Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 06 Jul 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:6634066-IMAGp.5                15 END     6           5       40                fibronectin 1 [Xenopus tropicalis]
     2   2.0    0Xl3.1-IMAGE:4970871.5                       6 END     2           1       33                fibronectin protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL463j08ex.3.5                      139 PI      92          1     2891                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012768304 Xl3.1-xlk147e24ex.3 - 108 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     4     3     4     2     4     2     4     2     4     4     5     4     5     3     5     4     5     6     6     6     6     7     7     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    14    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    17    18    18    18    19    19    19    19    19    19    18    19    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    21    22    21    22    21    22    20    22    20    22    20    22    20    22    20    23    20    23    19    22    20    22    20    22    21    23    18    23    20    22    20    22    19    21    20    21    19    21    19    20    18    19    15    18    14    16    14    17    14    15    14    15    14    14    15    15    15    15    14    15    13    13    13    13    12    13    12    13    12    14    12    15    12    15    12    15    13    15    15    17    15    17    16    18    16    18    15    17    14    16    13    15    13    15    12    15    12    15    12    16    11    15    10    15    10    14     7    13     9    14     4    14     4    14     9    16     9    16     9    16     9    15     9    15     9    14    10    14    10    14    10    15    10    15    10    15    10    13    10    13    10    13    10    13    11    14    11    14    11    14    11    14    11    15    12    16    12    16    14    16    14    16    14    16    15    18    15    18    16    17    16    17    15    17    15    16    15    16    16    17    16    17    15    17    15    16    15    16    15    16    13    16    16    18    13    18    16    18    16    19    13    20    15    21    14    21    14    20    14    20    14    20    14    20    15    20    15    22    15    23    16    23    16    23    16    23    16    23    16    23    17    23    18    25    18    25    16    23    17    24    16    25    16    26    16    27    16    28    17    28    17    28    20    31    20    31    21    32    24    35    23    35    27    37    29    37    28    37    29    38    25    38    35    40    36    40    37    40    36    40    39    41    33    37    35    38    36    39    35    39    35    39    36    40    34    41    35    41    37    42    36    43    37    44    36    45    38    48    41    48    41    48    39    47    39    47    40    49    38    49    39    49    39    51    39    51    35    51    42    53    36    52    37    53    36    53    37    53    38    51    37    51    35    51    37    52    37    52    37    52    39    53    39    53    38    52    38    52    39    50    39    50    38    48    38    48    38    48    27    45    22    45    21    40    20    35    17    25    17    23     6    11     5     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A--------
  5   1   2       bld Ga12      in                         XL190p01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATGACACGGCAGAATTGCACGGTCTGAGGCCGGGCACAGAATACACTGTGAGCATTGTGGCATTGCACGATGACATGGTAGAGCAAGCCATTGATTGGGATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCATAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGT
  5   1   2       bld Tbd1                                 AW765047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAGCAAGCCATTGATTGGGATCCAGAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCCTAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTTCATTCAACCTGCGTTTGCTCACCACA
  5   1   2       chi Tad1                            IMAGE:6939253.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCACAGCAATTCCAGCACCAACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGTTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCCTAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAAGACCTCGTATCCAAGATGTGACAGAAGACCCACGTTACCCCTGTCCCTGGCGCCACTTAGAACAGAAGACCTATAACTGGGCTTCCCAAAATTTGGATGCTAATACCCTGCCAgaaagggccaaaaatcccctattttagaaagaaaaagttttaatgccaaaaatcttccaaaaaCCTTTTTTCCTAATCCCCCCAGGGTTTTTTGCAAACCCCCGGGGCCCCAGGAACTTTCCAAAAAATCTCTTTTTCTTTAAACCCCCCTTAAAAAAGAAACAATGGGccccccaaaaaccccccccccGGGGGG
  5   1   2       bld DMZ       in                         xl221m04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAATTCCAGCACCAACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCCTAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAA
  5   1   2       bld DMZ       in                         xl243n15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCAATTCCAGCACCAACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCCTAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAA
  5   1   2       bld Ga18      in                      xlk154c13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACAAATCTTCAGTTCTCCCAAGTGACACCAAGTGGCTTCTCTCTTAGCTGGCATGCACCCACTGTCCATCTCACTGGGTACCTGGTACGGGTGAACCCTAAGGAGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGNACAGAATATATTATCTATANNNTGCTGTGA
  5   1   2       bld Neu7      in                         XL016d15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTT
  5   1   2       bld Tbd2                            IMAGE:3200749.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAACTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAAGAGCACCTNCCACGTCTNCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGA
  5   1   2       bld Ga12      in                         XL214e15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGGCCTACGAAGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCC
  5   1   2       bld Lu1       in                    IMAGE:4633190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACGCGTCCGGGAAGTTAGACTTTCTCCAGGTGTCGCTGCTACAACTGTAACTGGTCTGATGGTGGCCACAAAATATGAAGTGAATGTTTATGCTCTTAAGGATTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCGACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGAAGGGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTTGGGACTCTCCATCCAACCTGCGGTTCCTCACCACAACTAGCAACTCCCTGCTGGTCACTGGGCAGCCACCTCGCGCTCGTATCACTGGCTAT
  5   1   2       bld DMZ                                  xl236p06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGT
  5   1   2       bld DMZ       in                         xl286c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCTCTTACAAGTTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCNAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTC
  5   1   2       bld DMZ                                  xl236d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCTCTTACAAGTCAGCCACTGCAGGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATC
  5   1   2       bld Tad2                            IMAGE:6932393.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGTTTAATCTCTACACTTGATAATGTTAGTCCACCTCGAAGACCTCGTATCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTTCCAGCTCTAATGGACAGCAGCCCAGTTTCTGACCATGAAAGGGCAGCTTTATTGAGGGAACA
  5   1   2       bld Oo1                             IMAGE:6640603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAAATTTGCCCCTGGGCGCTACCCCGCAGAGAGGGTTGATATTGAGCTAGACACCTTTCCTGTGCAGCATGGAGATTTTGAAGGTCCCTTACCCTCATGGCTTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAAGAGGGGGCATCCCATACTACAAATTTCATGG
  5   1   2       bld DMZ       in                         xl270n19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAGATGTGACAGAGACCACAGTTACCCTGTCCTGGCGCACTAAGACAGAGACTATAACTGGCTTCCAGATTGATGCTATACCTGCAGACGGTCAGAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTG
  5   1   2       bld Ga18      in                      xlk147e24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATCCTATTAGAAGAACAGTTGATGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTNNNAGTGAGNNCAGGGAAATTTGCCCCTNNNGCTACCCNNANNGAGGGNTNATATTGAGCTAGACACNNTTCCTGTGCAGCATGGAGATTTGATGGTCNTNCCNNCATGGCTT
  5   1   2       bld DMZ       in                         xl259j05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAGATCTCAGAACATTTACTATCACAGGTTTGCAGCCCGGCACAGACTACAAAATCTATCTCTACACCCTAAATGACAATGCTCGTAGCTCTCCTGTGACTGTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATG
  5   1   2       bld Emb1                            IMAGE:6630831.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ccacgcgtccgcccacgcgtccgcccacgcgtccgcccacgcgtccggTTGATGTCACCACAGCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGNGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTANGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGGAACCACTGAATATATCATCTCCTGCCATCCTATTGACCCATGAGAAGCCCATTTGCAGTTTAGGGGTCCTGGAACCTCTTCCAGTGCCACATTAAACGGGCCTGACTCGGGGGAGCCACTTATAACATCGCTGNTTGAAGCCACACAAGG
  5   1   2       bld Ga12      in                         XL218c17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTGTGGACTCTCCATCCAACCTGCGTTTCCTCACCACAACTAGCAACTCCCTGCTGTTCACTTGGCAGCCACCTCGCGCTCGTATCACTGGCTATATCATACGCTACGAAAAAGCTGGGGGCCTAATAAAGGAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGA
  5   1   2       bld Ga18      in                        xlk1i24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGCACCTCCCACGTCTCCCAGCAGGAACCACAGAGTCTACTCTTACCAACCTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGNCAGTGAGGNCAGGGAAATTTGCCCCTGGNNNTACCCGCAGNNAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGNCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGNATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTNCCAGTGCCACATTAAACGGGCTGNNTCGGGGNGCCANTTATAACATCGTTGTTGAAGCACAGAAGGGGNNTGATAAACACAAGGNCNTAGAGAAGNNNNNGACTGTTNGNAGTCCTNGNNCTNNTGANGGNNTTTTACA
  5   1   2       bld Emb9                            IMAGE:7974819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGAGCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCTCTATTGCATTTTAGGGTTCCCTGGAACCTCTTCCAGTGCTACATTAAACTGGCTGACTCTGGGAAGCCACTAATAACTCATTGTTGAAGCCAAAAGGGACTGATAAACCAATGCTTTAAAGAACTTTGGATT
  5   1   2       bld Ga12      in                         XL161o20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAACGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCACAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGT
  5   1   2       bld Ga18      in                       xlk55i07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGNNNGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGNCAGTGAGGCCAGGGAAATTTGCCCCTNGNNNTACCCGCAGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAACGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCACAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGNGTGACTGTTGGNAGTCCTGGNTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACANTCAGTGGAGCACACTATTCTGTGGGACAGGAANGGGAA
  5   1   2       bld Ga18      in                      xlk142e17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGNCAGTGAGGCCAGGGAAATTTGCCCCTGGNNCTACCCGCAGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGNGTGACTGTTGGCAGTCCTGGNTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGNCAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTNNCTGGGTTACGGGANNNGACACTTCAGANGTGACTCATCCAAATGGTGCCATGATAANNNGTCAATCACAGGATTGGGNNGNAATGGGNNAGACGAG
  5   1   2       bld Ga18      in                      xlk142g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTNNCAGTGAGGCCAGGGAAATTTGCCCCTGGNNNTACCCGCAGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGNCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGNTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGNNAGGAATGGGAACNCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGNNNCTGGGTTACGGGAGNGGACACTTCAGANGTGACTCATCCAAATGGTGCCATGATANNNNGTNNNCACAGGATTNGGGNAGAAANGGGA
  5   1   2       bld Ga18      in                       xlk51n22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGAACACACCCCACATCACACAAACTAAGTTGGACAACGGTAATGGTATCCAACTTCCAGGCTCTAATGGACAGCAGCCCAGTTCTGACCATGAAGGGCAGCTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTNNCAGTGAGGNCAGGGAAATTTGCCCCTNGNNNNACCCGCAGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCNTGTGACTGTTGGCAGTCCTGGNTCTCCTGAGGGAGNNNACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGNCTTTGGTGCAAGNNNNNNNTTACGGGANNNGACNCTTCAGATGNGACTCATCCAAATGGNNNCNTGATAATGNNGTCAATCACAGGNNTNGGGNNAAATGGGNCAGANGAGGAGA
  5   1   2       bld Lmb1                            IMAGE:8533879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTATTGAGGAACATGGTTTCAGAAGTCCCCTTGCACCCACTACTGCTGTGCCAGTGAGGCCAGGGAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGACAGATGATGAGTTGTACTGTCTTGGCATGGAAAGGAGATTTAGTGTGNNACTCTGAGCTACTGCTATGATGAAGGAAATGTCATGTTGTGAGCATGCAGAAGATATCAGACATCTGTCTGCCTGCATGAGACGCAGGTGAG
  5   1   2       bld Emb4                            IMAGE:4684091.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAATTTGCCCCTGGGCGCTACCCGCAGGAGAGGGTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCCTGGCTTAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCACAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCANAGGGTGGAGGTGTGACCATTGCCCGCAGAACAGGGTGCTGTTTTCTTCCCGATGGCACTGCCTGGGCAAACAGTGGTCTCCGTTTTACCCCGGAGATACCAACCAAACTATTATTTTGACCTTGCCCCAATGAAGGGCTACCTTTCCCC
  5   1   2       bld Tad2                            IMAGE:6875471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGGGCCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAACGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCACAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGGCACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGGATTGGGGAGAAATGGGACAGACGNAGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAAATTTAAGTGTGAACCCTCCTGAAGCTACATGGCTATGGATGAAGGGGAAAATGTACCAATGTTTGGTTGAAGCAATGGGGCAGAAAGAAATTATCTAGGGAGCAATTCCTGCTTCGGG
  5   1   2       bld Ga18      in                      xlk120d13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGAGGNTTGATATTGAGCTAGACACGTTTCCTGTGCAGCATGGAGATTTTGATGGTCCTTACCCTCATGGCTTAGGGNCACAGCTGAATGATTCTGGTGTCCAAGAGGTGGCATCCCATACTACAATTTCATGGAGACCTGAGTTGGAAACCACTGAATATATCATCTCTTGCCATCCTATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGNTTTGGTGCAAGTNCCTGGGTTACGGGAGNGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATANTNNNNCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATNGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAATGTACAATGTTGGTGAGCAGTGGNAGAANGNATATCTAGGAGC
  5   1   2       chi Ga15                               XL474i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCAGGCACAGAATATATTATCTATATTATTGCTGTGAGAAACAATATGAAGAGTGAGCCTCTTGTGGGACGTAAGAGAACAGACGAACTCCCCCGCCTGGTTACACTTCCACACCCTGGCCAAGGCCCCGAAATTCTTGATGTTCCCACCGATGAAGAGAACACACCCCACATCGTTGTTGAAGCACAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCANACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCCAAACAGTGTCTCAGTTTACACAGAGATACCAANCAAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCCTGGGNCC
  5   1   2       bld Neu7                                 XL042f13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTGACCATGAGGAAGCCCCATTGCAGTTTAGGGTTCCTGGAACCTCTTCCAGTGCCACATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACA
  5   1   2       bld Em10                            IMAGE:8321017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCAGTGCCCATTAAATGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGG
  5   1   2       bld Tad1                            IMAGE:6940403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGGCTGACTCGGGGAGCCACTTATAACATCGTTGTTGAAGCGCAGAAGGGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCACGAAGTTGAAGAACATCNACAATACCAGTCGGTGGGCACCCACATGGGGTGGCACCAGGGGAG
  5   1   2       bld Ga15                               XL402n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGACTGATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCANATACACAGCACTCACAACAGACCCANAAGTGAANAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGANTTCANTTAACATGCCCATACTAACTGACTGAANATACAAAATA
  5   1   2       bld DMZ       in                         xl224j08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAACACNAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCANAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCANATGTGACTCATCCAAATGGTGCCATGATNATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCACACCACGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACNCAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACA
  5   1   2       bld DMZ       in                         xl224j12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATAAACACAAGGTCTTAGAGAAGCGTGTGACTGTTGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGNAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAA
  5   1   2       bld Tad1                            IMAGE:6940759.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGCAGTCCTGGTTCTCCTGAGGGAGTTTTACAGCCAGTCGAGGATACCTGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTTGAATGACATTCAATATTCAGTGGTTGAAAATT
  5   1   2       bld Tail                            IMAGE:8542903.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTTATGATACATTCAGTGGAGCACACTATTCTGTGGGACAGGAATGGGAACGCATGTCAGAATCTGGTTTCAGGCTTTGGTGCAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTATT
  5   1   2       bld Bone                            IMAGE:8739966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGTGCCTGGGTTACGGGAGTGGACACTTCAGATGTGACTCATCCAAATGGTGCCATGATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAAT
  5   1   2       bld Ga18      in                      xlk108d07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AANTNNNGGGTTACGNNNNNNACACTTCAGATGTGACTCATCCAAATGGTGCCATGATANTNNNNCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGNCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTNNACAGGGAGNTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAANTTTTATGTNAACTTTTGCNTTTTAATTATGGTTGGNNAATGGTCCTTTTTTAAATAAAATAGGNNNTTTTGTTAGTNNCTTTTTCAATATGGATTAGAANNGAAATTTGNAAAAGGNNAACACTTGTGGCTNGG
  3   1   2       chi Ga18      in                      xlk148c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGATnnnnCnnnnnnnAATGNNGCCANNATAATGNNNTCAATCACNGATNGGGANNAANNGGACANNCGANNANAGAATGNACAGATGATGANTTNNNCNNNNNTNGCAATGGAAAAGNANNATTNAAGTGTNNNCNNNTGAAGCTACATGCTATGATNNAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAANNNATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTNTTTCTCCCGATGNCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATNCCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTANCTTCCCCTGGNNCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNNACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTATTTTTTTTTATACTGTANNNCNAANNNNTTTACTACTGNNGAAAGANA
  3   1   2       chi Tad2                            IMAGE:6874515.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGATTAGTCAGCACCTGTGTATACTGTGACATGGTAGCGTATTTTTATAGGGGTGTGACGGACTACTTATATCTTCGCGCGGCGAGAGGATACAAGTAGGAAGTATATACGAATCAACAGGATTTAGGAGTAGACTTAAAGAATATAGGACACGACCAAAGCGCCAGAAGGCGCAAATATTCTCGCCTCGACGTTGCAACAATGGGAAGGAGACAAAGCGCGAAGGCGAAAACAGTTTGGGCCAAGCGTAAAATTGACCCGGGCAAAAGAGGTAAAAAGTGTGGGAGTGTGGCACCCCAATTGAAAAGTGCTTGCCCTTGCACCCAAGGGGCCTTTCCAAGGCAGGTTAACAAACGCCGAGTCACCAAGCAGAACCCCAGAAGGGGAAAGAAACCATCCACAATTACAGTTGGTGGCCACCACCAAGGGTTTGCACCAGGGGGGTTCCAGTTAACATTGCCCATACTTAATTGACGGAAGATACAAAAATACTTCAAACTTCACTGGAAAGTATTTGAAAGACATTCAGTATTCAGTGAGGGAAATTTTTAGGTTAACTTTTGCTTTTTAATTATGGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATGGAAAATGTGCCAAAGCTTCCACCCTTTTGGGAAGNNCTTCCCTCCCGGCGGCGCAGCGCTACTCTTGCTGGGTGTTGTTCATCAGAAGGAGAAATTAGA
  5   1   2       bld Li1       in                    IMAGE:5129894.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GATAATGGCGTCAATCACAGGATTGGGGAGAAATGGGACAGACGAGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAaatttttatgttaacttttgctttttaattatggttgggaaatggtcctttttta
  3   1   2       bld Ga18      in                      xlk142e17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AANNNGNANNGNCNNNGNNNNGAANGACAGNTGATGAGTNGTACCNNTCTTGNCAATGGAAAAGNNGAATTTNAAGTNTNNNNTCCTGAAGCTNCATGCTATGATGAAGGGAAAATGTACANTGTTGGTGAGCAGTGGCAGAAGGAANATCTAGGANCAATCTGCTCGTGNACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTNTTTCNNCCGATGGNACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAANCTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGNACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTNNCNCCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAANCTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATNNCCAAAGNTTTTACTACTGNGGAAAGATANNCANNC
  5   1   2       chi Tad1                            IMAGE:6937330.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAGAGAATGGACAGATGATGAGTTGTACCTGTCTTGGCAATGGAAAAGGAGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAatttttatgttaactttttgcttttttAATTATGGGTTGGGAAATGGGTCCTTTTTTAAATAAAAATAGGTGCTTTTTGTTAGTGGCTTTTTTCAAATATGGATTAGAAATGGAAATTTGTTAAAAAGGGCAACACTTGGTGGCCTGGGAGAAATGTGGTAAATAGTTTATTTTCAGTTGCCTGGGCCTGAAGCCTGGGCATCCAGTGGGAACCTTTTGAAATTTTCCAGGGCACAAATATTCAAAAAGGGAACCCCATTTGGTTCtttttttttttttttAAAAAAATCCCTCTGGAGAA
  3   1   2       bld Ga18      in                      xlk142g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GNAAANGNNGAATTNAAGNNTGNNCCTNCTGAANCTACATGCTATGATGNNNGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGNANTATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGNCCAGGTGCTNTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACANAGAGATACCAACAAANCTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGNCTTCAAGCAGATACACAGNACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGNCCNAAGCTTTTACTACTGNNGAAAGATANNCANNC
  5   1   2       bld Tad2                            IMAGE:6933254.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAATTTAAGTGTGAACCTCCTGAAGCTACATGCTATGATGAAGGGAAAATGTACAATGTTGGTGAGCAGTGGCAGAAGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGaaatttttatgttaacttttgctttttaattatggttgggaaatggtccttttttaaataaaaTAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTTGATTCCCAGCAAAAATCAAAGGGGACCATTGtttttttttATAATCCTGAAAGTGGTGCTAGACTTTGCTGCTTCTGGACACATTTACCCTATGGCACAATT
  3   1   2       bld Ga18      in                      xlk147e24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAAGNNNNNNCTCNTNNANCTACATGCTATNANNNAGGGAAAAATGTACAATGTTGGTGNGCAGTGGCNGAAGNNATATCTAGGAGCANNCTGCTNGTGNACATGCTATGGAGNACAGCAAGGGTGGAGGTGTGACAATTNNNGCANNCCAGGTGCTGTTTCTCCCGATGGCACTGCTGNGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGNCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGNCCAAAGCTTTTACTACTGNGGAAAGATANTCA
  5   1   2       bld Tad2                            IMAGE:6935664.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGGAATATCTAGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCCAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAAAAGTTATTTCAGTGCTGGCTGAACTGGCATCAGTGGACTTTGAATTCCAGGCCAAAATCCAAGGGACCCTTGGtttttttttAAAAATCCCCGAAATGGTGGCTAAGACCTTGCTTGCTTCTCGACACAATTTACCCATATTCCCACACATCCCCAAAATTCCCCTTTTTCCCGCGACAAATCCCTTTAACTTAAATGGCGCCCCAAACTCTTTCCCTCCCTAACA
  5   1   2       bld Tad2                            IMAGE:6935925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGGAGCAATCTGCTCGTGCACATGCTATGGAGGACAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCCCAATCATAATTTCCTTTTCCGCCCAATCCTTAACTAATGCCCCAACTTTTCCTCTACTGGCCAGTGTTAATTTATCAGGAATCTGGCTTCAAAAAGGAATTCCCTTCCAATTTTaaaaaccaaaaaaaaG
  3   1   2       bld Ga18      in                      xlk154c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CNNNGNGCAATCNNNNNNNGNACATGCTNNNNANGACAGNAAGGGNGNAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTNCCGATGGCACTNCTGGGCAAACAGTGTCTCAGTTTACACAGAGATNCCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTNCCNTNCCCTGNGCCTTCAAGNAGATACACAGNACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNNACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTATAATCCTGAAGTGGTGCTAGNCTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACNGTATNNCCAAAGCTTTTACTACTGTGGAAAGATANTCANTCNTCNNNNNTNAAA
  3   1   2       bld Ga18      in                       xlk55i07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCTNNTCGTNNNCNTGCTANGNAGGACAGCANNGGNNGAGNTGTGACAATTNNNGCAGNCCAGNTGCTNNTCNCCNGATGNNACTGNTGGGNAAACAGTNTCTCAGTTTANACAGAGATACCAACAAAACTATAATTTGNACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGNACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNCCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTANNNCCAAAGCTTTTACTACTGNGGAAAGATA
  3   1   2      seed DMZ       out                        xl317b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAAGGGTGGAGGTGTGACAATTGCCGCAGACCAGGTGCTGTTTCTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTNTATGTGCTCAAAGCTTT
  3   1   2       bld Ga18      in                      xlk120d13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGANAATTNCNNNAGNCCAGNTGCTNTTTCNNCNGANNNNACTNCNNNNNAAACAGTGTCTCANTTTANACAGAGATNCCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTNCCTTCCCCTGGNNCTTCAAGCAGATACACAGNACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTNNCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATNCTTCAANCTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATNNCCAAANCTTTTACTACTGNNGAAAGA
  3   1   2       bld Ga18      in                      xlk108d07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CNGCAGNCCAGNTGCTNTTTCNCCCGATNNNACTGCTNNNCAAACANTNTCTCAGTTTANACAGAGATACCAACAAANCTATAATTTGAACTGCCCCATTGAGNNCTANNTTCCCCTGGNNCTTCAAGNAGATACACAGNACTCACAACAGNNCCAGAAGTGAAGAACATCACAATACAGTCGNNNNNNACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTANNNCCAAAGCTTTTACTACTGNGGAAAGANANNCA
  3   1   2       bld Ga18      in                        xlk1i24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCNNTTTNNNCNGATGGNNCTNCNNNCAAACANNNTCTCAGNTNACANANAGANNCCAACAAANNNATANTTTGNNCTGNCCCATTGAGTGCTACCTNCCCCTGGGCCTTCAAGCAGATACACAGNACTCNCAACAGNCCCAGAAGTGAAGNNCATCACAATACAGTCGTGCNCCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATNCTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTANNNNCAAANCTTTTACTACTGNNGAAAGANA
  3   1   2       bld FaB       out                   IMAGE:8070670.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCCGATGGCACTGCTGGGCAAACAGTGTCTCAGTTTACACAGAGATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTATTTCCGTGGGCGTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTATTACTACTTGGAAAGACACAGCATGATAGTTTGAAAA
  3   1   2       bld DMZ       in                         xl259j05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATACCAACAAANCTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTCTACAGCATGTGCNCAAAGCTTA
  3   1   2       bld DMZ       in                         xl221m04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATACCAACAAAACTATAATTTGAACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACCNGTATGTGCCAAAGCTTTT
  3   1   2       bld Ga18      in                       xlk51n22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCAANNAAANNNNNTNATTTGNNTNCCCNNNTGAGTGCNACNTTCCCCTGGNNCNTCAAGNAGATACANAGNACTCACAACAGNCCCAGAAGTGAAGAACATCACAATACAGTCGTNNCACCACATGGGNGNACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATNCTTCAANCTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTANNNNNNAAGCTTTTACTACTGNGGAAAGANANNCA
  3   1   2       bld DMZ       in                         xl243n15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGCCCCATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTC
  5   1   2       bld Tad1                            IMAGE:6880052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGAGTGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACCAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCCTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGGTATTATGGGCTGGNGAttttattttaatttttttttAAACTGGGATGGGGCAAAAGCTTTTACTACTGTGGGAAAGAATAATCCAATCATTCCTTTTAAATAAAAAAGAACCCTGaaaaaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Egg1                               PBX0068C09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGAGGGCTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAATGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGAT
  3   1   2       bld DMZ       in                         xl224j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTACCTTCCCCTGGGCCTTCAAGCAGATACACAGCACTCNCAACAGACCCAGAAGTGAAGAACATCNCAATACNGTCGNGGCNCCACATGGGTGCCCAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCNCTGGAAGTATTTGAATGACNTTCNGTATTCNGNGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGNTGGGAAATGGTCCTTTTTTAAATAAAATAGGNGCTTTTGTTAGNGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACNCTTGNGGCTGGGNGAATGNGTAATAGTTATTTCAGTGCNGGCTGAGCTGGCNTCNGNGGACTTTGAATTCCNGGCAAAAATCAAAGGGNCCNTTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGNGATTTTATTTTATTTTTTTTTATNGCTGTATGTGCCAAAGCTTNTACTACTGGGAAAGAT
  3   1   2       bld Ga12      in                         XL161o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTCCCCTGGGCNTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCNCAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTANTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTNTTACTACTGTGGAAAGATAATCAATC
  3   1   2       bld Ga12      in                         XL193o05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGNCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCA
  3   1   2       bld DMZ       out                        xl334f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCCCAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTANCTGACTGAAGATACAAAATNCTTCAAACTTCACTGGAAGTATTTGAATGACNTTCAGTATTCAGTGANTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAANGAAATTTGTAAAAAGGGCAACACNNGTGGCTGGGAGAATGTGTAATAGTTATTTCAGNGCCGGNTGAGCNGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCNTTGTNTTNTNTTATAATCGTGAAGTGGNGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCNCAATCCTTGATAATGCCCAACNTTCCTNTACNGTCAGTGTTATTNATCNGAGTCTGCTTCATNNGATNCCNNCTATTNTAANACAGAAAAGTGANTAAGTCTGAAAGTAATGGCAGTTGAAT
  3   1   2       bld DMZ       out                        xl316d17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTCAAGCAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGNGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTCGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTCNATGTGCCAAAGCTNAA
  5   1   2       bld Lu1       in                    IMAGE:4633344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGATACACAGCACTCACAACAGACCCAGAAGTGAAGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTTTTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTGGACTTTTGCTTTTTACTTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGGttttttttttttATAATCC
  3   1   2       bld DMZ       in                         xl270n19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAACATCACAATACAGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTT
  3   1   2       bld Ga12      in                         XL218c17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCGTGGCACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAANCTTTTACTACTGTGGAAAGATAATCAATC
  3   1   2       bld Ga12      in                         XL214e15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACNGAAGATACAAAATNCTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTNTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATC
  3   1   2       bld DMZ       out                        xl338p06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACATGGGTGCACAGGGAGTTCAGTTAACATGCCCATACTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGNGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGNGCTTTTGTTAGNGCCTTTTTCAAATANGGATTAGAAATGAAATTTGTAAAAAGGGCAACNCTTGNGGCTGGGNGAATGNGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCNGTGGACTTTGAATTCCNGGCAAAAATCAAAGGGNCCNTTGTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCANAAGAACNTGATGT
  5   1   2       bld Emb4                            IMAGE:4683843.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGCGTCCGGTTAGTATGGGCATGTTAACTGACTGAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGAttgaaatttttatgttaacttttgctttttaattatggttgggaaatggtccttttttaaaTAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGAttttattttatttttttttATACTGTATGTGCCAAAGCTTTTACTACTGCGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGaaaaaaaaaaaaaaaaaGGGCG
  3   1   2       bld Neu7      in                         XL016d15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAGATACAAAATACTTCAAACTTCACTGGAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTT
  3   1   2       chi Emb3                            IMAGE:3399165.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTCACCGGGAAGTATGTGAATTACATCAGGTATCAGTGGACTGGACCTTTCATGTTCCCTTCGGCCTTTTATTAATGGTTGGCAATGTCCTTNTCTTAATAACAAGCGTGCTTTGCTTAGTGCCTTTCTCCAATATGGATAAGAAATGAAATTTGTAAAAAGGGCAACACCTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGA
  3   1   2       bld Tbd1                                 AW782332.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAGTATTTGAATGACATTCAGTATTCAGTGATTGAAATTTCTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAA
  5   1   2       bld Ga12      in                         XL193o05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 attgaaatttttatgttaacttttgctttttaattatggttgggaaatggtccttttttaaATAAAATANGTGCTTTTGTTAGTGCCTTTTTCNAATATGGATTACAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGC
  3   1   2       bld Li1       in                    IMAGE:5129894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTATGTTAACTTTTGCTTTTTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTG
  3   1   2       bld Ga12      in                         XL190p01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTTGCTTTNTAATTATGGTTGGGAAATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTnTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATC
  3   1   2       bld DMZ       in                         xl286c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCNTTTTAATTANNGNNGGGAAATGGTCCTTTTTTAAATAAAATAGGNGNTTNNGTTAGTGCCTTCTTCAAATATCGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTNGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATANTCCTGAAGTGGTGCTAGNCTTGCTGCTTCCGACACAACTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTTNTAATGCCCAACTTTCCTNTACTGTCAGTGTTATTTATCAGAGTCNGCGTCATATGATTCCTTCTATTTTAANACAGAAAACGGGNTTAAGTCT
  3   1   2       bld Lu1       out                   IMAGE:4056917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGGTCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATA
  5   1   2       bld Ga18      in                      xlk153j07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGAttttattttatttttttttATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGNNaaaaaaaa
  3   1   2       bld Ga18      in                      xlk153j07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCTTTTTTAAATAAAATAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTANNNCCAAANCTTTTNCTACTNNNGAAAGANA
  3   1   2       bld Emb1                            IMAGE:3402724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGGTGCTTTTGTTAGTGCCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGA
  3   1   2       bld Lu1       in                    IMAGE:4633344.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGAGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATATGA
  3   1   2       bld Lu1       in                    IMAGE:4633190.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTTTCAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATAA
  3   1   2       bld Lu1       out                   IMAGE:4058565.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAA
  3   1   2       bld Emb4      out                   IMAGE:4201717.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATATGGATTAGAAATGAAATTTGTAAAAAGGGCAACACTTGTGGCTGGGAGAATGTGTAATAGTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGCATAATCAATCATTCTTTTAATAAAAAGATCCTGAAA
  5   1   2       bld Gas8      in                    IMAGE:3517506.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGTATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGAttttattttatttttttttATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAGTCATTCTTTTTATAAAAGGATCCTGAAATTTGaaaaaaaaaaaaaaaaaaaaG
  5   1   2       bld Gas8      in                    IMAGE:3517482.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTTATTTCAGTGCTGGCTGAGCTGGCATCAGTGGACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGtttttttttttATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGAttttattttatttttttttATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATATGaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld DMZ       in                         xl224j08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGNGGNCTTTGAATTCCNGGCNAAAATCAAAGGGNCCNTTGTTTTTTTTTTCATAATCCTGAAGTGGTGCTAGACTNGCTGCTTCTGACACAATTACCNTATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCNACNGTCAGNGTTANTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATNCAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAACTTATGGCTGGNGNCCNAATCTTNATT
  3   1   2       bld Lu1                             IMAGE:4633508.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACTTTGAATTCCAGGCAAAAATCAAAGGGACCATTGTTTTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATA
  3   1   2       bld Gas8      out                   IMAGE:3517006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CATTGTTTTTTTTTATAATCCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATAAAAAAAAAAAAAAAA
  3   1   2       bld Lu1  5x3  out                   IMAGE:4057585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTATAATCCTGAAGGTGGTGCTAGACTTGCTGCTTCTGACACAATTACNCATATGGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTATATACTGTAATGTGCCAAAGCTTTTACTNACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATAAA
  3   1   2       bld Gas8      in                    IMAGE:3517482.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTGAAGTGGTGCTAGACTTGCTGCTTCTGACACAATTACCATATGCACAATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATATGAAAAAAAAAAAAAAAAA
  3   1   0       chi Emb4                            IMAGE:4958415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCACGCGTCCGGGAATCATATGAAGCAGACTTTGATAAATAACCCTGACAGTAGAGGAAAGTTGGGCATTAGTAAGGATTGTGCTTCATATGATTCCTTCTATTTTAAACCCACCAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGAT
  3   1   2       bld Gas8      in                    IMAGE:3517506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCATAATTCCTTTTCCGCACAATCCTTACTAATGCCCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGAAAATATGAAAAAAAAAAAAAAAAA
  5   1   2       bld DMZ                                  xl262n04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCGATTCGCAACTTTCCTCTACTGTCAGTGTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGAttttattttatttttttttATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTGaaaataaaaaaaaaa
  3   1   2       bld Emb4      out                   IMAGE:4958029.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTATTTATCAGAGTCTGCTTCATATGATTCCTTCTATTTTAATACAGAAAAGTGATTAAGTCTGAAAGTAATGGCAGTTGAATTTGATGTAATTATGGCTGGTGATTTTATTTTATTTTTTTTTATACTGTATGTGCCAAAGCTTTTACTACTGTGGAAAGATAATCAATCATTCTTTTAATAAAAAGATCCTG

In case of problems mail me! (