Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:4930071.5                      10 PI      90          5      869                calnexin [Xenopus laevis]
     2   0.0    0Xl3.1-xlk109p08ex.5                         6 PI      82       2495     2820                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012768212 Xl3.1-IMAGE:5079690.5 - 218 ESTs
                                                                       .....-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440......3450......3460......3470......3480......3490......3500......3510......3520......3530......3540......3550......3560......3570......3580......3590......3600......3610......3620......3630......3640......3650......3660......3670......3680......3690......3700......3710......3720......3730......3740......3750......3760......3770......3780......3790......3800......3810......3820......3830......3840......3850......3860......3870......3880......3890......3900......3910......3920......3930......3940......3950......3960......3970......3980......3990......4000......4010......4020......4030......4040......4050......4060......4070......4080......4090......4100......4110......4120......4130......4140......4150......4160......4170......4180......4190......4200......4210......4220......4230......4240......4250......4260......4270......4280......4290......4300......4310......4320......4330......4340......4350......4360......4370......4380......4390......4400......4410......4420......4430......4440......4450......4460......4470......4480......4490......4500......4510......4520......4530......4540......4550......4560......4570......4580......4590......4600......4610......4620......4630......4640......4650......4660......4670......4680......4690......4700......4710......4720......4730......4740......4750......4760......4770......4780......4790......4800......4810......4820......4830......4840......4850......4860......4870......4880......4890......4900......4910......4920......4930......4940......4950......4960......4970
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:5079690.5                                                        CCAGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACCATCACGACCATGACCACGATCATCATGACCACGATCATGACCACGATCATGACCACGACCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGTTTTTTTTTCTTTTCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATAAAAAAAAAAAACAGTTTAAACTTTTAATTGCAAAGCTTTTATTGAGAGGTTACTTACCGATTCTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAGTCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCGGAGAGTTGGTGCATAGTTTCTTGGTAAAAGCTTTGCAAATTAAAAGTTTAAACTGTGCTGGTGTTTTTTGTTTTTTGTTAAAATGAAACTAATTTAAAAAAAAAATTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTCGTGTAGGTTTCAGTCAGAACACAAATAAAATTTTT
                                                  Xl3.1-CHK-1012685158                                                              CGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACCATCACGACCATGACCACGATCATCATGACCACGATCATGACCACGATCATGACCACGACCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGTTTTTTTTTCTTTTCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATAAAAAAAAAAAACAGTTTAAACTTTTAATTGCAAAGCTTTTATTGAGAGGTTACTTACCGATTCTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAGTCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCGGAGAGTTGGTGCATAGTTTCTTGGTAAAAGCTTTGCAAATTAAAAGTTTAAACTGTGCTGGTGTTTTTTGTTTTTTGTTAAAATGAAACTAATTTAAAAAAAAAATTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTAxxTxxTCGTGTAxGxTTxxxxxxxxAxxxxAATAAAATTTTTAAGAAA
                                                      consensus depths                                                             4     6     4     9     5    13    14    25    14    28    19    34    23    37    23    37    23    37    24    37    24    37    26    37    26    38    26    38    29    38    26    38    28    38    38    38    37    38    38    38    38    39    39    40    38    40    39    40    38    40    41    41    40    41    42    42    42    43    42    43    42    43    41    42    40    41    40    41    39    41    39    41    39    41    40    42    40    41    38    41    41    41    40    40    37    39    38    38    38    39    38    39    35    38    35    37    35    37    36    38    36    38    36    38    37    40    37    40    33    39    33    38    26    33    27    33    26    33    24    34    25    36    24    36    25    35    23    33    19    31    20    29    19    28    18    26    18    27    21    28    18    28    18    28    19    29    19    30    20    31    21    31    20    29    19    29    19    29    19    27    19    26    21    27    20    27    19    28    21    28    18    25    20    25    22    26    22    25    22    25    22    26    23    27    23    26    23    26    23    26    23    26    24    27    25    28    26    29    24    27    24    26    25    27    25    28    24    28    25    27    23    26    24    26    23    25    22    23    22    23    21    23    21    23    20    22    19    21    19    21    19    21    18    21    19    22    21    24    21    24    21    23    21    23    22    25    21    26    22    26    22    27    23    29    23    29    22    28    23    29    23    29    23    29    21    27    20    27    20    27    20    27    21    27    23    28    21    28    23    33    24    33    24    34    30    35    26    34    20    30    27    29    20    29    25    29    25    29    21    31    20    32    23    33    27    33    26    34    19    34    21    34    24    34    21    34    23    34    23    38    20    41    27    42    26    42    20    39    26    38    27    39    23    38    33    39    31    38    32    38    31    38    32    39    35    42    37    42    37    43    37    43    36    44    38    43    39    46    38    46    41    46    40    47    36    46    39    46    41    47    36    46    32    41    32    39    23    33    24    33    21    30    22    31    20    32    20    31    20    27    20    27    18    26    19    26    14    25    18    25    19    24    19    24    19    24    20    24    21    24    21    24    19    24    22    24    23    25    23    25    22    25    26    30    27    30    27    30    28    30    28    30    27    31    28    30    28    30    26    30    27    30    27    31    28    31    30    33    29    33    28    33    23    33    24    34    22    31    26    31    15    27    17    20    16    18    17    20    14    17    12    13    12    13    12    14    12    15    11    15    10    14    10    14    11    14    11    14    10    13    11    14    11    14    11    14    10    13    11    14    12    14    12    15    12    15    12    14    12    14    12    14    11    14    10    14    11    14    11    14    11    14    11    14    11    14     9    13     9    13     9    13     6     8     5     8     5     7     2     5     4     5     4     5     4     5     4     6     5     6     5     6     5     6     5     6     5     6     4     6     5     6     5     6     5     6     4     6     2     6     2     6     2     5     3     5     2     6     2     6     5     6     5     6     6     7     6     7     6     7     6     8     7     9    10    11    11    13    11    14    11    14    11    14    11    14    12    15    11    15    11    15    11    13    11    13    10    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    13    11    13    11    12    11    13    11    13    11    13    12    14    13    14    15    16    15    16    15    16    15    16    15    16    17    18    17    18    17    18    17    18    18    19    18    19    18    19    18    19    17    19    16    18    18    19    17    19    17    18    17    18    17    18    18    19    18    19    19    19    16    18    16    18    17    18    14    20    16    21    15    21    16    25    16    27    15    26    14    25    14    27    11    26    17    34    15    34     9    32    12    31    18    34    18    34    17    34    17    35    17    36    16    36    15    35    20    35    19    35    21    34    24    34    24    34    26    34    26    34    24    33    24    33    27    33    29    35    29    36    31    36    29    36    30    36    29    36    30    36    28    36    28    36    26    35    25    35    22    35    22    34    21    32    18    32    10    26     6    19     6    17     6    11
                                                                   VAR                                                                                GGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCACGA
                                                                   VAR                                                                                                                                                                                                                                CCGTGACCACGA
                                                                   VAR                                                                                                                                                                                                                                            TCATCATGACCACGATCATGACCA
                                                                   SNP                                                                                                                                                                                                                    ---T--------
                                                                   SNP                                                                                                                                                                                                                                ----G-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        T----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---G--A-----
                                               BLH ATG     100    1247                                                        
                                               BLH MIN     100     388                                                        
                                               BLH MPR     100     388                                                        
                                               BLH OVR     100      43                                                        
                                               CDS MIN     100      21                                                        
                                               EST CLI      17      21                                                        
                                               ORF LNG     100       6                                                        
  5   1   2       bld Emb1 5g                         IMAGE:5161744.5p CGAGAGAGGGTTTTTCAGACAACAGCGCCCCTCTTTTATAGCTTATCGCTCCACCCCAGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACcatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgatgaCCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAANTGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACCAGTGTGGGTGAAGGATTACAAACTGCATTTCATTTTCCGGCACAAGGAACCCCAAGACTGGAGGAATATGAGGGAGAA
  5   1   2       chi Eye1                            IMAGE:6947230.5p                                TCTTTTATAGCTTATCGCTCCACCCCAGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGAccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgatgaCCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAAGCCTTGTTCTAATGTCACGTGCAAAAACACCATGGCAATTGTCAGCCAACCTGAATAAGCCCTTTTGTTTTTGATTAAGAAATCCTTTTAATCCTTTACAAATATGAAAGCTTAGATTTTTTCCAAAATGGGAAATTTGAAATGGTggggggggTGCCAATACGTTGGAAAAACTAACTTTTTCCCAAGAAACTTCACAAGAAACCGGAATACCCCCGCAGCCAAGTTTCCCATTGGAATAAAGAACGCCCCCTCACACCTATATCCATGGTTCTTGGGGGCCCTGAAACAAAGTTGGTTGGGTTGAAGGGATATTTACCCAAACTTGGCCAATTTCCCATTTTTTTGCCCGGCCTACTAAACGACGCCCCCCCTATTGAACATGGGGAGAAATAATTTGGAATGGAGGCAAAAAACTTGGTGCTAAAAATGGGCCCCTTTGAATGTCTCATAA
  5   1   2       bld Emb1                            IMAGE:6632613.5p                                       CCACGCGTCCGGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgatgaccTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACCGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACCTTTCAAAACTCAAGAACAGAAACCCCAGCAGTTCCATGATAAGACGCCCCTACACTATCATGGTTTGGGGCCTGACAAGTGTGGTTGAGGGAATTACAAACTGGCATTTTCATTTTTTCCGGG
  5   1   2       bld Thy  5g                         IMAGE:8551246.5p                                           CCTCAAGTTNNNNGGGAATACCTAAAGAATTCCTCCGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCACGACCatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCTTTCATTTTCGGGCAAAGAACCCCAGACTGGAGAATTGATGAGAACTTGCAAACAACAGATGCGACTAAATCTTCTTTTCAACAGAACTCACTTCACCTATT
  5   1   2       bld Brn2 5g                          Brn2-za41b01.5p                                               GGCTCCACCCCAGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACCATCACGACCATGaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTT
  5   1   2       bld Tbd7      in                         XL068d03.5p                                                      CGAGGGTTCGCTTCACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAA
  5   1   2       bld Emb4      in                    IMAGE:4203183.5p                                                           CGTCGACCCACGCGTCCGGNTGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATcacgaccatgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAAT
  5   1   2       bld Emb4                            IMAGE:4681451.5p                                                             CCACGCGTCCGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCAcgaccgtgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAACCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCCGAGCAGTTCCATGATAAGACGCCCCTACACTATCATGTTTTGGGGCCTGAACAATGTGGGTGGAAGGATTACAAAACTGGCATTTTCATTTTTTCCGGGGaacaaaaaccccccaaaaactggcaaaaaTTATGACGGGAGAATACCCTTGGCAAAAACCCGAACCCAAGATTGGCCAGAACCCCTAAAAAATCTCTTTTAACTTTTTTTCTCCAAACAACaaaaaaaaaaaccccctcccccccctttttaccccacccccccATAAATC
  5   1   2       bld Brn2                             Brn2-zb08g05.5p                                                               GACTCTAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGGGATCATGGATCTGAAATGGGGTGGTGTTTTTTTGTACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgacCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGG
  5   1   2       bld Brn2 5g                          Brn2-zb04c11.5p                                                                     GAGGCTGGGCACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGGGGGGGGttttttttttggtgcttggtgtagtaacaataaaggctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgacCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACATAGGAACTTTGGATGGGTGGGTTCTTTCCA
  5   1   2       bld Neu7 5g3  in                         XL003n10.5p                                                                         GGNCTGCAGGNAATTCGGCACGAGGCCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACCATCACGAccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgaCGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGAACAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGT
  5   1   2       bld Emb4                            IMAGE:4202842.5p                                                                           GTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCtcatgaccatcacgaccgtgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgaTGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCT
  5   1   2       bld Oo1                             IMAGE:6640821.5p                                                                           GTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAatgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgaTGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAAACTCACCCTTTACACCCTAGTCTTTAAATCCCTGATAACAGCTTTGAAAATCCTGGNNTGATCAAACCCGTTGTAAAATCGTGGGGAAATCTCCTAAATGACATGA
  5   1   2       bld Kid  5g                         IMAGE:7012517.5p                                                                                 CACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTNCAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAAGATTACAACTGCATTTCATTTTCCGGCACAAGAACCCCAGT
  5   1   2       bld Ga18 5g3  in                      xlk131h10ex.5p                                                                                 GCACGTGACGGGGTTCTTGCTGCNNNNNGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGNTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAANTGAATGTGGGGGTNCATACGTGAAANTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGANAAGTGTGGNGAGGNNTNNAAACTGCATTTCATTTTCCNGCACNAGAACCCCNAGACTGGAGANNNTGNNGNGAANNAT
  5   1   2      seed DMZ  5g3  in                         xl313a08.5p                                                                                 CACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCA
  5   1   2       bld DMZ  5g3  in                         xl313a12.5p                                                                                 CACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGC
  5   1   2       bld DMZ  5g3  in                         xl254d21.5p                                                                                  ACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTANAANATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAANAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGANTGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAAC
  5   1   2       bld DMZ  5g3  in                         xl254j21.5p                                                                                  ACGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCA
  5   1   2       bld Ga18 5g3  in                       xlk80l20ex.5p                                                                                      TGACGGGTTCTTGCTNCANNGNNGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGNTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGNTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAANNTACTTTCCAAAACTCAAGAACNNNAACCCGAGCAGNNNATGATANGACGCCCTACACTATCATGTTTGGGCCTGANAAGNGTGGTGAGGNNTACAAACTGCATTTCATTTTC
  5   1   2       bld Emb4                            IMAGE:4724785.5p                                                                                       TTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGAccatcacgaccgtgaccacgatcatcatgaccacgatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGGTTACAAACTGCATTTCATTTTCCGGCACAAGAACCCAAGACTGGAAAAATATGAGGAAAAAATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAAAAAACTCACCCTTTACACCCTAGTCTTTAATTCTGAAAACAGCTTTTGAATTCTGGTTGAATCAAACGGTTGTAAAATCGTGGGGAT
  5   1   2       bld Neu7 5g3  in                         XL003d24.5p                                                                                        AGGGGTTCTTGCTGCCNCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccACNNNCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATACAAATCTCCCA
  5   1   2       bld Int2 5g                         IMAGE:8530738.5p                                                                                        CGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGgctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTTTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCTAGCAGTTCCATGATTAGACGAGCTACACTTTCATGTTTGGGCCTGACAAGTGTGGTGAGGATTCATACTGCTA
  5   1   2       bld Oo1  5g                         IMAGE:5079690.5p                                                                                         GGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCtcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCCAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGAACTAAAATCTTACTTTTCAGAACAGAAAACTCAACTTTTACACCCTAGCCTTAAATCCCTGATAACAGCCTTTGAAAATCCTGGNTGGATCCAAACC
  5   1   2       bld Neu7 5g3  in                         XL046p12.5p                                                                                            GTTCTTGCTGCAGCGGCGGNCTTGGNGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGNTCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaCCATGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAA
  5   1   2       bld Ga18 5g3  in                      xlk130d22ex.5p                                                                                               TTCTTGCTNCNNNNNNACTTGGAGGGNNNCGGTGTGCTGGGGAGGNTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacnatcatgaccacgaccaTGATGATGACGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGNGACTTACAAAGCCCCGGNCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACNTT
  5   1   2       bld DMZ       out                        xl243o09.5p                                                                                                       CGGGGTTCTTGCTGCNNCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCtcatgaccatcacgaccatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgatgaccTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGANATGAAAGATTCAAATCTCCCAGGGGACCTANGCCTTGTTCTAATGTCACGTGCNAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCANGAACAGAAACCCG
  5   1   2       bld DMZ                                  xl233h24.5p                                                                                                       CGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCTCATGACCATCACGACCatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAA
  5   1   2       bld Ga15      in                       XL439l14ex.5p                                                                                                           CGTGACGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATaaatgctcatgaccatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacGATGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAG
  5   1   2       bld Ga18 5g3  in                      xlk164m13ex.5p                                                                                                             GGACTTGGAGGGCGNCGGTGTGCTGGGGAGGNTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGNTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAANTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGNNAAGTGTGGTGAGGNNTNCAAACTGCATTTCATTTTCCGGCACAAGAACCCCNAGACTGGNG
  5   1   2       bld Emb4 5g3  in                    IMAGE:4203368.5p                                                                                                              GACGCGTGGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCACGACCATGaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGA
  5   1   2       bld Ga12 5g3  in                         XL218g03.5p                                                                                                               ACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGACCATCacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgggctggacattgatgatgaccTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACA
  5   1   2       bld Sp1                             IMAGE:5513426.5p                                                                                                                CGGGGTTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATgctcatgaccatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATACAAACTGCATTTCATTTTCCGGCACAAGATCCCAAGACTGGAGAAATGANGAGAACATGCAAACGACAGATGCGACTAAATCTACTTTCGACAGAA
  5   1   2       bld Brn1 5g                         IMAGE:6952111.5p                                                                                                                 TTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGctcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGAACAGTGTGGTGAGGATTACAAACTGCATTTCATTTTTCGGCACAAGAAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTTCAGACGAGAAAAACTCACCTTTACACCCTAGTTCTTAAATCCTGATTAACAGCTTTGAAATCCTGGGTTGATCAAACCGGTGTAAAATCCTGGGGAAATCTCCTAAATGGACCTGGACCCCCTCCCGTGGAATCCCCCCTAATGGGGATTGGAAAGATCCCGGAGGGAATAAAAAAGGCCCGGAC
  5   1   2       bld Ooc1      in                      xlnoc002o24.5p                                                                                                                     TTCTTGCTGCAGCGGCGGACTTGGAGGGCGCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCAtgaccatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGGCTGCTTCTGCTTCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGT
  5   1   2       bld Tbd3 5g                         IMAGE:3549650.5p                                                                                                                          CGCCGGTGCGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAAGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCtcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGGAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTCTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTGCAAAACTCAAGAACAGAAA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202320.5p                                                                                                                          GCCGGTGTGCTGGGGAGGCTGAGTCACTGTGATCATGGATCTGAAATGGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAAGGCtcatgaccatcacgaccatgaccacgatcatcatgaccacgatcatgaccacgatcatgaccacgaccatgatgatgacgatgGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTTCGGCANCAGACCCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAAA
  5   1   2       bld Emb4                            IMAGE:4930582.5p                                                                                                                                                                                                 GGTTTCTGTTAGTGACTCTTCTGGTGCTTGGTGTAGTAACAATAAATGCTCATGaccatcatgaccatcatgaccacgatcatgaccacgaccatgatgatgacgatGGGCTGGACATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCCTTAAATCCTGGATACAGCCTTTGGAAATCCTGGGTTGGATCAAAACCGTTGGTAAAATCGTGGGGAATTCTTCCCTAAATGGACATGGAAcccctcccccgggaaatcccccccTAATTTGGAGAATAGNAAGGATTCCCCGAAGGGGATTAAAAAAGCCCTTCGAAAAGATTTTGGGGAATTGNAANAA
  5   1   2       bld Emb4                            IMAGE:5516360.5p                                                                                                                                                                                                                                                                                                      TGACGATGGGCTCTTATTGATGATGACCTAGAAAATCCCGAAGAATTAAAACCAGATACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACCGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAATGACATGAACCCTCNNCGTGATCCCCCTATGAGATAGAAGATCAGAAGATAAAGCCCTGAGATGGGATGAGAGACAAATATCAGAC
  5   1   2       bld Tbd7      in                         XL085m13.5p                                                                                                                                                                                                                                                                                                                 GCATTGATGATGACCTAGNAAAATCCCGAGNAATTAAAACCAGAGNACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTC
  5   1   2       bld Ga15      in                       XL404n10ex.5p                                                                                                                                                                                                                                                                                                                                                          CAGAGACCAGCCTGCCTCCTCCTGCTCCCAAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGGAAgaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGG
  5   1   2       chi Egg1                               PBX0027B07.5p                                                                                                                                                                                                                                                                                                                                                                                       AAGGTGACTTACAAAGCCCCGGTCCCAACAGGAGATGTCTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGACACGGATGAAGAGATTGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAAGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAA
  3   1   2       chi Ga15      in                       XL404n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                       CCGGTCCCCNACAGGAGATGTNTATTTTTCAGAATCATTTGACAAAGGAACTTTGGATGGGTGGGTTCTTTCCAAAGCCAAGAAAGATGNCACGGATGAAGAGATTGCCAAATATGATGGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAA
  5   1   2       chi Panc                            IMAGE:8737838.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGGCTGGTTTGTTAGACTATCCCACCCGATTCGAATTCGTCCCGCCAAATATGATGGTAAATGGGAAGTGACAGAAATGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGAAAGAAGATCAGAGGAATAAAAAGCCTGAAGATTGGGATGAGAAGAACCAAAAATATCCGAATCCGATGCTTGGAAACCTGATGACTGGATTAAGGAAGCCTCCTGCAGATCCAATGAACTGTCGTTGAACCGAAGGCTGGCTGAGTAGAGAACCTGAATACCCTTCTATCCAATGCCAGAAGCCCAGAACTGGTTAGAAATGATGGATTGAAGCCATTGCAACTCATTGACGCCCTGGTGAATCGCGACATTTGAATCCGTCAAGCCAGTGAAGTCCATGTA
  5   1   2       bld Ga15                               XL511j20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAATATAGATGGGTAAATNGGGAAGTGACAGAAATAGAAAGATTCAAATCTCCCAGGGGACCTAGGCCTTGTTCTAATGTCACGTGCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTCGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAA
  5   1   2       bld Emb4      in                    IMAGE:4203280.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCAAAACACCATGCAATTGTCAGCAAACTGAAGAAGCCCTTTGTCTTTGATAAGAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGA
  5   1   2       bld DMZ       out                        xl234b06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAATCTTTAATCTTACAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTC
  5   1   2       bld Ga15      in                       XL439n10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCGCAATATGAAGTTAATTTTCAAAATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGGTATATGGAAACCA
  5   1   2       bld Tbd7      in                         XL058e03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATGGAATTGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGG
  5   1   2       bld Ooc2                            IMAGE:3746055.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATGTGGGGGTGCATACGTGAAACTACTTTCCAAAACTCAAGAACAGAAACCCGAGCAGTTCCATGATAAGACGCCCTACACTATCATGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAACACGACCAGATGCAGACCTAAAATCTTACTTTTGAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAGCAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCGCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAATTATATCAGATCCAGATGCTGTGAAACCTGATGACTGCGATGAGGATGCTCCTGCCTAGATTCCAGATGATAGTGCTGTGAGATCC
  3   1   2       chi Tad1                            IMAGE:6877729.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACACACCATGGCCAAAAGCATGCCCCCCAATATTTCGCCAGGACCCTCTACCAAATTGCTTTCCATTTTCTTCCCGGAACCCGAGTCAAAACCTTCTAGCCCTTTTTACCCACCCCTTGGGTTCTTTAAACATCCCCCAATACACCCAGACTTATTGAAAATTCCCTCGGTTGCATCTCAAAACCCGGTTTGTAAAATTCGTTGGGGAATTCTCCTTAAATTGACCAGGGAACCCCTCCCCGTGAAATCCCCCCCTAATTGAGGAAAGAAGAATCCAGGAGGGATAAAAAGCCCTGAAGATTTGGGGATGAGAGGACCAAAAAATATCCGGATCCCAGATGTTGTGAAACCTGATGAACGGGGATGAGGATGCTCCCTGCCAAATTCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACTTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATTCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCGGCAAGTTTTTCTGGCCAACTCCTTTTTGAAANNNANANCCNCNGCCACACCAGCAACCCGCNGAGAACGATGTCGCGGTCAAGGACAAG
  5   1   2       bld Ga15      out                      XL510j20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTACACTNTCATGNTCGGGCCTGACTAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGA
  5   1   2       bld Ga12      in                         XL171f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATNTGTTTGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTA
  5   1   2       bld Egg1                               PBX0126C04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGGGGCCTGACAAGTGTGGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGTGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATG
  5   1   2       bld Ga15      in                       XL466i08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGTGAGGATTACAAACTGCATTTCATTTTCCGGCACAAGAACCCCAAGACTGGAGAATATGAGGAGAAACATGCAAAACGACCAGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGGCTAATGATGGATGGGGCCTAAAAAAAGGCAGCTGATGGAGCTTCTGCGCC
  5   1   2       bld Emb1                            IMAGE:6864248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGATGCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATTCACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCTTTCTACGCAGTTGGGCCTTGAACTGTGGGCCTATGACTTTCCGATATTTTTCTTTGGAAAATTTTTATTTATCTGGCTCAGAAAAGAAATGGTGGCTTGATTAACCTGGGGCTAATGGAAGGGATTGGGGCCTTTAAAAATGGGCAGCTGGATGGGAACCTTCTGGCCTCCTAGTGGTAGGGGGGGACAAATGAATAACCGGCCTGCAAAAGAAAAAGACCCTTGGGCTCCTGGAATGGTTTTAAATATCCGAAAGGGGGGCCCCTGGCCAGTTTTCTCCTGGGTTTTACACCTTTCTTGCTGGGCACTGGGGAAATAAAAACAGCCTTTTTGGTAGGCCAAAAACAAA
  5   1   2       bld Egg1                               PBX0037D06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAA
  5   1   2       bld DMZ       in                         xl339b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGACCTAAAATCTTACTTTTCAGACAAGAAAACTCACCTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGC
  5   1   2       bld Gas8                            IMAGE:3516236.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCTTATCTGTAAAATAAGAAAACTCATCTTTACACCCTAGTCCTAAATCCTGATAACAACTTTGAAATCCTGGTTGATCAAACTGTTGTAAACCGTGGGAGTCTCCTAAATGACATGAGCCCTCCTGTGAATCCCCCTAGTGAGATAGAAGATCCAGAGGATAGTAAGCCTGAAGATTGGGATGAGAGACCAAAAATACCAGATCCCGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAATGCTGTCAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACATTTCTGATCCTGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATACTAAGTGTGAGTCTGCTCCTGGTTGTGGAGTCTGGCAGCGACCCACTATTGACAATCCCATGTACAAGGGCAAATGGAAGCCT
  5   1   2       bld Emb4                            IMAGE:5514532.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAAGAAAACTCACCCTTATCCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGCGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGNGCCTANAAAGGCAGCTGATGGAGCTCTGCGCCTAGTGTAGTGGGACAATGATACTGCTGCAGAGGAAGACTTGGCTCTGGNATGTTATATCTGATGTGCTCTGCAGTTTTCTGGTAT
  5   1   2       bld Emb4                            IMAGE:4682391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTTACACCCTAGTCTTAAATCCTGATAACAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGNTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGGTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACCAAAAGACTGATGCTCCCCAGCCTGGATGTAAAAGAGGGG
  5  -1   2       chi Neu4                            IMAGE:4084506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCGTAAATCGTGGTAGCAGCCGTGAGATGCTGGTTGATGGGACTGTTGTGGACCGTGGGAGTGTCTAAATGACGATGAGCCCTCCTGTGAATCCCCCTAGTGAGATAGGAGATCCAGAGGATAGTAAGCGTGAAGATTGGGATGAGAGACCAAAGATACCAGATCCCGATGCTGTGGAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAATGCTGTCAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACATTTCTGATCCTGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATACTAAGTGTGAGTCTGCTACTGGTTGTGGAGTCTGCCACCGACCCACTATTGACAATCCCATGTACAAGGGCAAATGGAAGCCTCCAATGATTGATAATCCAAACTATCAGGGTATATGGAAACCAAGAAAGATCGCAAA
  5   1   2       bld Ooc2                            IMAGE:3746072.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAATTCCCAGCTTTGAAATCCTGGTTGATCAAACCGTTGTAAATCGTGGGAATCTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCATACTATCAGGGTATATGGAAACCAACAAATATCTCAAATTCAGATTTGTTTGAAGATCTAGAACCATTCAGATGACTACATTCTATCAGTTGCCCTGAACTGCTGTCTATGACTTGCGAC
  5   1   2       bld Ga12      in                         XL209l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCTAAATGACATGAACCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGA
  5   1   2       bld Ga12      in                         XL173n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCCTCCCGTGAATCCCCCTAATGAGATAGAAGATCCAGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGA
  5   1   2       bld Ga15      in                       XL459l23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGCCCTAATGAGATAGAAGATCCNGAGGATAAAAAGCCTGAAGATTGGGATGAGAGACCNAAAATATCNGATCCNGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCNAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACCAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCA
  5   1   2       bld Ga15      in                       XL505h18ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAGGATANNAAGCCTGAAGATTGGGATGAGAGACCAAAAATATCAGATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACNAGGGCANATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCANCCTGATGTAAAAGAGGAG
  5   1   2       bld Neu7      in                         XL017i16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTG
  3   1   2       bld Tbd7      in                         XL068d03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GATCCAGATGCTGTGAAACCTGATGACTGGGATGAGGATGCTCCTGCCAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGNCCNAATGTAAAAGAGGAGCA
  5   1   2       bld Sp1                             IMAGE:5511747.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGATCCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGANAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCCTGATGtaaagangaggaggaggaggaaagagaagaanaagacataggctgaaagagaagagaTGCTNGAGAAGTGACACGCAAACCNNAAGCAGATGAGATGAAGTGATGAAGGGCAGAAGCCAN
  5   1   2       bld DMZ       in                         xl266a15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCAGATGAAAGTGCTGTGAAACCAGAAGGCTGGCTGGATGATGAACCTGAATACACTTCTGATCCAGATGCAGAGAAGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAG
  3   1   2       bld Ooc1      in                      xlnoc002o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGATCCAGATGCAGAGAAGCCAGAGGACTGGAATGNAGATATGGATGANGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGGAGGAGGAGGAAAA
  5   1   2       bld Neu1      in                      Neu1-29E8-1.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCAGAGGACTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAG
  5   1   2       bld Tbd7      in                         XL071c01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGGGATGAAGATATGGATGGAGAATGGGAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAG
  5   1   2       bld Emb1                            IMAGE:6636458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGGCACCACAAGTGGCAAATCCTAAGTGTGAGTCGGCTCCTGGTTGTGGAGTCTGGCAGCGACCTACTATTGACAATCCCATGTACAAGGGCAAATGGAAGTCTCCAATGATTGATAATCCAGACTATCAGGGTATATGGAAACCAAGAAAAATCCCAAATCCAGATTTCTTTGAAGATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAGCAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGtaaaagaagaggaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgcctgaagaaagTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCCCAAGAGGAGATCAAACCTAAAGAAGACGACCTCATGCNCCCCATCCCCCCAGAAAATCGAACAACCTCCCAACAGATTAAGAAAAACCAAATAATATTCCCCAATCCCCACCAATGGAACTTGGAACCATTTGGCCAGAAAGTCTACTATTAAAAACAAAAAGCCTTTCCTGGCTTTTCTCCGGAGGATAAACTACCCTATTCCACGGGAACCATTTGCAACCCCTTGAAAGACTCCTTTGGCCCCCCCAACAAAT
  5  -1   2       chi Bla2                            IMAGE:7295623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGCCGCCGGGGGTGGAGGACGGCGCGGGACCCCTTGTCCCAACATCAATAATCAAGGGAGGGAGGATGCCTCAAGTGTGAAGCTATGCTGCGTTTCTGTGTCATCGGAAGCCCGGCAGGATCCGCCATCCGTGTTTTTTTGAAGATCGGCGAGCCGATCCGGGTGGACTTCAATTCTGCTACGTTATGCCTCTAGATTGTGGTTGATTGACTCCGATATTCTTCTTTGATAATTTTCTTTCTTGGTCAGGGGAAAAAATTGGGTCTGTACTGGGCTAATGAGGACGGGGCCTAAAAAAAGAAGCTGGTGGTGATTTTGCGCCTAGTGTGGTGGGACAAATGATATCTGTTGCGGAGGAAAGGCCCTGGGTCTGGATTGTTTATATTTGGACTGTGGCTTTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAGAAGACTGATGCTCCACAGCCTGATGTAAAAgaggaggaggaggtggaagaggaggaggaaggaaaagacaataaggctgaagaggaagaggatactgaagaaagtggaaagcaaaaaccaaagcaggatgaagaagaagggaaagaaagccaagatgaagaagaggcagaagaggaggcaaaagaggagaTCAAACCTAAGGAGGATGAAATTATAAACAGATCTCCAAGAAATCGAAAACTTCGAAGAGATTAAGAAAGCAAATATATTAAAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAAATaaaaaaaagaaaaaaaaaactaag
  3   1   2       bld Ga15      in                       XL439n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATCTAGAACCATTCAGAATGACTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCA
  5   1   2       bld DMZ       in                         xl232o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCCATTCTACGCAGTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTaaaagaggagcaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagaTGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGgatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggagatCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTAC
  3   1   2       bld Ga15      in                       XL423o08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACGCAGTTGGCCTNGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAA
  5   1   2       bld Ga15      in                       XL423o08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTGGCCTTGAACTGTGGTCTATGACTTCCGATATTTTCTTTGATAATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCNAAAAGATTAAGAAAACAAATATATTCC
  5   1   2       bld Neu7      in                         XL043d14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTTTATTATCTGCTCAGNGNGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAgaggaggaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagtgacacgcaaaaaccaaagcaggatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATTaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCC
  5   1   2       bld Ga18      in                      xlk164l13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTATTATCTGCTCAGAGAGAAATGTGGCTGATGACTGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTNNNNTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGtaaaagaggagcaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagtgacacgcaaaaaccaaagcaggatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggnagaagaggagaTCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTNGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGNCGACTTCNTGGNGGGA
  3   1   2       bld Ga18 5g3  in                       xlk80l20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNTCNGCNNAGANNGAAATNTGCTGATGNCTGGNCNNATGATGGATGGGGCCTAAAAAAGNCAGCTGATGGANNTTCTGCGCCTAGTGNAGTGGGACAAATGATANCTGCTGNAGAGGAAAGNCNTTGGCTCTGGATTGTNATATTCTGACTNGNGNTCTGCCAGTTTTTCTGGTTANACTCTTCTGCTGCTCTGGAAAGAAANAGCCATTGGATGCAGAACACAAAAAGACTGNTGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGNATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTNGTGGGATATGCAGTGTAACATGAAGAACTANCTCTNCTCNTT
  3   1   2       bld Emb4      in                    IMAGE:4203280.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGGGCTAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAAAAAAAAAAAAAAA
  3   1   2       bld Ga15      in                       XL459l23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAATGATGGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTNCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATCCAAT
  3   1   2       bld Emb4      in                    IMAGE:4203183.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGATGGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGGAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAAAAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202320.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGGGCCTAAAAAAGGCAGCTGATGGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTGGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGCAGGAGGAGGAAGAAGAAGAAAAAGACAATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTGTTTNNTCAGTAACATC
  5   1   2       bld DMZ       in                         xl319o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGAGCTTCTGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTCTGACTGTGGCTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTaaaagaggagcaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagaTGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGAtgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggagATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCCGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTC
  3   1   2       bld DMZ  5g3  in                         xl313a08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTNTGGATTGTTTATATTNTGNCTGTGGCTTTGCCNGTTTTTCTGGTTATACTNTTTTGNTGCTNTGGAAAGAAACNGCCCTTGGNTGCNGNACNCAAAAAGNCTGNTGCTCCCCNGCCTGATGTNAAAGNGGNGCCGGNGGNGGAAGAAGAAGAAAAAGNCCATNAGGCTGAAGNGGAAGAAGATGCTGAAGAAAGTGACCCGCNAAAACCNAAGCCGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGNGGAAGNGGNGGCNGAAGNGGNGATCNAACCTNAAGNAGGCGNCCTTNTGNACNGNTNTCCNAGNAATNGNAAACCTNGNAAAGNTTNAGNAAACNAATNTTTTCCNAATCCCCCNATGGNCTTGAACNTTTGGCNGAAGTTNATNTNAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTGTTGTTTGT
  3   1   2       bld DMZ  5g3  in                         xl313a12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCGCCTAGTGTAGTGGGACAAATGATAACTGCTGCAGAGGAAAGACCTTGGCTCTGGATTGTTTATATTNTGACTGTGGCTTTGCCNGTTTTTCTGGTTATACTNTTTTGNTGCTNTGGAAAGAAACNGCCCTTGGNTGCNGNACNCAAAAAGNCTGNTGCTCCCCNGCCTGATGTNAAAGNGGNGCCGGNGGNGGAAGAAGAAGAAAAAGNCCATNAGGCTGAAGNGGAAGAAGATGCTGAAGAAAGTGACCCGCNAAAACCNAAGCNGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGAGGAAGNGGNGGCNGAAGNGGNGATCNAACCTAAAGNAGGCGNCCTTNTGNACNGNTNTCCNAGNAATNGNAAACCTNGNAAAGNTTNAGNAAACNAATNTTTTCCNAATCCCCCNATGGNCTTGAACNTTTGGCNGAAGTTNATNTNAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTGTTGTNT
  5   1   2       bld Ga15      in                       XL408i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTCTGCCAGTTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAgaggaggaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagaTGCTGAAGAAAGTGACACGCAAAAACCAAAGCAGGatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggagATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATTaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgtttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCNGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTAtttttttttttAAA
  5   1   2       bld Ga18      in                       xlk68h16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTCTGGTTATACTCTTCTGCTGCTCTGGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAgcaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGNGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgttttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGNANTGTNTTNATCCTAGAAAANAAAATCAGNNGAGAGNTTTAGGAAATGTTAGNNCTAAAATGCATTTNNtttttttttttNAA
  3   1   2       bld Ga15      in                       XL439l14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TNTGGNANGAAACNGCCNTTGGNTGCAGNACCCAAAAAGGGTGATGCTCCCCAGCCTGATGTAAAAGNGGNGGNGGAGGNGGAAGAAGAAGAAAAAGGCNATAAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACCCGCAAAAACCNAAGCNGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGAGGAAGAGGNGGCNGAAGAGGAGATCNAACCTAAAGNAGNCGNCNTTATGAACNGATNTCCAAGAAATNGAAAACCTNGNAAAGNTTAAGNAAACNAATATNTTCCNAATCCCCCNATGGACTTGAACNTTTGGCNGNAGTTAATATAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCT
  3   1   2       bld DMZ       in                         xl339b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAAGAAACNGCCNTTGGATGCNGNACNCAAAAAGNCTGATGCTCCCCNGCCTGATGTNAAAGNGGAGCCGGNGGNGGAAGAAGAAGAAAAAGNCCATNAGGCTGAAGNGGAAGAAGATGCTGAAGAAAGTGNCCCGCNAAAACCNAAGCCGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGAGGAAGNGGNGGCNGAAGNGGNGATCNAACCTNAAGNAGGCGNCCTTNTGNACNGATTTCCNAGAAATNGAAAACCTNGNAAAGNTTNAGNAAACNAATNTTTTNCAAATCCCCCNATGGNCTTGNACNTTTGGCNGAAGTTNATNTAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACCTAACTCTACTC
  3   1   2       bld DMZ       in                         xl232o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGGAAAGAAACNGCCCTTGGATGCNGAACNCAAAAAGNCTGNTGCTCCCCNGCCTGATGTAAAAGAGGAGCCGGNGGNGGAAGAAGAAGAAAAAGNCCATNAGGCTGAAGNGGAAGAAGATGCTGAAGAAAGTGACCCGCNAAAACCNAAGCCGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGAGGAAGNGGNGGCNGAAGNGGNGATCNAACCTAAAGNAGGCGNCNTTNTGNACNGATNTCCNAGAAATNGNAAACCTNGNAAAGNTTNAGNAAACNAATNTTTTCCNAATCCCCCNATGGNCTTGAACNTTTGGCNGAAGTTNATNTAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTGTTTGTT
  5   1   2       bld Egg1                               PBX0132B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAAAGAAACAGCCATTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGaggagcaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTT
  3   1   2       bld DMZ       in                         xl319o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGAAAGCCNTTGGATGCAGAACNCAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGNGCCGGNGGNGGAAGAAGAAGAAAAAGGCCATNAGGCTGAAGNGGAAGAAGATGCTGAAGAAAGTGACNCGCNAAAACCNAAGCCGGATGAAGATGAAGGTGATGAAGGGCNAGAAAGCCNAGAGGAAGNGGNGGCNGAAGNGGNGATCNAACCTAAAGNAGGCGNCNTTNTGNACNGATNTCCNAGAAATNGNAAACCTNGNAAAGNTTAAGNAAACNAATNTNTTCCAAATCCCCCNATGGNCTTGAACNTTTGGCNGAAGTTNATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATNNAAACTTTTTAAATCTGAAGAAAGAAATCTAGTATTGCCAAACTCTNCCATACTTCAGTGTAATGAAA
  3   1   2       bld Ga12 5g3  in                         XL218g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCNTTGGATGCAGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAGAGGAGGAGGAGGAGGAAGAAGAAGAAAAAGGCAATnAGGCTGAAGAGGAAGAAGATGCTGAAGAAAGTGACnCGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGNCGNCATTATGAACAGATNTCCAAGAAATNGAAAACCTNGAAAAGATTAAGAAAACAAATATATTCCAAATCCNCCAATGGACTTGAACATTTGGCAGAAGTTAATATTAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGA
  5   1   2       bld Ga18      in                      xlk122m24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAACACAAAAAGACTGATGCTCCCCAGCCTGATGTAAAAgaggaggaggaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagtgacacgcaaaaaccaaagcaggatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggagATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATTaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTNACTCTACTCtttttgtttgnttttgtttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCNTNCATACTTCAGTGTAATGNAAT
  5   1   2       bld Neu7      in                         XL019n05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCTCCCCAGCCTGATGTAAAAGNGGAGCAGgaggaggaagaagaagaaaaagacaataaggctgaagaggaagaagatgctgaagaaagTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGAGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATNTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTC
  3   1   2       bld Ga18 5g3  in                      xlk130d22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGAAAAAGACANNGGCTNANGAGGAAGNAGNTGCTGANGAAAGTGACACGCAAAAACCAAAGCAGGATGAAGATGAAGGTGATGAAGGGCAAGAAAGCCAAGNNGNAGAGGAGGCAGAAGAGGAGATCAANCCTAAAGAAGACGACNTTATGAACAGNTCTCCAAGAANTCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCNCCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTNTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTNNNNNCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAA
  3   1   2       bld Ga18      in                       xlk68h16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANNCTGAAGAGGNNNANNNTGCNNAAGAAAGTGACNNGCAAANCNAAAGCAGGATGAAGNTGANGGTGATGANGGNNNNNAANCCAAGAGGNAGAGNAGGCAGAAGAGGAGNTCAANCCTAAAGNAGNNGNCATTATGANNAGNTCTCCAAGAAATCGAAANCCTCGAAAAGATTAAGAAAACAAATATATTCCAANTCCACCAATGGACTNGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATNCCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTNNNNCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAA
  5   1   2       add Ga18                              xlk128f23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATactgaagaaagtggaaagcaaaaaccaaagcaggatgaagaagaagggaaagaaagccaagatgaagaagaggcagaagaggaggcaaaagaGGAGATCAAACCTAAGGAGGATGAAATTATAAACAGATCTCCAAGAAATCGAAAACTTCGAAGAGATTAAGAAAGCAAATATATTAAAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaGCTTTGTTTTTACAGAGATAAAAGAAAACTATCCAGGAACGTTGCAACACTGAAGCCACAAGACATTGTCACCCACAAGTCGCAGCAGAGAACTTGCGTCATTAAACTATGTGTCTAGATTTATAAAACCCAAAAGCATCATTCCTATAATCTAAATGCATTTAACACTAGTTGACTTTTTGGNGGGATGTGCAGTGTAACATGAAGAACTAACTGTACTGTTCAtttttttttGGNATTTCTT
  3   1   2       bld Ga18 5g3  in                      xlk131h10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNTGCTNANGAAAAGTNNCNNGNAAANNNAAGCNGGATGAAGATGAAGGTGATGAAGGGNAAGAANCCNAGAGGAAGAGGAGGCAGAAGAGGAGNTCANCCNAAAGAAGACGACATTNATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAANTCCACCAATGGACTTGAACNTTTGGCAGAAGTTAATATAAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTNNNNCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAA
  5   1   2       bld Egg1                               PBX0017B09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTGACACGCAAAAACCAAAGCaggatgaagatgaaggtgatgaagggcaagaaagccaagaggaagaggaggcagaagaggagATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTT
  5   1   2       bld Neu7      in                         XL043p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCACGAGGTGAAGATGAAGGTGATGAAGGGCAAGNAAAGCCAAGNGGAAGAGGAGGCAGAAGAGGAGATCAAACCTAAAGAAGACGACATTATGAACAGATCTCCAAGAAATCGAAAACCTCGAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATaaaaaaaaaaaGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGNGGGATATGCAGNGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgttttttttttAAATTAAAACTTTTTAAACTGAANA
  3   1   2       bld Neu7      in                         XL019n05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATNAAGGGCAAGAAAGCCAANAGGAANAGGAGGCAGAANAGGAGATCAAACCTAAAGAAGNCGACATTATGAACAGATNTCCAAGAAATCGAAAACCTNGAAAAGATTAAGAAAACAAATATATTCCAAATCCNCCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAA
  3   1   2       bld Neu7 5g3  in                         XL003n10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGGGCAANAAAGCCAANAGGAANAGGAGGCANAANAGGAGATCNAACCTAAANAAGNCGNCATTATGAACAGATNTCCAANAAATNGAAAACCTNGAAAAGATTNAGAAAACNAATATATTNCAAATCCNCCAATGGACTTGAACATTTGGCANAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAA
  3   1   2       bld Neu7                                 XL026l18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATGAACAGATTTCCAANAAATNGAAAACCTNGAAAAGATTAAGAAAACAAATATNTTNCAAATCCNCCAATGGACTTGAACATTTGGCANAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAAC
  3   1   2       bld Neu7      in                         XL017i16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNACAGATNTCCAANAAATNGAAAACCTNGAAAAGATTAAGAAAACNAATATATTNCNAATCCNCCAATGGACTTGAACATTTGGCANAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATGCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATT
  3   1   2       bld Tbd7      in                         XL085m13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAACAGATTTCCAANAAATNGAAAACCTNGAAAAGATTAAGAAAACNAATATATTNCAAATCCNCCAATGGACTTGAACATTTGGCANAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAANCNTNTTCAACTGAAGAAAGCAATGCTAGTATTGCCAAACTCTTCCATACNTCAGTGNA
  3   1   2       bld Ga12      in                         XL173n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACAGATTTCCAANAAATNGAAAACCTNGAAAAGATTAANAAAACNAATATATTNCNAATCCNCCAATGGACTTGAACATTTGGCANAAGTTAANATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACNAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTA
  3   1   2       bld Ga18 5g3  in                      xlk164m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAAATCNNAAACCTCGAAANGNTNNNNAAAANAANNANNTNNNNAATCCNCCAATGGACTNGAACATNNGGCAGAAGTNAANATAAAAAAAAAAAAGCTTTCTGTTTTNACAGAGANAAATAACTATCCAGGAACATTGTAACNCTGAANTNCCTTNTCACCCACAAGTCGCAGCCGAGNNCTCGCATCATTATNNCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGNCTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAANCTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTNNNNNCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGNAA
  3   1   2       bld Ga18      in                      xlk164l13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATCGAAACNTCNAAAAGATTANNNAAACAAATNNNTNCAAATCCACNAATGGNCTNGAACATTTNGCAGAAGNNNNATNAAAAAAAAAAAAGCTTTCNGTTTTTANAGAGATAAATAACTATCCAGGAACATTGNAACACTGAAGNCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGNCTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAANCTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTNNNNNCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAA
  3   1   2       bld Neu7 5g3  in                         XL046p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TNGAAAACCTTGAAAAGATTNANAAAACAAATATNTTNCAAATCCNCCAATGGACTTNAACATTTGGCANAAGTTNANATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTTAC
  3   1   2       bld Emb3                            IMAGE:3398779.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAAGATTAAGAAAACAAATATATTCCAAATCCACCAATGGACTTGAACATTTGGCAGAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAG
  3   1   2       bld Tbd7      in                         XL071c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATTTGGCANAAGTTAATATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATNCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTAT
  5   1   2       bld Neu7      in                         XL022b10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTTAATATaaaaaaaaaaGCCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGNGGGATATGCAGNGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgttttttttttNAAATTAAAACTTTTTAAACNGAANAAAGAAA
  3   1   2       bld Ga15      in                       XL466i08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAAAAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACNCTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTCCCAC
  3   1   2       bld Neu1      in                      Neu1-29E8-1.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAAAGCTTTCTGTTTTTACAGAGATAAATAACTATCCAGGAACATTGTAACACTGAAGTCCTTGTCACCCACAAGCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAACATCATTTCTAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGG
  3   1   2       bld DMZ  5g3  in                         xl254j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAGGAACNNTNGTAACACTGAAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATATCTGGGNTCCACAGTCAGTCCCTGTNTA
  3   1   2       bld Ga15      out                      XL491k09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGTAACNCTGAAGTCCTTGTCNCCCCCAAGTNGCAGCCGNGAACTCGCATCNTTATNTCCCGNATTTAGATTTGTAAACCCNAGTAANGAAAAAGCNTCNTTTNTATAATTTAAANGCNTTTAACCCTAGTCGNCTTTTTGGGGGGANATGCNGGGNAACNNGNAGNACTAACTNTACTCTTTTTGNTTGNTTTNGNTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATNTAGTATTGCCAAACTNTTCCATACTTCAGNGTAANGAAATGTATTAATCCTAGAAAATAAAATCAGAAGNGAGCTTTAGGAAANGTTAGATNTAAAANGCATTTATTTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGAACTGTCCCACT
  5   1   2       bld Ga15      in                       XL501k07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgtttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL501k07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCCATACTTCAGTGTAATGAAATGTAT
  3   1   2       bld Ga15                               XL502k07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGTCCTTGTCACCCACAAGTCGCAGCCGAGAACTCGCATCATTATACCACGTATNTAGATTNGTAAACCCAAGTAATGAAAAAGCATCATTTNTATAATNTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACANGAAGAANTNACTNTNCTCTTTTTGNTTGTTCTTNGTTTTTTTTTAAATTA
  3   1   2       bld Ga15      in                       XL505h18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCACAAGTNGCAGCCGAGAACTCGCATCATTATACCACGTNTNNAGATTTGTAAACCCAAGTAANGAAAAAGCNTCATTTNTATAATNTAAANGCATTTAACACTAGTNGACTTNTTGGNGGGATATGCAGNGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATNTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGNGAGCTTTAGGAAATGTTAGATNTAAAANGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTNCCNCAGTCAGTCCCCGTTTATTTTTCT
  3   1   2       bld DMZ  5g3  in                         xl254d21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGCAGCCGAGAACTCGCATCATTATACCACGTATCTAGATTTGTAAACCCAAGTAATGAAAAAGCATCATTTCTNTAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATACGCAGTGTAACATGAAGAACTAACTCNACTCNTTNGGTTNGCTNTTGNTTTTNTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGNGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTNTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTNTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTNGCTTNGCGTGCATACNGGGNTCCACAGTCAGTCCCTGTNTA
  5   1   2       bld Emb4                            IMAGE:5572333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ggacgcgtgggcggacgcgtgggcggacgcgtgggAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgttttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTaaaaaaaaaaaaaaaG
  3   1   2       bld Ga12      in                         XL209l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAACCCAAGTAATGAAAAAGCATCATTTCTATAATNTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATNTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTTCCCACATCTTTATTAAAGCAACT
  5   1   2       bld Emb4                            IMAGE:4724863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGATGAAAAAGCATCATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgtttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAACAAGCATTTAttttttttttAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCAttttgctgtttttttgtttgttttACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTaaaaaaaaaaaaaaaG
  5   1   2       bld Neu7      in                         XL009e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGGNAATTCGGCACGAGGATTTCTATAATCTAAATGCATTTAACACTAGTCGACTTCTTGGTGGGATATGCAGTGTAACATGAAGAACTAACTCTACTCtttttgtttgtttttgtttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCAAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTAttttttttttAAATTTGTTTAATGGCTGCTTGGTTTGGNGTTCATTCCTTCCAGTTTAAAGTAACCCAttttgctgtttttttgtttgttttACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCT
  5  -1   2       bld Bla2                            IMAGE:7296161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTGGGCTTTTTTGGTGGGGGTTTCCCGGTTAACCaaagaaaaaaacccacacccttttggtggggttgggattttttttaaaaataaaaactttttaaaatggagaaagaaatttttgttttgccaaaatTTTTCCCATATTTCAGTGGAAAGAAAAGTATTTATTCCTAGAAAAATAAATTCAGAGGGAGGTTTTAGGAAATGTTAGATTTAAAAAGCCATTTAttttttttttAAATTGTTTTAATGGCTGCTTGGGTTGGTGTTCATTCCTTCCAGTTTAAGTAACCCAttttgctgtttttttgtntgttttaCACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGAAGAATTTaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCGATCTAA
  3   1   2       bld DMZ       in                         xl266a15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTTGGTGGGATATGCAGNGTAACNTGAAGAACTAACTCTACTCNTTTTGTTTGnTTTTGnTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGNGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACGAAGCT
  3   1   2       bld Tbd7      in                         XL058e03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATGCAGTGTAACATGAAGAACTAACTCTACTCTTTTTGTTTGTTTTTGTTTTTTTTTAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATNTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTT
  3   1   2       chi DMZ       out                        xl305l01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAATTTAAAGTGATTTGTTGNGGTTTTCCCAAAAGGTAAAAAACACTACCGCCTGTACTTTATCTNTGCTAGTGTTACAGTTACAGATGGGAAGATTCCAACCGCACCGCTTACTTTTCTTTCACTCGNCACACTTTCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACNGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGTTTTTTTTTCTTTTCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCNTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCNGCAGTAGGGTCTAAGCAAGAGTG
  5   1   2       bld Ga15                               XL520h22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                tttttttttAAATTAAAACTTTTTAAACTGAAGAAAGAAATCTAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTAttttttttttAAATTTGTTTAANGGCTGCTNGGTTNGGGGTTCATTCCTTCCAGTTTAAAGTAACCCattttgctgtttttttgttngttttACNCGAGTATTTACAANACATGCTTTTGGTTCTANAGAGCATGGNCAGTAGNCCNGGCAACATGCATGTTATCCCNGGTTACCGTTAAGCCGCCAGCACTTGAAGNCTTTATGGACCAAAANGCTATAATCGCCCAGTAAACAGATGTCNCGGATACCTCTAAATTACGNGGGNGCNCCCAAGGGTAAATATATTCATATANAACATTTGCTTTGNGNGCATACNGGGTTCCACAGNCAGNCCCNgtttatttttcnctatgtttttttgtttngtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCNGTTTaaaaaaaaaa
  3   1   2       bld Neu7      in                         XL009e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAGTATTGCCAAACTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCAAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTAC
  5  -1   2       bld Bla2                            IMAGE:7299687.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAACTTCTTCCATACTTCAGTGTAATGAAATGTATTAATCCTAGAAAATAAAATCAGAAGAGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTAttttttttttttAAATTTGTTTAAGGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCAttttgctgtttttttgtttgttttACACGAGTATTTACAAGACATGTTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTTTTTATGGACCAAAATGCTATAATCGCCCAGTAAACGGATGTTTGGGATACCTTTAAATTAGGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGtttatttttctctagggttttttgttttgtttttaCGGAAGCTGTAACTGTTCCCACATTTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttttttttGGGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCACATTTCACAGATTATACAGTTTTTGCATGGACCTTTTTCATATAGGACAAACACTTTACCTGCAGTAGGGTTTAAGCAAGAGTGTAtttttgatttttttttCAGAAAAAGGGTTATGTATGTCAACATTTTGTTGAAGGGAAAATACACCCCCTTTAATGACATAAATATCTTTCATTTTTGCATTACAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTAAAATaaaaaaaaaaaaaaaaaaaaaaaaaggcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGGACCCAATCGCCCATGATTGGGN
  3   1   2       bld Ga15      in                       XL408i12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAATGAAAGGTATTAATCCTAGNAAATAAAATCAGNAGAGAGCNTTAGGAAANGTTAGATNTAAAAAGCATTTATTTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTnGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4203368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGCTTTAGGAAATGTTAGATCTAAAATGCATTTATTTTTTTTTTAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCATTTTGCTGTTTTTTGTTTGTTTTACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTA
  5   1   2       bld Tbd7      in                         XL057c21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AATGTTAGNATCTAAAATGCATTTAtttttttttAAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCAttttgctgtttttttgtttgttttACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTG
  5   1   2       bld Neu7                                 XL037p05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTTAtttttttttAAAATTTGTTTAATGGCTGCTTGGTTTGGTGTTCATTCCTTCCAGTTTAAAGTAACCCAttttgctgtttttttgtttgttttACACGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGA
  5   1   2       bld Ga15                               XL448d06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGTATTTACAAGACATGCTTTTGGTTCTAGAGAGCATGGTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCctgtttatttttctctgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCANAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCANACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaCA
  5   1   2       bld Ga15      in                       XL507b07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCAGTAGTCCTGGCAACATGCATGCTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL507b01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL507b01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTT
  3   1   2       bld Ga15      in                       XL507b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTAGTCCTGGCAACATGCATGTTATCCCTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTT
  3   1   2       bld Ga15                               XL508b07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAGTAGTCCTGGCAACATGCATGTTATCCNTGGTTACCGTTAAGCCGCCAGCACTTGAAGTCTTTATGGACCAAAATGCTATAATCGCCCAGTAAACATGATGTCTCGGATACCTCGTAAACTTATCGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATANNGGGTTCCACCAGTCAGTCCCTGTTTATTNTTCTCTANGTTTTTTTGTTTTGTTNTTACTGAA
  5   1   2       bld Sp1       in                    IMAGE:4965424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GACCCACGCGTCCGCCAAAATGCTATAATCGCCCAGTAAACAGATGTCTCGGATACCTCTAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaaCAGTTTAAACTTTTGATTGCAAAGCTTTTGTTG
  3   1   2       bld Ga12      in                         XL171f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAATTACGTGTGTGCTCCCAAGTGTAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCTGTTTATTTTTCTCTATGTTTTTTTGTTTTGTTTTTACTGAAGCTGTAACTGTTCCCACATCATTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGTTTTTTTTTCTTTTCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCC
  5   1   2       bld Egg5      in                    IMAGE:3431600.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAAGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTA
  5   1   2       bld Ga15      in                       XL401b21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAATATATTCATATAGAACATTTGCTTTGTGTGCATACTGGGTTCCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGNGTACTTCTGACTTCTCTTTCAGAAATAGGGTNATGTATGNCCACCATTTNGTNG
  5   1   2       chi Tbd7      in                         XL091l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACAGTCAGTCCCtgtttatttttctctatgtttttttgttttgtttttACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTC
  5   1   2       bld Emb4      in                    IMAGE:5440011.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCACGCGTCCGCGGACGCGTGGGTTTTTACTGAAGCTGTAACTGTTCCCACATCTTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATTACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaaCAGTTTAAATTTTTAATTGCAAAGCTTTTATTAAGAAATTACTTACCGATTCTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAATCGTGCACCGTGCCATGGATCGTCACCGTTTCAAAAAATGAGTGCATGCGGACAGTTGGTACAAGGTTTCTTATTAATAT
  5   1   2       bld Tbd7                                 XL094c07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCCATCTTTATTTAAAGCAACTTTGCTGTTTAATCGTGTTAGtttttttttcttttCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaa
  3   1   2       bld Egg5      in                    IMAGE:3431600.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTATTTAAAGCAACTTTGCTGTTTAATCAGTGTTAGTTTTTTTTTCTTTTCTGCGATTGCTTACTGGGAGAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGCACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTACATTCTTTTTGTTAATAAA
  5   1   2       bld Tbd7      in                         XL064k24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GNCTTTTCTGCGATTGCTTACTGGGAGNAATTGGATACTGGCATGAATGGCTGCCTACTCTGTCCATTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaa
  5   1   2       bld Tbd7      in                         XL097e12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGGNAATTCGGCACGAGGGGATACTGGCATGAATGGCTGCCTACTCTGTCCTTTCACAGATTATACAGTTCTTGCATGGACCTCTCTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaa
  5   1   2       bld Em10                            IMAGE:7983080.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCATATAGGACAAACACTTTACCTGCAGTAGGGTCTAAGCAAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaaCAGTTTAAACTTTTAATTGCAAAGCTTTTATTGAGAGGTTACTTACCGATTCTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAGTCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCGGAGGGTTGGTACATAGTTTCTTAATAAAAGCTTTGCAAATTAAAAGTTTAAACTGTGCTGGTGttttttgttttttgttaaaatgaaactaatttaaaaaaaaaaTTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGACCTTTCTTTCTCACAGTTGAACATGGTGAGG
  5   1   2       bld Em10                            IMAGE:8317551.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGTGTACTTCTGACTTCTCTTTCAGAAATAGGGTTATGTATGTCAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaaCAGTTTAAACTTTTAATTGCAAAGCTTTTATTAAGAGGTTACTTACCGATACTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAGTCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCAAAGAGTTGGGACATAATTTCTTTATGGGGGCTTTGCAAATTAAAGTTTTAACTGGGCGGGGGGTTTGTTTCTTGGTAAATGAAACTTATTTaaaaaaaaaTTTCTGGTTACGGGCCCTTTAACAAAGTTTCCCCACCCTCCCCTTGTTCCTTTGGAAAGGAAGGACCCGGGACCCTAATTCCCTCCTTTTAAAAGAATTTTTcccccccccTCCCAGGGAAAAGGGGGAAATCTTTTTTCTCATTTGAATATGGGGAGGTGGTGTTTCTATCTTC
  5   1   2       bld Tbd7      in                         XL102i23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGTTATGTNTGTGAACATTTTGTTGAATGGAAAATACACCCCCTTAATGACATAAATATCTTTCAGACATACCCGTTTCCACAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaCAGTTTAAACTTTTAATTGCAGAGCTTTTATTGAGAGGTTACTTACCGATTCTNTGCATGNGCTCCTCTTTTGGAACGGNGACAGGTTGACGATCCATCGNGCATCGCTTGATTTCTCGTCCCTGCCTTNTATAGGAGATAGCCAGGGAGGAGAGGTCGTGCNCCGTGCGATGGATCGTCACCGTTTCANAAGAGGAGTGCATGCGGAGGGTTGGTNCATGGTTTNTTGGTAAAGGCTTTGCAAATTAAAAGTTTAAACT
  5   1   2       bld Em10                            IMAGE:8319605.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCGTTTCCCAGATGAAAAGGAAACCATGACAGTCTGCCTGTGCTGTAGTGAGCAGCGCCCCACTTTAGTCTTAAAGGACCAGTAACAGTAATTTCTTTTTGTTAATaaaaaaaaaaaaCAGTTTAAACTTTTAATTGCAAAGCTTTTGTTGAGAGATTACTTACCGATTCTCTGCATGTGCTCCTCTTTTGGAACGGCGACAGGTTGACGATCCATCGTGCATCGCTTGATTTCTCGTCCCTGCCTTCTATAGGAGATAGCCAGGGAGGAGAAATCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCGGAGAGTTGGTGCATAGTTTCTTGGTAAAAGCTTTGCAAATTAAAAGTTTAAACTGTGCTGGTGttttttgttttttgttaaaatgaaactaatttaaaaaaaaaaTTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTNAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAAACATGATTTCTGTGGAATCAGATATGTCTTTGTAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCAACTGAG
  3   1   2       bld Emb4      in                    IMAGE:5440011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGGAACGGGACAGGTTGACGATCCATCGTGCATCGCTTGATTCTTCGTACCTCCTCTCTATAGGAGATAGCCAGTGAGGAGAATTCGTGCACCGTGCGATGGATCGTCACCGTTTCAGAAGAGGAGTGCATGCGGAGAGTTGGTACATGGTTTCTTATAAATAAGCTTTGCAAATTAAAAGTTTAAACTGTGCTGGTGTTTTGTTTTTTTGTTAAAATGAAACTAATTTAAAAAAAAAATTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCCCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAATGGATATTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATAAAGCANNCGTCGATT
  5   1   2       bld Tbd7      in                         XL090c24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAAAGTTTAAACTGTGCTGGTGTTTTTTGTTAAAATGAAACTAATTTaaaaaaaaaaTTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCA
  5   1   2       bld Tbd7      in                         XL053n09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAAGTTTAAACTGTGCTGGTGTTTTTTGTTAAAATGAAACTAATTTaaaaaaaaaaTTACTGTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAA
  5   1   2       bld Emb4                            IMAGE:4970169.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTaaaaaaaaaaTTACTTTTACTGGTCCTTTAGCAAAGTGTCTCCAACCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCATTATTTCATTGAGACTGCTTCACGATCTCTTGTAATAGAACATTTCCAGGTACACTCTGCTAGTTTAGATAGTATGACTGTACTCATGACTGCTAGTTGTATCGGTGCCTAGTggggggggAACTTN
  5   1   2       bld Egg3                            IMAGE:6325253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCCCCGGGGTGTCTCCACCCATCCCTTGTTCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAGTggggggggggggggggggAAACCTTTTTGACCCCAGACATTGAGAATGGAGAATGACTATTCAANTTCAGGGGTTGGTTTAAGTGCTTGACGCAAACCTCGTGTTGGCATTTTCAGATTTTTAGCAGCCC
  5   1   2       add Egg1                               PBX0060C12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCATCCCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCCCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAAC
  5   1   2       bld DMZ       in                         xl307c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCT
  5   1   2       bld DMZ       in                         xl310f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTGTTCCATTGTGAAGTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCA
  5   1   2       bld Egg1                               PBX0157B12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGATGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCCCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAA
  5   1   2       bld Egg1                               PBX0056F07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATCCTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTG
  5   1   2       bld Egg1                               PBX0056F10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGGACCTGAAGTCCCTCTGCTTTCCAGAGGATCTATGCACCACCCACTCACAATGGAAAGCAGGGGAACCTTCATTTCCCACAGTTGGAACATGGTGAGAGAGGGGTTGCATTAAACTGTCTGACTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACT
  5   1   2       bld DMZ       in                         xl259c14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTCACAATGGAAAGCAGGGGAACCTTCATTTCTCACAGTTGGAACATGGTGAGGGAGGGGTTGCATTAAACTGTCTGACTAAGGGATGTTGGGAAATGGTTAGTATGAATAACATGAATTTCTGTGGAATCAGATATGTCTTTGTAAAAAAATGGTAGTTATGCACCTTTTTCTATATAAACCCAACTGAGTGAGCTCATGTTAAAAAGTATAGCAGGAATTATAGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggggAAAACCTTTGACCC
  3   1   2       add Tad1                            IMAGE:6878471.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGATAATTATGGAAGGCATAGAAGTTTGCCGAGTTCGGGGCGAAGTTGCTCTGCTTTGCCTGGTGGTTTGTTGGGCGGTCCTATGCTTTGTGCCTTCGCCGCCTGCGCAATGCAACCGGTACGTCGTCTTCTTGCTCCGCATCTTCGGTTGTCGCTTATGGGGTTTCCCTGCTTAATTTGTCCGGATGCGACGTGTCGGGTTACCCTGGTTGTCTTCCCTTTTTTCGTCGTGTCATGAGCCGCCGAGTTTCTAATATGGCCGCGTGTCCGTTTTCACTTTATTGAGTTAAATGGCCACTTGCCTTCCAAAACGCTGCGGGTGGGCGGGTATGCAACATCTAAGGCATTGTTGAAACCCCTCAATGATACTCGAGGCCCAATTGCTTCCCGCGCGCCCTGATTCTTCGAATCTCTTTAAAATAGATCCGCTTCCCAAGGTACCACCTCATGATATGTTTTAGATTATGTACTGACTGGTAGCTGCAGGGACTGGCTTAAGGTGGTTATCAGTGTGCAGTAATGTTGGGGGGGGGGGAACCCTTTGACCCCTGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTCCTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCCTAACAATGCTTTTAAATTCCCTTAAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTTCCGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAATATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTTGAAAAGC
  5   1   2       bld Tbd7      in                         XL082a21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTCATGTTAAAAGTATAGCAGGNAATTATAGCAACGTCTGCTCAGNAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTgggggggggggAAACCTTTGACCCCAG
  5   1   2       bld Neu7      in                         XL006i22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCAACGTCTGCTCAGAAATACAGCTATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACCTAAAGTTggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGAC
  5   1   2       bld Ga15      in                       XL405l07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATAATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggAAACCTTTGACCCCANACATGAGATGGANATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACNCAAACTCGTGTTGCATTCAAATTTANCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCNTCNCTGCTGNAAATCANTTNCCCTTACAAACAAAATGTTGCTGCTTTGGGGG
  5   1   2       bld Ga12                                 XL198a18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTATTATTACGTGTTACATATGAAGGGGGGTTTCCATTAAAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggg
  5   1   2       bld Neu7                                 XL025j07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAGGCAACTGTACAATGAAATGCCAACACAGGTACGTGACAGCCAGNGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATT
  5   1   2       bld Emb4                   IMAGE:4682555-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAAATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAATAATGCTTTTAAATTCCTTTaaaaaaaaaaaaCAT
  5   1   2       bld Emb4                            IMAGE:4682555.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AACACAGGTACGTGACAGCCAGTGCCTACGAGTCTACAATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTgggggggggggggggggAAACCTTTGACCCCANACATGANATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCCTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAATAATGCTTTTAAATTCCTTTaaaaaaaaaaaaCATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGGGGCTCTATGGGGCTTTGCCCATCCAAATGCCTCTACTGCAGGAGGGAAAACTCTTAACCTTGCCTCACCCACCAGGGAAAAATGCTGCAACAAGTGTTTCCATGGCACCAAATTGGGATGCAAAAAACGATGGAAATTTTATTCGCCTGGAAGGCCTTTTCCACCCCTCTGAGAAGGGGGGAAAAACCTTTTCCCGTTGGCCCCCGGGGCGGCGGCAAAAAACACCTATAATTGGGTGCGAGCACGGTAATCGGCCCGaaaacaccctgaaaaattttttaaaaaagacacaaaacaaaagaggcgcccccccatccaaagaaaattccccccatggggccccc
  5   1   2       bld Neu7                                 XL026j07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTTATGGTGCTGTTAGGGGTATTGTCCGCTCGTCTTGCTGAGAAACCAATGAGATTAAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGNNAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTNTTAGAATATGTATTGACTTGNAGCTACAGTGA
  5   1   2       bld Neu7                                 XL028f15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGGNAATTCGGCACGAGGGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGNCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggAAACCTTTGACCCCAGACATGANATGGAGAT
  5   1   2       bld Emb1                            IMAGE:6636007.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAATGCCACGTGGCGTTGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCCCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTTCATGGCACAAATTGTGATGAACAAATGATGTGTATTTTATTTGCTGGAAGGCCTTTCCACCTTCTGGAATGTGGAAAAATCTTTTTCCTTTTGCTCTTGGTTGGGGCaaaaaaaaaTTATATTGGTCCGGGGAAAGTTTTCAGTCCAGAAACCCCAAATAAAATTTTTTTaaaaaaaaaaaaaaaaaaaaaGGGGCGGGCCGGCTCCAAAAAGTATTCCCCCCCGAGGGGGGCCCAAAGCTTTAACGCGGTAACCCCCGCTTTTTTCTTGGTAAACAAGAGGGGCCCCCCCTATAAAggggggggCGCGTATTTTATAAAGCTTAAGGGCACCGGGGCCCG
  3   1   2       bld DMZ       in                         xl310f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCATATAATGATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCNTTGAGACCTGCTTNTACTGATCTCTTTGTAAANAGAACCNTTTCCCAAGGTACCNCCTCCTGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGNGACTGGCTTAAGTTGGTTATCTGNGTGCNCTAAAGTTGGGGGGGGGGAAACCTTTGACCCCAGACNTGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATAT
  3   1   2       bld Tbd7      in                         XL097e12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTAAAGGCAACTTGCTGTCAAAATGCTTTTGCTGGTTGGTATTGTATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTNTACTGATCTCTTTGTAAATANAACCATTTCCCAAGGTACCNCCTCATGCTATGTTTTANAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAA
  5   1   2       bld Ga18      in                       xlk62n22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTTGTATTGCATTGGTAAAACCGTCAATGCTACTTGAGTTCCAATTATTTCCATTGAGACCTGCTTCTACTGATCTCTTTGTAAATAGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTgggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGNGCTTTNNCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGNAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGNCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCaaaaaaaaaaTTATATTGTTCGTGTAGGTTTCAGTCAG
  3   1   2       bld Sp1       in                    IMAGE:4965424.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGATCTCTTTGTAAATAGAACCATTCCCAAGGTACCCCCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAATAAAATTTTTAAGC
  3   1   2       bld Ga15      in                       XL498h07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTNTTTAGGNGNCCCTATAGAANACAAGNTACTTGTTTTTTTTGCNGGATCCCNTCGATTNGAATTNGTCGNCCCCCGNGTCCGCTTAAGTTGGTTATNTGNGNGCNCTAAAGTNGGGGGGGGGGAAACCTTTGACCCCNGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGNGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTC
  3   1   2       bld Neu7      in                         XL006i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAACCATTTCCCAAGGTACCACCTCATGCTATGTTTTANAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAA
  5   1   2       bld Ga15      in                       XL518f21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACCTCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggAAACCTTTGACCCCAGACATGANATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTCGTGTTGCATTCANATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCATCNCTGCTGNAAATCAGTTTCCCTTACAAACAAAANGTTGCTGCTTTGGGGGCNCTATGGGGCTTTGCCTATCCAAANGGCTCTACTGCATGAGGAAAACNCTTAAGCTTGNCNCNCCCANCAAGGGAAAAATGCTGCANCAGNGTTNCCATGGCACNAATTGNGATGACAAAATGATGNGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGNAANGNGNAAAANCTTTTTCATTTGCNCTTGTTGGGGCaaaaaaaaTTATATTGTNCGNGTAGGTTNCAGNCAAAACNCAATAAAATTTTTAAGaaaaaaaaaa
  3   1   2       bld Egg6                            IMAGE:4435036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATGCTATGTTTTAGAATATGTATTGACTTGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAAAAAATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATTAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTCG
  3   1   2       bld Ga15      in                       XL518f21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCTCANGGTANGTTTTAGAANANGTATTGACTTGTAGCTNCAGNGNCTGGNTTAAGNTGGTTATCTGNGNGCNCTAAAGTNGGGGGGGGGGAAACCTTTGACCCCNGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATG
  3   1   2       bld Ga18      in                      xlk122m24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCNCATGCNATNTTTTTAGAATATGTATTGNCTNGTAGCTACAGTGACTGGCTTAANTTGGTTATCTGTGTGCNCTAAAGTNGGGGGGGGGGGAANCCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTNNNNNNCGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGNNNNTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGNCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGNCAAAAAAAATTATATTGTTCGTGT
  3   1   2       bld Gas5                            IMAGE:3749413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTACGTTTTCCCACCTTTATTGACTAGTAGCTACAGTGACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGAGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAAAATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCATGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCCAGTCAGAGACACAATAAATTTTTAAGAAAAAA
  3   1   2       bld DMZ       in                         xl259c14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATGTTTTTAGAANATGTATTGACTTGNAGNTNCNGNGACTGGNTTAAGTTGGTTATCTGNGNGCNCTAAAGTTGGGGGGGGGGGAAACCTTTGACCCCNGACNTGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCNTTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATA
  3   1   2       bld Tbd7      in                         XL091l19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACTGGCTTAAGTTGGTTATCTGTGTGCACTAAAGTTGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACA
  5   1   2       add Ga15      in                       XL498h07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTAAGTTGGTTATCTGTGTGCACTAAAGTTggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTCGTGTTGCATTCANATTTANCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCATCNCTGCTGNAAATCAGTTTCCCTTACAAACAAAANGTTGCTGCTTTGGGGGCNCTATGGGGCTTTGCCTATCCAAANGGCTCTACNGCATGAGGAAAACNCTTAAGCTTGTCNCNCCCANCAAGGGAAAAATGCTGCAGCAGNGTTTCCATGGCNCNAATTGNGATGACAAAATGATGNGNATTTTATTTGCNGGCAGGCCTTTCANCCTTCTGNAANGGGNAAAATCTTTTTCATTTGCNCTNGTNGGGGCaaaaaaaaTTATATNGTTCGNGNAGGTTTCAGNCAAAACNCAANAAAATTTTTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl307c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTAANTTGGNTATNTGNGNGCCCNAAANNTGGGGGGGGGGGAAACCTTTGACCCCNGACCTGAGATGGNGATGNCTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCNTTCAGATTTAGCAGCCNTTTNTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAAT
  3   1   2       bld Neu7 5g3  in                         XL003d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCNNTAAAAANGGGGGGGGGGGGAAACCTTTGACCCCANACATNANATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTNGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTT
  5  -1   2       bld Ooc3      out                   IMAGE:3437492.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCACTAAAGTTggggggggggAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaaCATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGTCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCaaaaaaaaTTATATTGTTCGTGTAGGTTTCAGTCAGAACACAATAAAATTTTTAA
  3   1   2       bld Neu7      in                         XL022b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATTNGGGGGGGGGGGAAACCTTTNACCCCANACATNANATGGANATGACTATTCAGTTCAGGGTTGTTTAGTGCTNACGCANACTNGTGTTGCATTCANATTTAGCAGCCATTTTTTCCGATTTTTTGGTTTGCAACCAnAACAAnGCTTTTnAATTCCTTTAAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTACTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAA
  3   1   2       bld Neu7                                 XL036m08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TAAANTTGGGGGGGGGGGAAACCTTTGACCCCANACATGANATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTCGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTNTGGTTTGCAACCANAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGANGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCCTCTGTAATGTGTAAAATACTTTTTCATTTGC
  3   1   2       bld Neu7      in                         XL043d14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTTGGGGGGGGGGGAAACCTTTNACCCCANACATNANATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTCGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTTTGGTTTGCAACCANAACAANGCTTTTNAATTCCTTAAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGNCAGAACACAAT
  3   1   2       bld Tbd7      in                         XL057c21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAANTTGGGGGGGGGGGAAACCTTTGACCCCANACATNAGATGGANATGACTATTCAGTTCAGGGTTGTTTAGTGCTNACGCAGACTNGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAAT
  3   1   2       bld Tbd7      in                         XL053n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANTTGGGGGGGGGGGAAACCTTTGACCCCAGACATGAGATGGAGATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCANACTCGTGTTGCATTCAGATTTAGCAGCCATTTNTTCCGATTTTNTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAATAAAATTTTTAAGAAA
  3   1   2       bld Ga15      in                       XL405l07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AANTTGGGGGGGGGGAAACCTTTGNCCCCAGACATGAGATGGAGANGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTNGTGTTGCATTCAGANTTAGCAGCCATTTCTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTG
  3   1   2       bld Tbd7      in                         XL090c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTNGGGGGGGGGGAAACCTTTNACCCCANACATNANATGGANATGACTATTCAGTTCANGGTTGTTTANTGCTNACGCANACTNGTGTTGCATTCANATTTANCANCCATTTNTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTNCTGTAATGTGTAAAATCTTTTTCATTTGNNCTTGTTGTGGCAAAAAAAATTATATTGT
  5   1   2       add DMZ       in                         xl261h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGACTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaCATCTCTGCTGTANATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGNGCTCTATGGNGCTTTGCCTATCCAAANGGCTCTACNGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAANAATGCTGCAGCAGNGTTTCCATGGCACGAATTGNGATGACAAAATGATGNGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAANGNGTAAAATCTTTTTCATTTGCTCTTGTTGNGGCaaaaaaaaTTATATTGTTCGNGTAGGTTTCAGNCANAACACAATAAAATTTTTAAGaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl261h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATGNCTATTCAGTTCAGGGTTGTTTAGTGCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCNTTTCTTCCGATTTTTTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCGGNAATGTGTAAAATCNNTTTCATTTGC
  3   1   2       bld Ga18      in                       xlk62n22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CNNTTCAGTTNAGGNTTGTTTTANNNNNNNGNAGNCTCGTNNTNGCNTTCAGNTTTAGCAGCNNTTTNCTTCCGATTTTCTGGTTTNGCAACCATAACAATGCTTTTAAATTNCNTTTAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGNNNNNNGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGNCCTTTCAACCTTCTGTAATGTGTAAANTCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAAAATTATATTGTTCGTGTAG
  5   1   2       add Ga15                               XL479d15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTGACGCAGACTCGTGTTGCATTCAGATTTAGCAGCCATTTCTTCCGATTTTCTGGTTTGCAACCATAACAATGCTTTTAAATTCCTTTaaaaaaaaaaaaaTCNCTGCTGTAAATCAGTTTCCCTTACAAACAAAANGTTGCTGCTTTGGGNGCNCTATGGGGCTTTGCCTATCCAAANGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCNCCCANCAAGGGAAAAATGCTGCANCAGNGTTTCCATGGCACGAATTGNGATGACAAAATGATGNGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAANGNGTAAAATCTTTTTCATTTGCTCTTGTTGGGGCaaaaaaaaTTATATTGTTCGNGTAGGTTTCAGTCAAAACNCAATAAAATTTTTAANAAAAAAA
  3   1   2       bld Neu7      in                         XL043p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTTGCATTNANATTTANCAGCCATTTNTTCCGATTTTTTGGTTTGCAACCANAACAANGCTTTTNAATTCCTTTAAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCAAATGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGTGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAATAAAATTTTTAAG
  3   1   2       bld Tbd7      in                         XL064k24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTNTTGCATTCANATTTAACAGCCNTTTTTTCCGATTTTTTGGTTTGCAACCAnAACAAnGCTTTTnAATTCCnTTAAAAAAAAAAAACATCTCTGCTGTAGATCAGTTTCCCTTACAAACAAAATGTTGCTGCTTTGGGTGCTCTATGGTGCTTTGCCTATCCACGGCTCTACTGCATGAGGAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGTCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCACTTGTTGGGCAAAAAAAAATTA
  3   1   2       add Tbd7      in                         XL102i23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGCTCTACTGCATGANNAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGGNANTTCTTTTTCATTTGCTCCCTGNNAANGCAAAAAAAATTATATTG
  3   1   2       bld Tbd7      in                         XL082a21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTCTACTGCATGAGGAAAAACTCTTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTATTTGCTGGCAGGCCTTTCAACCTTCTGTAATGTGTAAAATCTTTTTCATTTGCTCTTGTTGGGCAAAAAAAATTATATTGTTCGTGTAGGTTTCAGTCAGAACACAA
  3   1   2       bld Ga15      in                       XL401b21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTACTGCATGAGGAAAACTCNTAAGCTTGTCTCACCCAGCAAGGGAAGAATGCTGCAGCAGTGTTTCCATGGCACGAATTGTGATGACAAAATGATGTGTATTTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)