Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:7008365.5                       5 END     2           5       40                selenoprotein W, 2b [Danio rerio]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL410o20ex.3                         42 PI      89         32      169                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6324439.5                      31 PI      87          1      170                (no blast hit)
     4   0.0    0Xl3.1-XL427j08ex.3                         24 PI      85          1      169                (no blast hit)
     5   0.0    0Xl3.1-XL104d11.5                           18 PI      85          3      168                (no blast hit)
     6   0.0    0Xl3.1-XL069m15.5.5                          8 PI      85          1      169                (no blast hit)
     7   0.0    0Xl3.1-XL056g24.5                            5 PI      86          1      167                (no blast hit)
     8   0.0    0Xl3.1-XL091c07.5                            2 PI      86          1      151                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012768379 Xl3.1-XL426h07ex.5 - 40 ESTs
                                                                       ...-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL426h07ex.5                                                      CTGCTGCATGGGGAGAGAGTGTGGAGAGGCGGATGCTGAGAGAGGTATGGTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGGAAACTTCTTATTTCAGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTGTAAATTTATTAAAGGCTGTTTTTACTCCAAAAAA
                                                  Xl3.1-CHK-1012687176                                                            CATGGGGAGAGAGTGTGGAGAGGCGGATGCTGAGAGAGGTATGGTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGGAAACTTCTTxTTTCxGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTGTAAATTTATTAAAGGCTGTTTTTACTCC
                                                      consensus depths                                                           6     8     5     8     4     8     6     8     7     8     8     9     6     9     8    10     8    10     4    11     8    12     9    13    11    13    11    13    11    13    14    16    14    17    16    20    19    23    20    24    20    24    20    24    21    25    21    26    21    26    25    31    25    32    26    34    26    35    32    35    32    35    32    35    33    35    32    35    33    35    34    35    34    35    34    34    34    34    35    35    34    34    33    33    33    33    33    33    32    32    31    31    31    31    31    31    30    31    28    28    28    29    28    29    27    28    25    27    24    27    26    27    24    26    24    26    23    26    23    25    22    24    22    24    20    22    20    22    19    21    18    20    17    19    17    19    16    18    16    18    16    18    15    18    15    18    14    16    11    14    10    11     6     6     3     3     3     3
                                                                   SNP                                                                                                                                                                              ---G--------
                                                                   SNP                                                                                                                                                                                                                                          CC----------
                                                                   SNP                                                                                                                                                                                                                                                                                          ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------C--
  5   1   2       bld Ov1       in                    IMAGE:5049408.5p CCACGCGTCCGGGCTGTCGGTGGGTGTCTGGCACCCGGCTGCTGCATGGGGAGAGGGTGGAGAGGGGCGGACGCTGAGAGAGGAATGGTGAACATAGACTTGATTGTTTCGGAGGTGCTAATGAATGTTTGATTGATTGTGTTTGGAGATGTCTTGTTTCAGTGTGCTGAAGCTTATATTTGATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCATCAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCTGCATTAACTCCTgagagagagagagagagagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACTCTGCGTTTGGATTTAGACATTATTATATTTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTA
  5   1   2       bld Ga12      in                         XL159d15.5p                              GGTCGGTGAGTATCTGGCACCCGGCTGCTGCATGGGGAGAGAGTGTGGAGAGGCGGATGCTGAGAGAGGTATGGTGAAGATAAACTTGATTATTTCAGAGACAGTACAGAATGTTTAATTGATTGTATTTAGGAAACTTCTTGTTTCGGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGG
  5   1   2       bld Ga12      in                         XL157i23.5p                                          GCTGGCGCCCGGCTGCTGCATGGGGAGAGAGTGTGGAGGGGCGGATGCTGAGAGAGGTATGGTGAAGATAAACTTGATTGTTTCAGAAACGGTACAGAATATTTAGTTGATTGTATTTGGAAGACTTCTTGTTTCGGTGTGCTGAAGCTTATGTTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGG
  5   1   2       bld Ga15                               XL426h07ex.5p                                           CTGGCGCCCAGCTGCTGCATGGGGAGAGAGTGTGGAGAAACGGATGCTGAGAGAGGTATAGTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGAAAACTTCTTATTTCAGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGAC
  5   1   2       bld Ga12      in                         XL144h04.5p                                            GGGCACCCAGCTGCTGCATGGGGAGGGAGTGGAGAGAGGCAGATGCTGAGAGAGGAATGGTGAAGATAAACTTGATTATTTCAGAAACTGTACAGAATATTTAATTGATTGTATTTAGGAAACTTCTTATTTCAGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACAACAGCTCTTGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTCCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGA
  5   1   2       bld Ga12      in                         XL205h12.5p                                             GGCACCCAGCTGCTGCATGGGGAGGGAGTGGAGAGAGGCAGATGCTGAGAGAGGAATGGTGAAGATAAACTTGATTATTTCAGAAACTGTACAGAATATTTAATTGATTGTATTTAGGAAACTTCTTATTTCAGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACAACAGCTCTTGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTCCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGGTGCACATA
  5   1   2       bld Ga12      in                         XL213m18.5p                                             CGAGGCCGGCTGCTGCATGGGGAGAGGGTGTGGAGAGGCGGATGCTGAGAGAGGTATGGTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGAAAACTTCTTGTTTCGGTGTGCTGAGGCTTATATTGCATTTTCGTGATGGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTANGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGG
  5   1   2       bld Tbd7                                 XL100b23.5p                                                CCCAGCTGCTGCATGGGGAGAGAGTGTAGAGAGACAGATGCTGAGNAGAGGTATAGTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGAAAACTTCTTATTTCAGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAG
  5   1   2       bld Egg1                               PBX0109F05.5p                                                                                                       GTGAAGATAAACTTGATTATTTCAGAAACAGTACAGAATATTTAATTGATTGTATTTAGGAGACTTCTTGTTTCGGTGTGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAAACTGCTT
  5   1   2       bld Ga12                                 XL141g13.5p                                                                                                                               GAAACAGTACAGAATATTTAATTGATTGTGTTTAGAAAACTTCTTGTTTCGGTATGCTGAAGCTTATGTTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTT
  5   1   2       bld Ga12      in                         XL149h07.5p                                                                                                                                                          ATTTAGNAAGNACTTCTTGTTTCGGTATGCTGAAGCTTATATTGCATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGT
  5   1   2       bld Ga12      in                         XL196h08.5p                                                                                                                                                                     ACTTCTTATTTCGGTATGCTGAAGCTTATATTACATTTTCGTGATAGTTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCT
  3   1   2       bld Te2       out                   IMAGE:7206993.3p                                                                                                                                                                                     TTGCACTGTGCTCCTCTCCCCTTTAAGCCCCAGCAGCATCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCATCAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCTGCATTAACTCCTGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATATTTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTAGTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATAGGATGGAAACAGTGCGACACTGTAAATTATTAAAA
  5   1   2       bld Ooc2                            IMAGE:3745176.5p                                                                                                                                                                                                                                   AGGAATTCCCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACT
  5   1   2       bld Ooc2                            IMAGE:3745104.5p                                                                                                                                                                                                                                    GGAATTCCCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTATGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGAT
  5   1   2       bld Ooc2                            IMAGE:3745200.5p                                                                                                                                                                                                                                    GGAATTCCCTCCCTTCTGTGATCTTTAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGC
  3   1   2       add DMZ       out                        xl226l08.3p                                                                                                                                                                                                                                                   AAAAAAAGGGGGGGGGGCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTTGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGATCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCTGCATTAACTTCTGCGAGAGAGAGGGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATATTTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTC
  3   1   2       add DMZ       out                        xl320m12.3p                                                                                                                                                                                                                                                          GGGGGGGGGGCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTTGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGATCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCTGCATTAACTTCTGCGAGAGAGAGGGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATATTTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTC
  3   1   2       chi Ga12      in                         XL205h12.3p                                                                                                                                                                                                                                                           TTTAACCCCAACTCCCAGAATTCTTGAAGAGAACAACAGCTCTTGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTCCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTG
  3   1   2      seed Ga12      in                         XL213m18.3p                                                                                                                                                                                                                                                             TAACCCCAACTCCCAGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACAC
  5   1   2       bld Ga12      in                         XL187d23.5p                                                                                                                                                                                                                                                                           AGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGAC
  3   1   2       bld Ga12      in                         XL217j11.3p                                                                                                                                                                                                                                                                           GGAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTG
  5   1   2       bld Ga12      in                         XL217j11.5p                                                                                                                                                                                                                                                                            GAATTCTTGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACNCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACA
  3   1   2       bld Ga12      in                         XL187d23.3p                                                                                                                                                                                                                                                                                  TNGAAGAGAACATCAGCTCTCGTCTGTCTGAGGATGTTGGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTGTAAATTTATTAAAGGCTGTTTTTACTCCAAAGAAAGAAA
  3   1   2       bld Ga12      in                         XL196h08.3p                                                                                                                                                                                                                                                                                                                        GGAAGGTGCAGTTCAGCAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACAC
  5   1   2       bld Ga12      in                         XL149l22.5p                                                                                                                                                                                                                                                                                                                                         ACAACAGGTCTGTTTAACCCCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTgagagagagagagaCCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTNAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTANCANANAAACGCTGCTCCTCTAGTTTCCTCCATCTTGNTGCACATAAAACTNCACACANCACTATGAATT
  3   1   2       bld Ga12                                 XL160n07.3p                                                                                                                                                                                                                                                                                                                                                           CTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTAGGGANGAAACAGTGCGACACTG
  3   1   2       bld Ga12      in                         XL149l22.3p                                                                                                                                                                                                                                                                                                                                                            CCTTCTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGA
  3   1   2       bld Ga12      in                         XL144h04.3p                                                                                                                                                                                                                                                                                                                                                              CTTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCNTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTCCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTTATGAATTTACTGTATGAGACAAAATAACATATTGAAGTG
  3   1   2       bld Ga12                                 XL157h22.3p                                                                                                                                                                                                                                                                                                                                                               TTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTNC
  3   1   2       bld Ga12      in                         XL157i23.3p                                                                                                                                                                                                                                                                                                                                                               TTCAAAACCGCCATTTTTCTTTTATCTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTANCCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGNATGTATTTTTCCTATGGGAGGAAACAGTGCGACACTGTAAATTTATTAAAG
  3   1   2       bld Ga12                                 XL197g09.3p                                                                                                                                                                                                                                                                                                                                                                              TTCTTTTATGTGGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGGGTGCGTTTGGACTGAGACATTATTATAATTGGCACANTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCANTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTNGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGCGAGTGTAAATGTGTAAGAATGTATT
  3   1   2       bld Ga12      in                         XL159d15.3p                                                                                                                                                                                                                                                                                                                                                                                       CTGGATCCGCATTAACTCCTGAGAGAAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCNACCTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGNACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGAGGAAACAGTGCGACACTGTAAATTTATTAAAG
  3   1   2       bld Ga12                                 XL197h08.3p                                                                                                                                                                                                                                                                                                                                                                                          GGATCCGCATTAACTCCTGAGAGAGAGAGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATTATAATTGGCACATTGTTCATATTGACATTAAATCCCTCAACTCTTTGCCCCGTGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACAC
  3   1   2       add Ga15                               XL434b02ex.3p                                                                                                                                                                                                                                                                                                                                                                                            GNGCATTAACTTCTGNGAGAGAGAGGGAGAGACCCCCGTGTGAGTATGAGGCTGACGCTGCGTTTGGATTGAGACATTATATTTGGCACATTGTTCATATTGACATTAAATCCCTCAAT
  3   1   2       bld Ga15                               XL447f24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTTCCTGTGACGCGGCAACTGCTTGATATATAAACGCTGTTACATTTATTGCACTGGGGATCCCCCAGGAACCAGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTATTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAA
  3   1   2       bld Ov1       in                    IMAGE:5049408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTAAAAAATACCAGTTTGCCCAGGAACTGCTCCATCTTAGTCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATAGGATGGAAACAGTGCGACACTGTAAATTTATTAAAGGCTGTTTTTACTCCAAAAAAAAAAAAAAAG
  3   1   2       bld Ga18      in                        xlk3i05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCTGTAGGAAACGCGGAGGCAAAGATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGTAGCAGAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACANNNGACAC
  5   1   2       bld Ga18      in                        xlk3i05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTCCCCTTCGTGCCAAGTTTCACAAGCGATTTTCCACTTTACGCGNNNNAGAAACGCTGCTCCTCTAGTTTCCTCCATCTTGTTGCACATAAAACTTCACACAACACTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGATCACCTTGCGAGGTACCGGATCACTAGCCGCCATATTGGNTGGTAACCGAGATGCGACTGTAGAGCCGAGTGTGAGTGTAAATGTGTAAGAATGTATTTTTCTATGGGATGGAAACAGTGCGACACTGTAAATTTATTAAAGGCTGTTTTTACTCCaaaaaaaaaa
  3   1   2       add Ga12      in                         XL149h07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCNTGTTGCNCCCCCCNCTTCACACANCNCTATGAATTTACTGTATGAGACAAAATAACATATTGTCACTCGGGCTCTATTGAAGTGAATTTCTGGGTGACGACAAGNTCACCTTGCGAGGNACCGGATCAAAAGCCGCCATATTGGCTGGTAACCGAGATGCGACTGTAGANCCGAGTGTGNAGTGTCCCCGAGAAAAGAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)