTCTGTCTACTTTTGTCGTCTCCTGCCTTCCCTCTCTGCGCTGTATAATCCACAGCATAAACACACAGGAATGG
  3   1   2       bld Ga12 5g3  in                         XL202j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAACATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTA
  3   1   2       bld Neu7 5g3  in                         XL043n04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTTTTCCAGTCCCTCCTGGTCTGACTTTTTCCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTATTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAA
  3   1   2       bld Tbd7 5g3  in                         XL090k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTNCTGTGGCAGAAAGTTGTNCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATAAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGNA
  3   1   2       bld Ga18      in                      xlk153n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTTTCCAGTGTTTAAGNTGCCATTNATATTCNTTTNANNNNNNNGCGGGGAAAATCCCCTGNNNNNNTCANTTTCTTNNCCAGCTGGAGTAACACNGGGTNNNCTGTATCTTTNTTTTTTTTCTTTTTAACCATCTCGCCTGACTnGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCNNNNCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAnCCAAAAAAGGAAGGATNANANCNNC
  5   1   2       bld Ga18      in                      xlk153n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTTTTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCCNGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTAttttttttctttttaaccatctcgcctgacttgtagatttaatgttttttttattattattttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGtttatttttttatccactctagattttttttcattttACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGNCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACaaaaggatataaggagaaaacaaaaataataaaaagccaaaaaaggaaggataaaaactactgaataaaaaCCATGGAGAAATGT
  3   1   2       bld Ga12 5g3  in                         XL197e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCAGTGTTTAAGGTGCCATTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTAC
  3   1   2       bld DMZ  5g3  in                         xl277g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTGATATTCTTTTTATAGCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTATTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCAACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAG
  3   1   2       bld Ga12 5g3  in                         XL197f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTATAGNTGNGCGGGGAAAATCCCCTGCAACTGTCATTTTNTTGCCCAGNTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTTATTTTTAACCATCTCGCCTGACTnGTAGATnTAATGTTTTTTTTATTATTATTTTGNGANGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGAT
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402370.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTGTAACACGGCAGGGGGAAAATCCCATGCAACTGTCATTTTCTGGCCCCAGCTGAAGTAACACTGGGTATACGGAATCATATATTTAATCTTTATAACCATCTCGCATGACTTGTAGATTTAATGTTTTTTTTAATATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATCTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTACTGAATAAAAACCATGGAGAAAAA
  3   1   2       bld Neu7                                 XL025i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGCATAAAAACTAC
  3   1   2       bld Neu7      in                         XL035d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTATTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTACnnAATAAAAACCAGGAGAAA
  3   1   2       bld Tbd7      in                         XL073e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGCGCGGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGGCACTGAAGGGGGTGGGACAAAAGGCATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAA
  3   1   2       bld Tbd7      in                         XL070j11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGCGGGGAAAATCCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTATTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGATAAAA
  3   1   2       bld Ga12 5g3  in                         XL171m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAAAATCCCCTGCAACTGTCATTTTCTTGCCCAGCTGGAGTAACACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTACATTTGCCACCCCCTTTTCTGTCACCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTNGCCACTGTAAGGGGGTG
  5   1   2       add DMZ                                  xl257a08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttATTTNGGGATGNCNAATGCAGTACNGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGGGTAGGGTGCCCCCTGCAGTACNAATGAAAAGAATTTTGTTACTTTCTTATATTATNTTTTTCCCCGTACAAAGGNGTCtttgtttaattttttatccactanattttttttCATTCTATAGCTTTATCAGGTTCATTTGCCACCCCCTTTTTTTGNCCTTTCTCTCTCTCTGGGGCGNATTGATCGGGGAGNGGGGTTGGAGATCGCCGGTCCACTGGNGNGAAGTTCCNAACTCTCCATTCGTTTCTATCGGTTTTTTAAAGGACTATCAANGGGNGAAAGTTCATCCTTTGATAAATAGGCCTTTCAACATCCCATAGAAATGAGGAGAGNGGCGGAGTTTCACTCTGGNGGACNGNGGNGATCTCTGACTTCACTCTTTGCTAAATATACCCCTCTCTTTCTCTCTCGCTCTGTTCTACTTTTGTTCGTCTCCNGCCCTTCCCTCTTCCTGCGCTGGTATAAATCCAACAGCTAT
  5   1   2       add DMZ                                  xl256i10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGNGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGGGTAGGGNGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGNACAAAGGNGTCtttgtttaattttttatccactanattttttttCATTCTATAGCTTTATCAGGTTCATTTGCCACCCCCTTTTTTTGNCCTTTCTCTCNCTCTGGGGCGNATTGATCGGGGAGNGGGGTTGGANATCGCCGGNCCACNGGNGNGAAGTTCCGAACTCNCCATTCGTTTCNATCGGTTTTTTAAAGGACTATCAANGGGGGAAAGTTCATCCTTTGATAAATAGGCCTTTCAACATCCCATAAAAATGAGGAGA
  5   1   2       add Ga15      out                      XL512g22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTCTTGCCCAGCCGGATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGNGATGNCAAATGCAGNACAGGCCTTTATAGTTTAGGATTGNACCTGTAGGGCGGAGNAGGGNGCCCCCTGCAGNACTAATGAAAANAATTTTGTTACTTTCTTANATTATTTTTTTCCCCGNACAAAGGGGNctttgtttaattttttatccactaaattttttttCATTCNATAGCTTTATCAGGTTCATTTGCCACCCCCTTTTTTTGNCCTTTCNCNCNCNCGGGGGCGNATTGATCAAGGAGNGAAGTNGGANATCACCGGNCCACTAGGGNGAGGTTCCNAACTCNCCATTCATTTCTATCGGTTTTTTAAAANACTATCAANGGGNGAAAGTNCATCCTTTGATAAATAGGCCTTTCAACATCCCATAAAAATGAAAANAGGGGCGGAATTTCACTCNGG
  5   1   2       bld Egg5                            IMAGE:3431178.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGAGTAACACTGGGTTTACTGTATCTTTAttttttttctttttaaccatctcgcctgacttgtagatttaatgttttttttATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATgaattttgtaaccttgttatatttttttcccatacaaaggtgtctgtttatttttttatCCACTC
  5   1   2       bld Ga18      out                      xlk79o24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAACGCTGGGTTTACTGTATCTCTATTAtttttttctttttAACCATCTCGCCTGACTTGTAGATTTAATATGTAttttttttttattttGTGATGTCAAATGCAGTACAGGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTAGGGTGCCCCCTGCAGTACTAATGAAAAGAATTTTGTTACTTTCTTATATTATTTTTTTCCCCGTACAAAGGTGTCtttgtttaattttttatccactagattttttttCATTCTATAGCTTTATCAGGTTCATTTGCCATCCCCTTTTTTGTCCTTTCTCTCTCTCTGGCTTCACTCTTTGCTAAATATACCCctctctttctctctctctGTTCTACTTTTGTTCGTCTCCTGCCCTTCCCTCTTCCTGCGCTGGTATAAATCCAACAGCTATAAAGCACACAGGGAANTGGGTTNACCTTGGCAGNNTTGATGGGANTGGTGGGANNNAAGTTCTATGGCAGAAGTNNNCATCGGTCACANTTTTTAATGACAACCTGACTGTATTCACTNCTTGCCTTCTCTGGGCANTGAANNGGGTGGGACNNAGGATTTAAGGAGAAnaaaaaacancaaaaataatnnaagccaaaaaaCGAAGGATANAACTACTGAATAAAACCA
  3   1   2       bld Ga15      in                       XL436e02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGGGTTTACTGTATCTTTATTTTTTTTCTTTTTAACCATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAA
  5  -1   2       bld Tail                            IMAGE:8544061.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCtttttttttttttttttttttaaccatctcgcctgacttgtagatttaatgtttttttttttttttttttGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATAtttttttcccgtacaaaggtgtctgtttatttttttatccactctagattttttttcattttaCAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACaaaaggatataaggagaaaacaaaaataataaaaagccaaaaaaggaaggataaaaactactgaataaaaaccatggagaaatggaaaaaaaaaaGGGACGAATTTTTTCGATGCTC
  3   1   2       bld Tbd3                            IMAGE:3550004.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCTCGCCTGACTTGTAGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGGAAGGAGAAAAACTACTGAATAAAAAC
  3   1   2       bld Ga18      in                       xlk64g16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGNAGATNNAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTNACAGTCTAGGATNGTACCTGTAGGGCGGAGNACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCNNNNCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAnCCAAAAAAGGAAGGAT
  3   1   2       bld Tbd7      in                         XL092n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATTTAATGTTTTTTTTATTATTATTTTGTGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTATNNTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGNNAGGTCTGTGGCAGAAAGTTGTGTCTCGGTCNCACTTTNTAA
  5   1   2       add Egg1                               PBX0120B12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATTTAATATGTAttttttttttattttGTGATGTCAAATGCAGTACATGCCTTTATAGTTTAGGATTGTACCTGTAGGGCGGAGTACGGTGCCTCCTGCAGTACTAATGAAAAGAATTTTGTTACCTTCTTATAtttttttttttcccccgtacaaacgtgtctttgtttaattttttatccactagattttttttCATTCTACAGCTTTATCAGGTTCATTTGCCACCCCCTTTTTTTGTCCTTTCTCTCTCTATGGGGCGTATTGATCGGGGAGTGAAGTTGGAGATCGCCGGTCCACTGGTGTGAAGTTCCGAGCTCTCCATTCATTTCTATCGGATTTTTAAAAGACTATCAATGGGTGAAAGTTCATCCTTTGATAA
  5  -1   2       bld Emb9                            IMAGE:7975581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCtttttttttttttttttttttttttGATGTCAAATGCAGTAAAGGCCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATAtttttttcccgtacaaaggtgtctgtttatttttttatccactctagattttttttcattttaCAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACaaaaggatataaggagaaaacaaaaataataaaaagccaaaaaaggaaggataaaaactactgaataaaaaccatggagaaaaa
  3   1   2       bld DMZ                                 rxl310b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNGATGTCAAATGCAGTAAAGGCCNNTACAGTCTAGGATTGTACCNGTAGGGCGGAGTACGGTTNCCCCNTNCAGTACTANTGAAANGAANTTTGTAACCCTGTTATATTTNTTTNCCGTNCAAAGGTGTCNGTTTATTTTNNNATCCACTCTAGANTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTNGCCACCCCCTTTTCTGTCCCCTNTCTCTCGCTGTTNTACTTTTGTTNGTNTCNTGCCCTTTCCCTCCNTGCCCTGCACCGGNATAAATCCAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATNGGTGGGAGGGAAGGTNNGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTCTGCCNCTGAAGGGGGTGGGACAAACGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAA
  5   1   2       bld Ga15      in                       XL486p03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATgaattttgtaaccttgttatatttttttcccgtacaaaggtgtctgtttatttttttatccactctagattttttttCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACaaaaggatataaggagaaaacaaaaataataaaaagccaaaaaaggaaggataaaaactactgaataaaaaccatggagaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL486p03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCTTTACAGTCTAGGATTGTACCTGTAGGGCGGAGTACGGTTACCCCCTACAGTACTAATGAAATGAATTTTGTAACCTTGTTATATTTTTTTCCCGTACAAAGGTGTCTGTTTATTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGCTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAG
  3   1   2       bld Emb4                            IMAGE:4202298.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAGGTGTTTGTTTATTTTTTTTATCCACTCTAGATTTTTTTTCATTTTACAGNTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTTTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCCAACTGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAnAAATAATAAAAAGCCAAAAAAGGAAGGATAAAAACTACTGAATAAAAACCATGGAAA
  5   1   2       bld Ga15      in                       XL436e02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGGCATCAAGTTCATTTGCCACCCCCTTTTCTGTCCCCTCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCANAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAA
  5   1   2       bld Ga15      in                       XL429d12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGCTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAaaaggatataaggagaaaacaaaaataataaaaagccaaaaaaggaaggataaaaactactgaataaaaaccatggagaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL429d12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCTCTCGCTGTTCTACTTTTGTTTGTCTCCTGCCCTTTCCCTCCCTGCCCTGCACCGGTATAAATCTAACCGCTATACAGCACACAGGGAAATGGTTTGACCTCGGCAGGATTGGTGGGAGGGAAGGTCTGTGGCAGAAAGTTGTCTCGGTCACACTTTTTAAAGACAACCTGACTGTAATCACTTCTTGCCTTTTTTGCCACTGAAGGGGGTGGGACAAAAGGATATAAGGAGAAAACAAAAATAATAAAAAGCCAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)