Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL420g21ex.5                         62 PI      89         20     1224                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012768225 Xl3.1-IMAGE:6880326.3 - 78 ESTs
                                                                       ..-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6880326.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGTTAAGGCGAGTTGAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTTGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACTGCCAAACATGGTGTATAAATGCATTCCACGCGGACATTTCATTTGCAATAAAGCTTTAATTATATGTAGATGAGACTGTCATCTTCATCCCTTAGTTTTCATGGTGTTTATCATTGCTGTCTGCTCTATGCCTCCCTCCCCCACATCAACTGTATTAAAGGGAGAAATTGGTTTCCATTAAACACCAGAATTTCTCATCGCTTGCTTTATATATTGGAAGCAAAACGATCTCTCCAGCCCACGGACCTGCGCAGGACACGAGAAGCTTTCAGATTGATGCTTAAAGGGGAGCTATCATGAAAATGAGCTTCATCATACTGAAATACGTTTTCTAAATACAATCAATTAAAAATTCTGTACCATTTCTGAAAAAATCGTTTTGGCGAATTTCGTGGCAAAGCAAAATGGGATAAGTTTG
                                                  Xl3.1-CHK-1012685883                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCGAGTTGAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTxxxxxxGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACxxxCxAAxxxxGTGTATAAxxxxATTCCAxxxxGxxxxTTxATTTGCAATAAAxxxTTxATTATATGTAGATGAGACTGTCATCTTCATCCCTTAGTTTTCATGGTGTTTATCATTGCTGTCTGCTCTATGCCTCCCTCCCCCACATCAACTGTATTAAAGGGAGAAATTGGTTTCCATTAAACACCAGAATTTCTCxxxxxxTGCTTTxxxxxxTGGAAGCAAAACGATCTCTCCAGCCCACGGACCTGCGCAGGACACGAGAAGCTTTCAGATTGATGCTTAAAGGGGAGCTATCATGAAAATGAGCTTCATCATACTGAAATACGTTTTCTAAATACAATCAATTAAAAATTCTGTACCATTTCTGAAAAAAxx
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                          3     4     3     4     5     8     9    18    16    21    22    27    29    31    30    32    31    33    32    34    32    34    32    34    33    34    33    34    33    34    33    34    33    34    34    35    34    35    34    35    34    35    34    35    34    35    34    34    35    36    35    36    35    36    35    36    35    37    36    38    37    40    37    40    37    40    36    40    36    40    35    40    39    42    40    43    39    44    39    44    43    45    42    45    41    46    43    47    42    46    41    45    43    49    40    46    38    46    34    46    34    45    34    45    39    45    36    43    36    45    39    44    37    45    40    46    40    46    37    44    36    41    36    41    34    40    33    40    34    40    33    39    33    38    34    37    34    36    38    40    38    39    38    39    38    40    39    41    38    41    37    41    37    41    38    40    38    41    39    40    36    40    34    39    34    39    23    38    21    37    20    37    20    37    19    36    19    36    19    36    17    36    13    36    15    36    14    35    14    35    12    35    13    35    11    34    12    34    11    30     8    23     7    22     3     9     2     5     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     1     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AG----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -T--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G--T
                                               BLH ATG      74    1361                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MIN      71     188                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH MPR      20     188                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               BLH OVR      74      55                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               CDS MIN      74      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               EST CLI      25      22                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
                                               ORF LNG      74       3                                                                                                                                                                                                                                                                                                                                                                                                                                                                     
  5   1   2       chi Ov1  5x                         IMAGE:8332691.5p GGGCTGCGAATAGGGGAAAGGGCTCAATGTTTGCTTTTTACTTGCAGAGAATTCTTTGTTCCCTGCTATAAGCGCTGCTGATATGACCCAATAGGGAGTCAGGGTGGGAGATGGGAGCACCTGTCTCATTACAGACATTTAACTGCCCCCGTGTAATTGCTCAGGGACTGTCAATCATTGGGATTGGCAGCTCAGCCCTTTAAATCCAGAGACATTTAAATGTCCTTCCATGGTCTCCCCTCCAGGCAGAACTTGCAGCTTGTCTTCATTGTGTCTGGGGGATGCTGGGAGTTGTAGTCCAGCAGTCTGGGGAGCCAAGATCCAGTTAGTAACTAGTTAAGGTGCAGACCAGGGCTGGAGGGAGGCACAACTGCCATAGACTACTACTGCAGGTAGTTATAGTTCAACAGCAGGTGGGCTGGGACTCTCCAACTGCTTATAGTCCTGACTGGGTATAGAAGTGCAGTTCAGCAGCCGGTTTGTCACCTCTGGGTTCCCCCTGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAATGAAGAGGAAGGTGTCCCAGTACAGCAATCCGAGAATATCACTACTTAAAGAGCTCAGCACCCCACATAGTCTGCCTCTAGATGTCTCAG
  5   1   2       chi Te1                             IMAGE:6930709.5p                                                                                                                                                                                                                                                                                                                                                         GGGGCGCCGTCACCGCTGCCTCACTCTGATTGGCCGCTTTAAATATCCACGGGCGCAGCGATTGGGTCGGGACGGACAGCGTTTTGCGCGTTTGATTTGAAATCTCTCTGTTAAGGCGAGTTGAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTTCCAGATCCTACAAAGGAATGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCCTGAAACCTCAAAAACCTGGCTCTAGACCATTAAAGGAAGTGAATAAAGTTGGCAAATTTTTGGCCCTTGCCAAGAACCTTTTTGGAATTCCGGGTTCGGGGGTTTACAACACCCCAAGGTCCTTGGACGTTATTGGGTAACAAAGGCCCCCCGGAAATCCCCGTTTTGGG
  5   1   2       bld Neu7 5g3  in                         XL004e17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAATCTCTCTGTTAAGGCGAGTTGAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTTGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGT
  5   1   2       bld Te2N 5g                         IMAGE:7206408.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAATCTCTCTGTTAAGGCGAGTTGAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTANGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCANCAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAGATTACAAGAACACATCCCCAAATGGAAAGGGG
  5   1   2       bld Te2  5g3  in                    IMAGE:7208206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGGCTTTAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACATGAAGTGTGGCCAGAAGTAGAGTCTTA
  5   1   2       bld Neu7 5g3  in                         XL021i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGNCTGCAGGNAATTCGGCACGAGGTGCAAGAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6878353.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGAGCAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATTGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCTCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACANAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTTTCAGATTACNAGAACACCTTCCCCAAATGGA
  5   1   2       bld Egg3 5x3                        IMAGE:6325389.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGGGGGAAGCGGCGCTGTTCGAGGGGTAGTCCAAACTTGGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCATTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCANATGAAAAGGGGGAAGCCTGTCGTCGAAAGTGAAAAATTTTGATGAGGATGGGCTGGACCTGCTGTCTAAAAGCTAGTCCATGATCCCGCCCAGAAGGATTCCCGCACAAAAAGTTATGCTGGCACCCCTACTTTGAAGAAATTGGATAAATCCAGGCCTTCCTGCGCATTCAGAATCGGGAATTAAAAACGGGCAAACGTTT
  5   1   2       bld Gas8 5g3  in                    IMAGE:3517010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGAGGAAGCGGCGCTGCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGCACACAGCAACCGGCCGGGTCGTCGCAATGAAAAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCG
  5   1   2       bld Ga15 5g3  in                       XL474c19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCGCTGCAAGAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCC
  5   1   2       bld Brn3 5g                         IMAGE:8540152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGCGTTGCTAGAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCCATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTGGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGTGTAGGAACTATTTTCGCAGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCACTATTCAGGATATTCAGATCTTTANGGACACCCCACATGAAGTGTGGNCAGAGTAGAGTCTTTACAGATTACAGACACATTCCCAATGGAAGGNNGAGCTGTCTCAATGTGAAATATGATGAGATGGCTGACTGCG
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGCTGCAAGAGGGGTTGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGNACCAGATCCTACAAGGGATTGGTTTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGGTTGGAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCAGATTTACACA
  5   1   2       bld Tbd7 5g                              XL078f10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCGCTGCAAGNAGGGGTTGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAAC
  5   1   2       bld Tbd7 5g3  in                         XL094i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCGCTGCAAGNGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGA
  5   1   2       bld Neu4      in                    IMAGE:3557463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGTCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTNCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGTCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCC
  5   1   2       bld Tbd7 5g3  in                         XL095i14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGCAAGNAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGA
  5   1   2      seed Ga15 5g3  in                       XL468l17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCGCTGCAAGAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTANAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAAGGGGGAAGCCTGTCGTC
  5   1   2       bld Lmb1 5g                         IMAGE:8534517.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCGCTGCAGAGGGGTTGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACTCAACAATGAAATGTGGCCAGAAGTAGAGTCTTTACAGATTACAGACACATTCCCAAATGGAAAGGGGAACCT
  5   1   2       bld Egg3 5g                         IMAGE:6323868.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GATTCCCGGGGAGGGGTTGTCCTACTTGGGAAAAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAAGGGGGAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTTACTTTCGACAACTGGGATAAGTCCAG
  5   1   2       bld Gas9 5g                              BG409944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCACGCGTCCGGTCCAAACTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAACCCCTCTTCCACGGTGACTTCTGAAATTGACCAGCTNTTCAGGATATTCAGGTCTTTGG
  5   1   2       bld Ov1  5g                         IMAGE:8330365.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAAGAGGGGTAGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACAGCTCTTCAGGATATCAGATCTTNAGGGACACCACAATGAGTGTGGCAGAGTAAGTCTTACAGATACAGAACCT
  5   1   2       bld Neu7 5g3  in                         XL045i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCC
  5   1   2       bld Ga12 5g3  in                         XL175b02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AATTCGGCATGAGGGGAAACCGTCTGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGT
  5   1   2       bld DMZ  5g3  in                         xl301g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATTGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAT
  5   1   2       bld DMZ  5g3  in                         xl294f19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCCAAACTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATTGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAG
  5   1   2       bld Tbd7      in                         XL074e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAACTTGGGAAACAGTCTGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGA
  5   1   2       bld Ga12 5g3  in                         XL192i09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTTGGGAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTANGAACTATTTTCGCCG
  5   1   2       bld Ga12 5g                              XL154e11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGAAACCGTCTGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAG
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3746482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCATTTGGAATTCCGGTTCGGGTTTACACACACGNAGTCGTGACGTTATGGTACAGAGCCCCCGAAGTGCTGTTGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGGCGAGATCGCCACAAAGAAACCCTCTTGCACGTGACTCTGAAATTGCCAGCTCTTTCAGATATCAGATCTTTAGG
  5   1   2       bld Egg4 5g3  in                    IMAGE:3743974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACCGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCGAAACCTGCTCATAGACAATAAAGGAGTGATANAGTTGGCAGATTATGGCCTTGGCAAGAGCTAT
  5   1   2       bld Ga12 5g3  in                         XL192o21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGTCATGGACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCAGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCG
  5   1   2       bld Tbd7      in                         XL058m17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GNACGAGTACACTAAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTG
  5   1   2       bld Te2N                            IMAGE:7768142.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAATAGAGAAGATCGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACAGGCCAGGTCGTCGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGA
  5   1   2       bld Tbd7      in                         XL058b08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         NATCGGNGNGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAAAATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCA
  5   1   2       bld Skin                            IMAGE:8643454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGAAGGTGTCCCAAGTACAGCAATCCGTGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATTGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCATTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGANNAGCTATGCTGCACCCCTAC
  3   1   2       bld Te2  5g3  in                    IMAGE:7208206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCTTGATCCTTCACGCAGACTCAGGTTGGATTCTATCTTGAGGTCTCTCCCTGAATCTAAGAAGTAATTAGACTCGTACCCAAGCGGCCCGTAATCGATACCATGCTCGTTAAGAGTACCTGTACCAGATCCTACAGGGGGATGTATCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCTACCACACTCTAATGTAAATATGGACCCTGCCAAACCATGTGTATAAATGCAATTCCACGCGGACATTTCATTGCCAATAAAGCCC
  5   1   2       bld Neu7      in                         XL034j06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TNCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGG
  3   1   2       bld Tad1      in                    IMAGE:6880326.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCCATACGGGCCGGGCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACTTGTCCCAGATCTTACAAGGGGATGTATTCTGCCACTCCAGACGAGTTNTACACAGAGACTTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACCATGTGTATAAATGCAATTCCAC
  3   1   2       bld Ga15 5g3  in                       XL468l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAGACTCGATACCCCAGCGGNCCAGTATATCGATACAATGCTCGTTAAGGAGTTACCTGTACCAGATTCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAANCCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAAT
  5   1   2       bld Tad1      in                    IMAGE:6880326.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGCCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTANAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTTCCGCCNATCAGATTAGAAATTAAAAACGGCAAATGTTTGTTTTCTTTGGGGTTTCTGGGATGGGGGGATCTGATGTAAAATCACCTCATTATTTTTTTAATTGTCCTGCAACGTGAATATAAAAAATGGAAGGTGGTGGTGTGGTCTCCGTCCCTT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6878353.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGGCCCAGTATTTCGATCCAATGCTCGTTAAGGAGTTACTTGTACCAATTCTTACAGGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCTCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTTTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAANGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACCATGTGTATAAATGCAATTCCA
  3   1   2       bld Ga15 5g3  in                       XL474c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACCGCGGACAT
  5   1   2       bld Ga12      in                         XL150o24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGANGTCGNGACGTTATGGTACANA
  5   1   0       chi Thy                             IMAGE:8548639.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTGAGTTCTGCGTGATATGCCTCTAACTAAACCCTCCTTCATTCTCCCTCTTTGCTTTGAAGTCAAACCGTCTGGTTGTGTAAAAAGCCTTTATTAGTACAGGTTCGTTTTGTGCATCTCCCACCCAATAATATTCTAGCAATAAAGCCCCCCACCCAGGCACAAGTTCTGAGATTTGGCACCCTACAATGATTAAAATAAACACTTGATTAAAGCCTTTTTAAGGGCTCTTACACATGGGCGTTTTTTTCTGCGCTCTCCTCCGTTGCGCTTTCTTCCGTTCAGCCGCAGGAGTGGACGCAGTCGATTGTTGTggggggggTTGTGCTCACACAGACGCATGTGTGCGCTGTACGCAGGTGAAATGAGTCATGCTGCGTCCCACCTGCGTTTGGCGCTTGCGTGCGTCTGTGTGAGGGCGGCCCCCTTCACGGTGGTTGACTGCGTCTACTACTGCGCTCCCCTGCTGCTGAACGGAAGAGGGCGCGACGCAGGAGAGCGCAGAAGAGACGCCTGTGTGTAAGAGCCCTTAAGCTGAGGGTGCTAAGTGTTATTTGGTTCTTGATGGTGATCATATAGGAAGTGGGCTGGGTGGGGCTGCTACTTCAGGACTTAGACGAGGGGTCGATCATGCGGACTTAGGTCAAGCCAGAATGTT
  3   1   2       bld Ga12 5g3  in                         XL192i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACACAGAGACCTGAANCCTCAAAACNTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATT
  3   1   2       bld DMZ                                 rxl278o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAGACAATAAAGGAGTGATAAAGTTGGCAGNTTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGNTCGGGNTTACACACACGAGGTCGNGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCANTC
  5  -1   2       bld Tbd5                            IMAGE:3580463.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCCAGAGCATTGGAAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCACCGCAAGTGCTGTTGGGGTCAGTCGCATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATNTTCGCCGAGATCGCCACANAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATtgtctgtatgtgatatatatatgtatgtgtgtgtgtcTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATGT
  3   1   2       bld Tbd7      in                         XL110b21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGNCNTTATTATA
  5   1   2       bld Tbd7      in                         XL110b21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATTTTGGCCTTGNCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCANGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATT
  3   1   2       bld Egg4 5g3  in                    IMAGE:3743974.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCACTGGAAGTGCTGTTGCGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCNGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATA
  3   1   2       bld Tbd7      in                         XL058b08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGGGTTTACACACCACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGNCTTTATTA
  3   1   2       bld Neu7 5g3  in                         XL004e17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATACTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACCTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGNCTTTATT
  3   1   2       bld Neu7 5g3  in                         XL045i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTNCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTNCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTNCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTNCCACGCGGAC
  3   1   2       bld Ga12      in                         XL150o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTACACACACGAGGTCGTGACGTTATGGTACAGAGCCCCGGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGNCTTTATTATATG
  3   1   2       chi Tbd7      in                         XL074e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGTCATGTGACTTTCTATGTCGGTTAAAGCAGACTTTATTATATTGCATGCGGAAGTCACAGCCTTTTGTCCCTTCCATGCAGCAATTCAAGTAATTAGCCTGAAATTTGGGAGGACCCAAATCTCACAAGTAAAGTGACACATTTGCATTTTGCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTTATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCNTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATT
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402819.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TACAAAGCCCCGAAAGTCCTTTGGGGGTCAGTCCGATATTCACGCCCAGTTAACGTCTGAGGCGTAGGAACTATTTTCGCGGAGATCGCCACAAAGAAACCCTTTTTCCACGGTGACTCTGAGAGTGACCAGCTTTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATATGT
  5   1   2       bld Egg1                               PBX0086G11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAAGTCCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGG
  3   1   2       bld Ga12 5g3  in                         XL175b02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCNTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTATGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTGCAANAA
  3   1   2       bld Egg1                            IMAGE:3302128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCTTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGGTTTTGGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTTTTTTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTTTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATATGTAGATGAAAAAAAAAAAAAAAAAAAAAAAAAAGATT
  3   1   2       bld Tbd7      in                         XL058m17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGNCTTTATTATA
  3   1   2       bld Egg6                            IMAGE:4435933.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCAC
  3   1   2       bld Neu7      in                         XL034j06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTATTTTCNNNGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTANAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTCTCATNTGCAATAAAGCCTTTATNATA
  3   1   2       bld Neu4      in                    IMAGE:3557463.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTATTCGCCATGCTCGCACCATACCAGCCCGTCTTCCCAGGTGACTCTGAAATTGACCACTCGTTCAGCATATTCAGATCTTTAGGCCCACCCCACAATGAAGTGTGGCCACAAGTAGAGTCTTCCAAGATCTCCAAGCACACATTCCCCCAATGGAAAGGGGGAAGCCTGTCGTCGCATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTTCGCACGACAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGA
  3   1   2       bld Neu7 5g3  in                         XL021i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGCCGAGATCGCCACAAAGAAACCCTTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATA
  5   1   2       bld Egg1                               PBX0136B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGAGGAGAAACCCCTCTTCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGGTCTTTGGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCtgtatgtgatatatatatgtatgtgtgtgtgtgtCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATGTaaaaaaaa
  3   1   2       bld Ooc2 5g3  in                    IMAGE:3746482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCAACAATGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGAGTAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATGTAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Emb4                            IMAGE:4202977.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTTTGGGGACACCCAACAATAAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATAAGGAATTGAAAGGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATGTA
  3   1   2       bld Tbd7                                 XL059e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAAGTGTGGCCAGAAGTAGAGTCTTTACAAGATTNCAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAANAGGATTTCCGCANGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCNGCCAATCAGATCAGGAATTANAACGGCNAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACNCATTATTTTTNATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGNAGTGGCACCTCCAAGTACNTGTGTTAAAGCACCACACTACTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTGCCACGCGGACATTCTCATTTGCAGATAAAG
  3   1   2       bld Tbd7 5g3  in                         XL094i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAGAGTCTTTACAAGATTACAAGAACACATTCCCCAAATGGAAAGGGGGAAGCCTGTCGTCGAACGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAANGTAAATATGGACC
  3   1   2       bld Ga12      in                         XL195c23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCAAATGGAAAGGNGGANAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACA
  5   1   2       bld Ga12      in                         XL195c23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCAAATGGAAAGGGGGAAGCCTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCTACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTtattgtctgtatgtgatatatatatgtatgtgtgtgtgtCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATG
  5   1   2       bld Ga18      in                      xlk130d16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCAttattttttattgtctgtatgtgatatatatatgtatgtgtgtgtgtCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATATGTAAAAAA
  3   1   2       bld Ga18      in                      xlk130d16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTNCCAAACATGTGTATAAATGCANTTCCACANGG
  3   1   2       bld DMZ  5g3  in                         xl301g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATATGTAGATGAGACTGTCATCTTCATCCCTTAGTTTTCATGGTGTTTATCATTGCTGTCTGCTCTATGCCTCCCTCCCCCACATCAACTGTATTAAAGGGAGAAATTGGTTTCCATTAAACACCAGAATTTCTCATCGCTCTGCTTTATATATGGAAGCAAAACGATCTCTCCAGCCCACGGACCTGCGCAGGACACGAGAAGCTTTCAGATTGATGCTTAAAGGGGAGCTATCATGAAAATGAGCTTCATCATACTGAAATACGTTTTCTAAATACAATCAATTAAAAATTCTGTACCATTTCTGAAAAAAATCGTTTTGCGAATTTCGTGGCAAAGCAAAATGGGATAAGTTTGCCCACCGCTA
  3   1   2       bld Gas8 5g3  in                    IMAGE:3517010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCGTCGAATGTGAAAAATATTGATGAGGATGGGCTGGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTTTAATGTAAATATGGACCTGCCCAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCATTAAAATATGTAGATGAAAATAAAAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl294f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGACCTGCTGTCTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTTCCGCACGAAAAGCTATGTTGCACCCCTACTTCGATGACTTGGATAAGTCCAGCCTTCCCGCCAATCAGATTAGAAATTAAAACGGCAAATGTTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTNTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACACGGACATTTCATTTGCAATAAAGCTTTATTATANGTAGATGAGACTGTCATCTTCATCCCNTAGTTTTCATGGTGTTTATCATTGCTGTCTGCTCTATGCCTCCCTCCCCCACATCAACTGTATTAAAGGGAGAAATTGGTTTCCATTAAACACCAGAATTTCTCATCGCTNTGCNTTATATATGGAAGCAAAACGATCTCTCCAGCCCACGGACCTGCGCAGGACACGAGAAGCTTTCAGATTGATGCTTAAAGGGGAGCTATCATGAAAATGAGCTTCATCATACTGAAATACGTTTTNTAAATACAATCAATTAAAAATTCTGTACCATTTCNGAAAAAAATCGTTNNGCGAATTTCGTGGCAAAGCAAAATGGGATAAGTTTGCCCA
  3   1   2       bld Tbd7 5g3  in                         XL095i14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAAAATGCTAGTCTATGATCCCGCCAAGAGGATTTCCGCACGAAAAGCTATGCTGCACCCCNACTTCGACGACTTGGATAAGTCCAGCCTTCCTGCCAANNANATCAGGAATTAAANCGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCNCCNCNCTCTAATGTAAATANGGACCTGCCAAACATGTGTATAAATGCAATTNCCACGCGGA
  3   1   2       bld Ga12 5g3  in                         XL192o21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGACTTGGATAAGTCCAGCCTTCCTGCCAATCAGATCAGGAATTAAAACGGCAAACGTTGTTTCTTTGGGGTTTCTGGATGGGGGATCTGATGTAAATCACTCATTATTTTTTATTGTCTGTATGTGATATATATATGTATGTGTGTGTGTCTCGTCTTCTGCTGCTGATGTAGTGGCACCTCCAAGTACTTGTGTTAAAGCACCACACTCTAATGTAAATATGGACCTGCCAAACATGTGTATAAATGCAATTCCACGCGGACATTTCATTTGCAATAAAGCTTTATTATATGTAGATGAGACTGTCGTCTTCATCCCTTAGTTTTCATGGTGTTTATCATTGCTGTCTGCTCTATGCCTCCCTCCCCCACATCAACTGTATTAAAGGGAGAAATTGGTTTCCATTAAACACCAGAATTTCTCATCGCTCTGCTTTATATATGGAAGCGAAACGATCTCTCCAGCCCACGGACCTGCGCAGGACACGAGAAGCTTTCAGATTGATGCTTAAAGGGGAGCTATCATGAAAATGAGCTTCATCATACTGAAATACATTTTCTAAATACAATCAATTAAAAATTCTGTACCATTTCTGAAAAAAATCGTTTTGCGAATTTCGTGGCAAAGCAAAATGGGATAAGTTTGCCCACCGCTACTTGTGTAAAACCCCGCTTCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)