Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:8641476.5                       9 END     1           1       11                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:4203129.5                       2 END     1           1       50                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:6880326.3                      78 PI      89          3     1197                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012768375 Xl3.1-XL420g21ex.5 - 62 ESTs
                                                                       .-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL420g21ex.5                                                                                                                AGTTTAGCAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTGTATATTGCTGAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686269                                                                                                                      GCAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGxxATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTxTxTxxTGTATAxxxxxxAAAAAA
                                                      consensus depths                                                                                                                     2     6     7    15    17    25    23    31    24    33    30    33    32    34    32    34    32    34    32    34    32    34    32    34    32    35    32    35    33    35    33    35    33    35    33    35    33    35    33    35    34    35    34    35    34    35    34    35    35    35    35    35    35    35    35    35    33    33    29    34    34    35    34    35    34    35    34    35    35    35    33    36    35    36    34    36    34    36    37    38    36    38    37    39    34    38    36    40    36    39    34    40    37    41    35    41    37    41    35    40    33    41    39    43    38    42    33    41    30    36    30    36    27    37    30    37    28    34    28    34    20    31    22    31    24    31    24    32    24    30    24    29    23    29    22    29    24    30    24    30    23    30    24    30    22    29    23    30    23    29    23    30    25    30    26    29    26    28    26    28    19    27    24    27    17    27    17    27    12    27    11    27    12    27    14    27     7    28     8    28     7    28     7    28     7    28     7    28     7    28     8    28     8    27     4    20     4    18     4    13     3     8     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTGCTGATA
                                                                   SNP                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                            -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                            -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----------CA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --G-G-------
                                               BLH ATG      57     690                                                                                                                
                                               BLH MIN      57     186                                                                                                                
                                               BLH MPR       3     186                                                                                                                
                                               BLH OVR      57     126                                                                                                                
                                               CDS MIN      57      50                                                                                                                
                                               EST CLI      10      50                                                                                                                
                                               ORF LNG      57       7                                                                                                                
  5   1   2       chi Ga15      in                       XL508c05ex.5p GGGGattccagtctcttattcaaatcggtgcatggttgctaggggaatttggaccctagcaatcagattgctgaaattgcaaactggagagctgAAAATATCACATTCTACATCATACGAAGGGGCAGATTTATCAAGGGTCGAAGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCANAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGANATTGCCAC
  5   1   2       bld Egg3 5g                         IMAGE:6869086.5p                                                    CGATTCCCCGGGAGGCGCTTTAGCTTCTGATTTGAATCGCTCTGTTCAAGCAAGTTGCCGAGTTTAGCAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGGGGACTCTGAAATTGACCAGCTCTTCANGATATTCAGAGCTTTGGGGACAACCCAACAATGGAGGTGTGGCCAGAAAGTAGAATCTTTACAAGATTACNNAGAACTCATTCCCCAAATGGGAAAAGGNGGGAGCTTTGTCGGCGGAACGTGGAAAAATAATCGATTAAGGAATGGGGCTGGACCCTACTTGGCTAAAAATGCCTAAATCCTATGAATCCCA
  5   1   2       bld Brn2 5g                          Brn2-za45a04.5p                                                                                              tttttttgttttttttGGAGTTTAGCAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCAT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074708.5p                                                                                                     GACCCACGCGTCCGCCCACGCGTCCGAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACA
  5   1   2       bld Neu1 5g3  in                       Neu1-17B10.5p                                                                                                      CGGACGCTGGGTCGACCCACGCGTCCGGCGGAGGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCGGGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCC
  5   1   2       bld Egg3 5g                         IMAGE:6870912.5p                                                                                                               TCCCGGGGCAGGAAGAAGCGTAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCCAATGGAAAGGGGGGAAGCTTGTCGGCGAAACGTGAAAAATATTCGATAAGGATGGGGCTGGGACCTACTGGCCTAAAATGGCTAATCTTATGATTCCGCCCCAAAAGAAATTTCCCCACCGTAAAAGCTTTGGCTGGCACCCCCTAATTTTCGAAGGAATT
  5   1   2       bld Ov1  5g                         IMAGE:5074089.5p                                                                                                                 CCACGCGTCCGAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4201815.5p                                                                                                                   CACGCGTCCGAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGCGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAACACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTTATTGACAGGAAGGGAGTGATTAAGTTGGCAGGATTTTGGGGCTTGCCAAAACTTTCGGGAATTCCA
  5   1   2       bld Egg3 5g                         IMAGE:6871382.5p                                                                                                                   CCCCGGGGGAAGAAGCGGAGCTGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATANGNACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCCACGGTGACTCTGAAAATGACCACCTCCTCAGGGATATTCAGAGCTTTGGGGAACCCCCCAACAATGAGGTGGTGGGCACAAAATTAAAAATCTTTTACAAGAATTACAAAGAAACCTCCTTCCCCCAAATGGGAAAAggggggggaactttgttccggccaaacctgaaaaaaattttccaaaaaaggggggggcttggggacccctctggggggtaaaaaGAGCGTTAAACCTCTGTGATTCCCCCGCCCCAGAAAAAAATATTTCTCCCGCCACCGCTAAAAATCTTTTTTGGTGCC
  5   1   2       bld DMZ  5g3  in                         xl261e19.5p                                                                                                                      GCAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTC
  5   1   2       bld DMZ  5g3  in                         xl318p24.5p                                                                                                                       CAGGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGC
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328986.5p                                                                                                                         GGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCCTCACAGAGACCTGAAACCTCCGAACCTGCTTATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAAATCTTTCGGCAATCCAATTCCGGGTTATCACATATGAGGTAGTGAACATAACGGCCTGAACCCCCAAATTGCTGTCGGGGTCAAATCAATAATCCCCTTCCGCAGATGTTCGGAACTTAAGGACCATTTTTGCTGAAATGCCTACAAAGAATCCCCTCTTCCAGGTTACTCTGAAATTGACCATCACTTTAGAT
  5   1   2       bld Ga12 5g3  in                         XL157d20.5p                                                                                                                          GGAAGAAGCGGAGCGGCGCGAGGGGGAATCCGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGANGTAGTGACATTAT
  5   1   2       bld Ga12 5g                              XL157e20.5p                                                                                                                          GGAAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTNTGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCC
  5   1   2       bld Tbd7      in                         XL065g23.5p                                                                                                                            AAGAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCTGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATA
  5   1   2       bld Emb4 5g                         IMAGE:5542421.5p                                                                                                                             GAAGCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACCCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCANATGGAAAAggggggggAGCTTTGTCGGGCGAAACGTGAAAAATATTCGATAAAGGGATGGGGCTGGGACCCTNACTGGCCTAAAAATGCCTTAATTCTATTGATTCCAGCCCCAAGAAGAAATTTTCCCGCACGGTAAAAGGCTTTTGCC
  5   1   2       bld Gas8 5g                         IMAGE:3516556.5p                                                                                                                                GCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAAGTAGTGACATTATGGTACAGAGCCNCAGAAGTGCTGTTGGGGTCAGTACGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATGGGCACAAAA
  5   1   2       bld Emb4                            IMAGE:5572206.5p                                                                                                                                GCGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGGAACCCCAACAATGAGGTGTGGGCCAGAAAGTAGAATCCTTTACGAGATTACAAGACCTCATTCCCCCAAATGGAAAAGGGGGGAGCCTTTGTCGGCGAAATGTTGAAAAATATTCGATTAAGGGTTGGGGTTGGAACCTAACTGGGGTTAAAAATGGCCTAATCCATGGAG
  5   1   2       bld Kid  5g                         IMAGE:7011450.5p                                                                                                                                 CGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATTGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCCACAATGAGGTGTGGCCAGAAGTAGAATCTTTTACAGATTACAA
  5   1   2       bld Te2  5g                         IMAGE:7394022.5p                                                                                                                                 CGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGCCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCNAACATGANGTGTGGCCAGAAGTAGAAATCTTACAAGATTACAGAACTCA
  5   1   2      seed Ov1  5g3  in                    IMAGE:8327912.5p                                                                                                                                 CGGAGCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCA
  5   1   2       bld Tbd5                            IMAGE:3581517.5p                                                                                                                                  AGCGGCGCGAGGGGGAATTCCAGCCTTGGGNAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCGCTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATA
  5   1   2       bld Tbd7 5g3  in                         XL108f10.5p                                                                                                                                     GGCGGCGCGAGGGGGAATCCGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATTGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGC
  5   1   2       bld DMZ  5g                              xl248i09.5p                                                                                                                                     GCGGCGCGAGGGGGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8328732.5p                                                                                                                                        GCGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGATATTCAGAGCTTTGGGAACACCCAACAA
  5   1   2       bld Ga15 5g3  in                       XL420g21ex.5p                                                                                                                                         CGCGAGGGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATTGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAA
  5   1   2       bld Ga18 5g3  in                      xlk139k19ex.5p                                                                                                                                          GNNNNGGGGGNATCCAGCCTTGGGAAANAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGNTGTGTACAAAGGTCGTCACAAAGCAACTGGNCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGNGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTNNNNNNCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGNTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGNAGATTTTGGGCTAGCCAGAGCTTTCGGNATTCCAGTTCGGGNTTACACACATGAGGNAGTGACATTATGGTACAGAGCCCCAGAAGNGCTGTTGGGGTCAGTCCGATATTCCACGCCGGNTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGANTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGNTCTTCAGGATATTCAGAGCTTTGGGANNACCCAACAATGAGGTGNGGCCAGAAGNAGAATCTTTACNNATNCAAGAACTCATT
  5   1   2       bld Emb3 5g                         IMAGE:3398831.5p                                                                                                                                            GCTCATGAATCCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCATTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGACAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACACAGCCCCAGAAGTGCTGTTGGGGTCAAGCCGAATTTTCACGCCCGGTTGATTTTGGAACATATGAACCCATTTTGCTAGATTGCCACAAATAATCTCTTCTGCACGGTGATTCTGGACATGACA
  5   1   2       bld Tbd7      in                         XL086g08.5p                                                                                                                                            GGGGGAATCCAGCCTTGGGNAAACAGCCATGGNACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCGCTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATT
  5   1   2       bld DMZ  5g3  in                         xl294g01.5p                                                                                                                                               GGGGAATCCAGCCTTGGGAAACAGCCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCGCTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATTGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGGGACTCTGAAATTGACCAGCTCTTCAGGAT
  5   1   2       bld Lmb1 5g                         IMAGE:8533785.5p                                                                                                                                                  GGAATCAGCCTTGGGAAACAGTCATGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACAGCTCTTCAGGATATCAGAGCTTTGGGACACCNNNACATGAGTGTGGCAGAAGTAGATCTTTTACAGATACAGACTCATCCCCAATGGAAGGGGGAGCTGTCGCGACGTGAAATATCATAGATGCTGACTCTGCTAATGTATCAGACTGCAGAATTCGCCTAGCTGCGACTATCA
  5   1   2       bld Tbd7      in                         XL106p16.5p                                                                                                                                                             GGGGAAACAGCCTGGNACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCGCTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGC
  5   1   2       bld Ga12      in                         XL177g18.5p                                                                                                                                                              TGGGAAACAGCCTGGACGAGTACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATCCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCGCTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCCATACCCAGCGGCCAGTATATCGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTCCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAG
  5   1   2       bld Emb4                   IMAGE:5542421-IMAGp.IMAGp                                                                                                                                                                                  TACACTAAAATAGAAAAGATCGGAGAGGGCACATATGGGGTTGTGTACAAAGGTCGTCACAAAGCAACTGGCCAGGTTGTTGCAATGAAGAAAATTCGATTGGAAAACGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCTAACATAGTTTGTCTCCTAGATGTCCTCATGCAAGATTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCTCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAAC
  3   1   2       bld Ga18 5g3  in                      xlk139k19ex.3p                                                                                                                                                                                                                                                     CACNAANNANNGNNNGTNTNCAATGANGAAAATTCGNTNGNAACNANNGNANNNNTCCNAAGTACAGNAATCCGANGNAATATCNCTNCTNAANNNNTTCAGNACCCTANCATAGTTTNTCTCCTAGANNNNCTCATNNAGATTCAAGGTTGTATCTTATCTTTGANTTTCTCTCCATGGATCTAAAGAAGTATTTGGACTCCATACCCAGCGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATNCCAGATCCTACAAGNCATTGTATTTTNCCACTCCAGNAGAGTGCTACACAGAGNCCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTANCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTANNNNNTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATNCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATNNNNCTCCACACTG
  3   1   2       bld Ga15      in                       XL508c05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGCCAGTATATAGATACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTATTGTCTGTATGTGATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACA
  3   1   2       bld DMZ  5g3  in                         xl318p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACGATGCTCGTTAAGAGTTACCTATACCAGATCCTACAAGGGCATTGTATTTTGCCACTCCAGAAGAGTGCTACACAGAGACCTGAAACCGCAGAACCTGCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTAGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTNTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTGCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATC
  5  -1   2       bld Bla2                            IMAGE:7299550.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCGTTGAGGTGTAGTCTACGATCTCAGCTGATTGCATCGAGATTCACGGACTGACTCAGACTGTCTGCAGCAGGATGATANGTGCAGATTNGGCTGCAGAGTTCGCATTCCAGTCGGGTTACACACTGAGGTAGTGACATTATGTACAAGCCCCAGAAGTGCTGTTGGGTCAGTCCGATATTCCACGCCGGTTGATGTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTTTGAAATTGACCAGCTCTTCAGGATATTTAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACCCAGAGCGTAATTTCTGTATGGGAATCTTGATGTAAATCACTTTCttttttttttATTGTCTGTATGTGATATATATATGGGGGTGTGTTTGTCTCGTCGTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAAGCTTTATTGTATATTGCTGGaaaaaaaaaaaaaaaaaaaaaaaaaaNAACTCGAGGGGGGCCCGTACCCACTCGCCTATGAGAT
  3   1   2       bld DMZ  5g3  in                         xl261e19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGTTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCA
  3   1   2       bld DMZ  5g3  in                         xl294g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCATCGACAGCAAGGGAGTGATAAAGTTGGCAGATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGGGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTC
  5   1   2       bld Skin                            IMAGE:8644244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTTTGGGCTTGCCAGAGCTTTCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACACAGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTttttttattgtctgtatgtgatatatatatgtgtgtgtgtttgtcttgtCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCCCACACTCTAATGTAATATGGACTTGCCAAACTGTGTATAGATGCATCTCCACCTGACTTTCATTCCATAAGCTTATTGTTATGCTGaaaaaaaaaaaaaaaaaaaGGGCGCGCAAGCTGAATTCTGACGCGCTCAGCCTCGCTTATGGCGATACTTATCGACTGAAATCATGTGGTTGCACCACTGATCTGAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8327912.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGGCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCTTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATGAAAAAAAAAAAAAAAG
  3   1   2       bld Ga12 5g3  in                         XL157d20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCATTCCAGTTCGGGTTTACACACATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACGACATTTCATTTCCAATAAAG
  3   1   2       bld Tbd7      in                         XL086g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAANAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTTAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAANAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACACAGAGCGTAATTTCTGTATGGGAATCTTGATGTAAATCNCTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATATATATGTGTGTGTGTTTGTCTCGTCGTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGNCNTTATTGTATATGC
  3   1   2       bld Ga15                               XL442h22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCNCGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCNCAAAGAAACCCCTCTTCCNCGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTTAGAGCTTTGGGAACNCCCNACAANGAGGTGTGGCCNGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGANGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCNGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCNCCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACNCNCAGAGCGTAATTTCTGTATGGGAATCTTGATGTAAATCNCTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATATATATGTGTGTGTGTTTGTCTCGTCGTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGGTAGTGACATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGAAAAAAAAAAAAAAAAG
  3   1   2       bld Ga15 5g3  in                       XL420g21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTATGGTACAGAGCCCCAGAAGTGCTGTTGGGGTCAGTCCGATATTTTACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCNCAAAGAAACCCCTNTTCCNCGGGGACTNTGAAATTGACCAGCTNTTCAGGATATTCAGAGCTTTGGGAACNCCCAACAATGAGGNGNGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGNGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATNTATGATCCAGCCAAGAGAATTTCCGCNCGTAAAGCTTTGCTGCNCCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACNCATCGAGNGTAGTTTNTGTATGGGAATNTTGATGTAAATCNCTTTNTTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTCATCCAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328986.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTCCACGCCGGTTGATGTTTGGAGCATAGGAACCATTTTTGTTGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGGAAAAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tbd7      in                         XL065g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCCACAAANAAACCCCTCTTCCACGGTGACTNTGAAATTGACCAGCTNTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAATGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAANAGAATTTCTGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACNCCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCNCTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACNACATTTCATTTCCAATAAAG
  3   1   2       bld Emb4 5g3  in                    IMAGE:4201815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTGATGTTTGGAGCATAGGAACCATTTTTGCTGAGATTGCACAAAAAACCCTCTTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTCTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTTTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGAAAAAAAAA
  3   1   2       bld Ga12      in                         XL177g18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTTTGGAGCATAGGAACCATTTTTGCGGAGATTGCCACAAAGAAACCCCTCTTCCACGGTGACTNTGAAATTGACCAGCTCTTCAGGATATTTAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCANAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAANAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACACAGAGCGTAATTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCGTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCNCCACACTCNAGATGTAAATATGGAGCTTGCCAAACTTGTGTATAGATGCATGCTCCACACNCACATTTCATTTCCCAATAAAG
  3   1   2       bld Ov1                             IMAGE:5048542.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATGT
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074708.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGAAA
  5  -1   2       bld Ov1       out                   IMAGE:5074195.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAATTGACCAGCTCTTCAGGATATTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTATtgtctgtatgtgatatatatatgtgtgtgtgtttgtCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTaaaaaaaaaaaaaaaGGGCGGCCCTCGGATCTAACGGACGCGTGG
  3   1   2       bld Emb4      out                   IMAGE:4203129.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCAGAGCTTTGGGAACACCCAACAATGAGGTGTGGCCAGAAGTAGAATCTTTCCAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCAGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTCTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGAA
  3   1   2       bld Tbd7      in                         XL106p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTACAAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACNTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACNCAGAGCGTAATTTCTGTATGGGAATCTTGATGTAAATCNCTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATATATATGTGTGTGTGTTTGTCTCGTCGTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTNACATTTCATTTCCAATAAAG
  5   1   2       bld Egg1                               PBX0074G10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGATTACAAGAACTCATTCCCCAAATGGAAAGGGGGGAGCTTGTCGGCGAACGTGAAAAATATCGATAAGGATGGGCTGGACCTACTGGCTAAAATGCTAATCTATGATCCTGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACACAGAGCGTAGTTTCTTTTGGGTTTCTGTATGGGAATCTTGATGTAAATCactttctttttttattgtctgtatgtgatatatatatgtgtgtgtgtttgtcttgtCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCA
  3   1   2       bld Ga15      out                      XL495g15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGNGAACGNGAAAAATATCGATAAGGATGGGCTGGNCCTACTGGCTAAAATGCTAATCTATGATCCNGCCAAGAGAATTTCCGCACGTAAAGCTTTGCTGCNCCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACNCNTCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCNCTTTCTTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACT
  3   1   2       add Tbd7 5g3  in                         XL108f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAAAANAATTTCCGCACGTAAANCTTTNCTGCNCCCCNACTTCGATNATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTANAAACTAACNCATCGAGNGTAGTTTCTGTATGGGAATCTTGATGTAAATCNCTTTTTTTTTTTTTATTGTCTGTATGTGATATATATATGTGTGTGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCGCCACACTCTAATGTAAATATGGACGTGCCAAACTTGTGNATAGATGCATACTCCACACTGCACATTTCATTTCCCAATAAA
  3   1   2       bld Tbd4                            IMAGE:4059946.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCCGCACGTAAAGTTTTGCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTCTTTTTTTTTTATTGTCTGTATGTGATATATATATATGTGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTGAAAAAAAAAAAAAAAAAAAAGCGCCGCGTCGAGCCTCTAGAACTATAGTGA
  3   1   2       bld Neu1 5g3  in                       Neu1-17B10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CGTAAAGCTTTGCCTGCACCCCTACTTCGATGATTTGGATAAGTCCAGCCTTCCTGACAATCAGATTAGAAACTAACACATCGAGCGTAGTTTCTGTATGGGAATCTTGATGTAAATCACTTTTTTTTTTTTTTATTGTCTGTATGTGATATATATGTGTGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTTCATTTCCAATAAAGCTTTATTGTATATTGCTG
  3   1   2       bld Ga15                               XL425o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGTGTTTGTCTCGTCTTCTGCTGCTGATATTGCTGCACCCTAAGTACTTATATATGCACCACACTCTAATGTAAATATGGACTTGCCAAACTTGTGTATAGATGCATCTCCACACTGACATTCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)