Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6636340.5                      48 PI      80        240      636                (no blast hit)
     2   0.0    0Xl3.1-xl328k08.5                           38 PI      81        243      636                hairy2b [Xenopus laevis]
     3   0.0    0Xl3.1-XL510d18ex.3                         19 PI      90         11     1299                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012768299 Xl3.1-IMAGE:3302026-IMAGp.5 - 50 ESTs
                                                                       -20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3302026-IMAGp.5                     GGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAATGTATTATCAAAGGATTTACAATAAAATTT
                                                  Xl3.1-CHK-1012686683                           GCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAATGTATTATCAAAGGATTTACAATAAAATTTTCAATG
                                                      consensus depths                         10    13    14    19    15    19    15    19    17    19    18    19    18    19    17    19    18    19    18    19    18    19    17    19    18    19    17    19    18    19    18    19    18    20    19    20    19    20    19    20    19    20    19    20    19    20    19    20    17    18    17    18    17    18    16    18    16    18    17    18    18    19    18    19    18    19    18    19    19    22    20    24    22    25    26    29    25    29    26    30    28    31    30    31    30    31    30    31    30    31    31    31    30    31    30    32    28    32    32    33    31    33    32    33    31    34    28    33    29    33    31    35    27    35    31    35    27    31    27    29    25    29    23    29    23    29    22    28    23    27    23    26    24    26    22    25    22    25    23    25    22    25    23    25    23    26    23    25    23    25    24    25    24    25    23    24    24    24    23    25    21    22    22    22    22    23    22    23    22    24    21    24    21    24    22    25    22    25    22    25    22    27    23    27    23    27    22    27    23    27    25    27    24    27    22    27    20    25    19    25    13    17    11    13    11    12    11    12    10    12     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10    10    10     9    10    10    10    10    10     9     9     9     9     8     9     9     9     8     9     9     9     9     9     9     9     9     9     8     9     9     9     8     9     8     9     8     9     7     8     4     6     2     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                               BLH ATG     170     838                     
                                               BLH MIN     164     114                     
                                               BLH OVR     170      73                     
                                               EST CLI      -5      54                     
                                               ORF LNG     170       3                     
  5   1   2       bld Tad2 5g3  in                    IMAGE:6881623.5p CAGTATCAGTCAGGGCAAGCGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCCTGAACCAGATCAATGGCATGAACTACCCCTACCCAGCCCCAAATCTTGACGCCACTGTGACTGCTCACTCAACCGAGCAAGGCATATACGGGN
  5   1   2       bld Egg2 5g                IMAGE:3302026-IMAGp.IMAGp         TTCGGGCCCGAGGCCAAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCATATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCCATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCT
  5   1   2       bld Ga15 5g3  in                       XL504p10ex.5p              GGCAAGCGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCC
  5   1   2       bld Em10 5g                         IMAGE:7981023.5p                CAAGCGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACACCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCAATTGCGTGCAAGATGGGTGGTC
  5   1   2       bld Ga18 5g3  in                       xlk56d07ex.5p                 GCAAGCGGCCAAGNGNTGGTGCGGGANATTAGCACACTCTCTACCCAGCGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCNTTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTNNTCTGTTTGTNGNCCTATTGCGCTTTGAGNNCNGAAGATGCCGGCTGATGTGATGGAGANGANCTCTTCATCCCCAGNGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCAT
  5   1   2       bld Ga18 5g3  in                      xlk115p08ex.5p                 GGCAAGNGGNCNNNNTTGGTGCGGGANATTAGCACACTCTCTACCCAGCGACACTCTTCTTTCATTCTATTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCNNNNGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAANCTGCAGCGGGTNCAGATGAGCGCTGCACTGAGTACAGACCCTTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTNCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAANGGGNTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGNCAACTGCATGAACCNNNNNAATGGCATGAACTACCCTACCCAGCCCCANATNNCTTCTNCAGCNCACCCACCCTGCCTACGGACAGCCCATGGNCCAGCTCCCAGNNG
  5   1   2       bld Kid  5g                IMAGE:4030543-IMAGp.IMAGp                  AGCGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGG
  5   1   2       bld DMZ  5g3  in                         xl333i09.5p                  AGTGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGA
  5   1   2       bld DMZ  5g3  in                         xl284g15.5p                  AGTGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCT
  5   1   2       bld DMZ  5g3  in                         xl285g17.5p                  AGTGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAANATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACANAAAGTCCTCCAAGCCCATCNTGG
  5   1   2       bld Kid  5g                         IMAGE:4030543.5p                   GCGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGNGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAAGCACCCAGCTTCCCATTGCGTGCAAAATGGGTGGGCCCCCAGTCCNAAACTGCCAAAGTGGATGGGAGGCTTCCACTTGGGCCAGCCCCCAAAATGGACAGGTTGCCTTCCCTGATCACAAAACCCCGGTTTTCCCCTCCCAACGGAACTGGGCATTCCTGGCCTAACCCAACTCCCATGGGGGGGCCCCGCAATTG
  5   1   2       bld Te2N 5g                         IMAGE:7205459.5p                    CGGCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACNGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGGATGGGTTGGTCCACCAGTCGAAGCTGCCAAAATGTATGGGAGCTTTCAGCTTTGTGCCAGCCCCCCGATGGAACGGTTGGCCCTTCCCTGATCACAAAACCCAGCCTTTTCCCTCCACAACGGGATTTTGGT
  5   1   2       bld Ga18 5g3  in                        xlk4b03ex.5p                     AGCNGCCANNNNTTGGTGCGGGANATTAGCACACTCTCTACCCAGCGACACTCTTCTTTCATTCTATTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCNNNNGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCNCACCCCACCCTGCCTACGGACAGCCCATGGNCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGNANATGGGTGGTCCANCAGTCGANGCTGNCAAANNGT
  5   1   2       bld DMZ  5g3  in                         xl320c06.5p                      GCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCC
  5   1   2       bld DMZ  5g3  in                         xl291n23.5p                      GCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCA
  5   1   2       bld DMZ  5g3  in                         xl275h11.5p                      GCCAAGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCA
  5   1   2       bld FaB  5g3  in                    IMAGE:8070897.5p                       GGCAAGCGGTTGGTGCGGGACTTATCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCGCACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAGAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACGCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACTCTACACAGCCACAGATGCCTTCTGCAGCCGCACCCCACACTGCCTACAGACAGCCCATGGTCAGCTCCAGGAGCAGCTCACAGAGCAACCTACTCCCATGCGTGCACATGGGTGGTCACAGTCGAGCTGCTAAGT
  5   1   2       bld Kid  5g                         IMAGE:7010288.5p                          CGGTTGGTGCGGGACATTAGCACACTCTCTACCCANGCGGACACTCGTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAG
  5   1   2       bld DMZ  5g3  in                         xl304l02.5p                          AGCGGTTGGTGCGGGACATTAGCACACTCTCTACCCAGCGGACACTCTTCTTTCATTCTACTATTGGATTGCCGATTGCATTCTTGCACACACTCATACATATAACCCGGCCTTTTAATACATTGTTGTTCTGTTTGTGGACCTATTGCGCTTTGAGTGCAGAAGATGCCGGCTGATGTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCC
  5   1   2       bld Em10                            IMAGE:8319569.5p                                                                                                                                                                                                           GTGATGGAGAAGAACTCTTCATCCCCAGTGGCTGCCACCCCGGCCAGTGTGAGCAATACCCCGGATAAACCCAAAACTGCCTCCGAGCACAGAAAGTCCTCCAAGCCCATCATGGAGAAGAGAAGGAGAGCCAGGATCAACGAGAGCCTCGGGCAGCTCAAAACCCTCATCCTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAA
  5   1   2       bld Te2N                            IMAGE:7205324.5p                                                                                                                                                                                                                                                                                                                                                                                      CTGGATGCGCTCAAGAAAGATAGCTCCCGGCACTCCAAGCTGGAGAAGGCAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCCTGTTATTATAGATAAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCAAAAGACATGGAAAGCCTCTTTAAGTGGTTTCTTCCTTAATTTTGTGGGAAAATTTTTTCCTT
  3   1   2       bld Tad2 5g3  in                    IMAGE:6881623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTGAAACACCCCTTTGAGGGAACCCTGCCAGGCGGGTGCCAGAATGAACCGTTTGCACTTGAGTTACAGACCCTTTCAGTAACTGGGCAAAGTACAAGAGCTGGATTTCAGGGGAGTGCATGAAAGGAAGTAACCCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTTTCTTCCTATTTTGGGAAGTTTTGGA
  5   1   2       bld Ga15      in                       XL482m23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGATATATTGGAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTG
  3   1   2       bld FaB  5g3  in                    IMAGE:8070897.3p                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTTGGAGATGACAGTAAACACCTGAGGAACGTGCAGCGGGTGCAGATGAGCGTGGCACTGATTACCAGACCTTCAGTACTGAGCAAGTACAGAGCGGGATTCAGGGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTTTGCAGCCGCACCCCACCCTGCCTATGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCCTAAGTTGTCTTCCTATTTTGGGAAG
  3   1   2      seed DMZ  5g3  in                         xl333i09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGATGACAGTGAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTT
  3   1   2       bld Ga15      in                       XL463j11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCCGGAAACACCTGAGGAAACCTGCAGCGGGTGCAGATGAGCGCTGCANTGAGTACAGNCCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACT
  5   1   2       bld Ga15      in                       XL463j11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAACACCTGAGGAACCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTG
  3   1   2       bld DMZ  5g3  in                         xl285g17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAACCTGCAGCGGGGTGCAGATGAGCGCTGCACTGAGTACAGACCTTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACNCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCNGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCNCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCNTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAANGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACNATATCTGTATATATAGGAAATGTTCATATNGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACANGGAATGCTCTTAAGTT
  5   1   2       chi Brn3                            IMAGE:8541171.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATNNNCCACATAGCTTNGNNNGAAGATCCATCAATAAGAATTCGTCCCGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACTTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCTTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGACTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTTCGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATAATCAGATTTCGTTTGTACACAAATAATGCTATATTTTATGCCAAGACATGAATGCTTTACGTTGTCTTCTATTTGTGGAGTTTACTGTATGTATAAATGCCATGTATTTCTCTTTCTAAAAAGAAAACAACAATTACAATATAAAAAATAGGTGGAGGCCTGTCCTCTCAACCGTCTCCCCCC
  3   1   2       bld DMZ  5g3  in                         xl304l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTT
  3   1   2       bld DMZ  5g3  in                         xl284g15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGCGGGTGCAGATGAGCGCTGCACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTT
  3   1   2       bld DMZ  5g3  in                         xl291n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGAGTACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTACTG
  5   1   2       bld Emb3      in                    IMAGE:3400011.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACAGACCCTTCAGTACTGGGCAAGTACAGAGCTGGATTCAGCGAGTGCATGAATGAAGTAACCCGATTCCTGTCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCCTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGG
  3   1   2       bld DMZ  5g3  in                         xl275h11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTACCTGTGAAGGGGTCAACACAGATGTCCGGACCCGACTCNTGGGGCATCTTGCCAACTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTNTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTG
  3   1   2       bld Ga15 5g3  in                       XL504p10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGTCAACACAGATGTCCGGACCCGACTCCCTGGGGCATNTTGCCAACTGCATGAACCAGATCAATGGCATGAANTACCNTACCCAGCCCCAGATGCCTTNTGCAGCCGCACCCCACCCTGCTTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTATACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAG
  3   1   2       bld Ga15      in                       XL482m23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACTCCTGGGGCATCTTGCCAANTGCATGAACCAGATCAATGGCATGAACTACCCTACCCAGCCCCAGATGCCTTNTGCAGCCGCACCCCACCCTGCNTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAAGCTCT
  3   1   2       bld Egg1                            IMAGE:3302002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACCTATCCACGGCATAACTACCATACCAGCCCCAATTGCATATTGCAGCAGCACCCCACCTTGCTGACGGACAGCCCATGGTCCAGCTCACAGTACAGCTCTACAGAGCAGCCCAGCTCCCATGACGGCTAAGATGGGTGGTCCACCAGTCGAACCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCATCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCT
  5   1   2       bld Ga15      in                       XL495b20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL495b20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTCTGCAGCCGCACCCCACCCTGCCTACGGACAGCCCATGGTCCAGCTCCCAGGAGCAGCTCCACAGAGCAGCCCAGCTCCCATTGCGTGCAAGATGGGTGGTCCACCAGTCGAAGCTGCCAAAGTGTATGGAGGCTTCCAGCTTGTGCCAGCCCCAGATGGACAGTTTGCCTTCCTGATCACAAACCCAGCTTTCCCTCACAACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTT
  3   1   2       bld Emb3      in                    IMAGE:3400011.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCGGCATCCCTCCCTCCCTCCGAACAGCCCATGGTCCAGCTCCCAGAACTAGCTCCTCAGATCAGCCAAGCTCCATTGGCGCGCAAGATGGGTGGTCCTCCAGTCTAAGCTGCCACACGTGTATGCAGGCTTCCAGCTTGTGCCAGCCCCAGATGAACAGTTGCCCTTCCTGATCACAAACCCAGCTTTCCCTCACACCGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGCAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAAAAAAA
  3   1   2       chi Ga18                             rxlk104p21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CANCNCCNNNNGAGCAGCCAGNNCCCATNNNGNNNNGNTGGGTNGNCCNCCANTCGAAGCTGCCAAAGTGTATGGAGNNTTCCAGCTTGTGCNAGNCCNAGATGGACAGTTTGCCTTCCTGATCNCAANNCCAGCTTTCCCTCACAACGGATCTGTCATTCNNNNCTACACCANNTCCAATGTGGNNACCGCATTGCCACCTTCAGTNTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATNCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAATGTATTATCAAAGGAT
  5   1   2       bld DMZ       in                         xl276h07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGGATCTGTCATTCCTGTCTACACCAACTCCAATGTGGGCACCGCATTGCCACCTTCAGTGTCTCCTTCAGTAATGCCATCAGTCACAATTGATTCTGTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCCTGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGG
  3   1   2       bld Ga18 5g3  in                      xlk115p08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CNTCAGNNNCTNCTTCAGNANTNNCNTCAGTCACAATTGATNCTNTTTGGAGGCCCTGGTAAAGGGAAATGACTGTGGGACTTGTGTTAGCTGGNACTNAGTTACAAATAGTAACCCCCTCATGNGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATANCCAGATTTTCTAATATNCCACTGTGTATAAATGTATNTCAAAGGNT
  3   1   2       bld Ga18 5g3  in                       xlk56d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNGATTCNNNTNNGAGGCCNTGGTAAAGGGAAATGACTGTGGNNCNNGTGTTAGCTGGANCTNAGTNACAAATAGTANNCNCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTNCGTTTNNNACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTNATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATNATAGGGGTTACAGCTCTGTTAAANCATTGTCATNATAGTCACCCANCCAAACAATTGGGGCCATATAGTACTGATTGATNTNNTTTGAAAAACTTCTAATGCGGGCTTGGGNCCACGGAAATCTTTTNATATCCNCNATGAATATAATGCACTATTTTAGATNANTGGTACATTATTCAAGNGATTTCAAACTCTAGTAATATGCCCTTCTCCANNNNNCNAATNACTTGTTCTNTTANGAAANNAGANNANACAAAATANCCAGNNNNNNTNNTATNC
  3   1   2       bld DMZ  5g3  in                         xl320c06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGGGAAATGACTGTGGGACTTGTGTTAGCTGGAACTTAGTTACAAATAGTAACCCCCTCATGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAATGT
  3   1   2       bld Ga18 5g3  in                        xlk4b03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTAGNNGNACTNAGTTANAAATANNANCCNNNNNATNNGGTAGTGANNNCTGATGCNCTATATCTGTNNNTATAGGAAATGNTCATATTGANTTGTATCCNTGTATTATAAGNTTNATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATNNCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAANTGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATNCCACTGTGTATAAATGTATTNTCAAAGG
  3   1   2       bld DMZ       in                         xl276h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCGGTAGTGAGAATTCTGATGCACTATATCTGTATATATAGGAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCCTGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAAT
  3   1   2       bld Neu7      in                         XL027h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAATGTTCATATTGAATTGTATCCTTGTATTATAAGATTAATCAGATTTCGTTTTGTACACAAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGNAATAAATGTATTATCAAAGGATTTACA
  5   1   2       bld Neu7      in                         XL027h22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATGTTNTATTGAATTGTATCCTTGTATTATAAGATTAATNAGATTTCGTTTTGTACACAAAATAATACTATTATTTTGATGCCAAAGACATGGAATGCTCTTAAGTTGTTCTTCCTATTTTGTGGAAGTTTTACTTGTATGTAATAAAAATGCACATTGTATTTTCTCTTATTCCTAAACGCTGAATTTGTCATTTGTGGATTTTGCCCTTTTCTATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCATGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGAATAAATGTATTATCAAAGGATTTACAATAAAATTTTCAATGCCTaaaaaaaaaa
  3   1   2       bld Tbd3                            IMAGE:3549119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATTTAATTGTCAATGCAGGGGTTATTGCATTCAAATGAACATATTTTTTATATAGCTCAGGCATCTTGGATCCAAACTCCTCTTTATATTACAGACCACACCCCTGTTATTATAGGGGTTACAGCTCTGTTAAAACATTGTCATAATAGTCACCCAACCAAACAATTGGGGCCATATAGTACTGATTGATGTCATTTGAAAAACTTCTAATGCGGGCTTGGGACCACGGAAATCTTTTGATATGCTCTATGAATATAATGCACTATTTTAGATCAGTGGTACATTATTCAAGTGATTTCAAACTCTAGTAATATGCCCTTCTCCATTTAACTAATGACTTGTTCTTTTAGGAATTCAGTGCATACAAAATAGCCAGATTTTCTAATATACCACTGTGTATAAATGTATTATCAAAGGATTTACAATAAAATTTTCAATGCCTATTCATTTTAATCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)