Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7206654.5.5                    48 PI      92         84      685                (no blast hit)

 This cluster: approximate FL confidence score = 86%

 1012768397 Xl3.1-xl327i15.5 - 46 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl327i15.5 GCAGCTTGTTCCCAGGCATCAACCGGAAGCGGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGCCCCCCCTCCCCTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACAATTAAAATTCTT
                                                  Xl3.1-CHK-1012686856       TGTTCCCAGGCATCAACCGGAAGCGGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGCCCCCCCTCCCCTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTCTxxxAxxATTAAAxTxxTxCTTGTC
                                                      consensus depths      2     2     2     3     3     3     5     7     9    11    16    16    17    18    19    21    22    22    22    23    22    23    25    25    25    25    25    25    25    25    25    25    24    24    24    24    24    24    25    25    24    24    25    25    25    25    25    25    24    24    24    24    24    24    24    24    24    24    24    24    25    26    25    26    25    26    25    26    25    27    25    27    25    28    25    28    26    29    26    29    28    30    28    30    28    30    28    31    28    32    29    33    29    33    29    33    28    32    27    31    26    31    26    30    27    31    25    29    25    29    25    29    23    29    22    29    23    30    22    31    22    31    20    29    19    28    20    30    20    29    15    26    18    27    18    25    18    26    18    24    15    22    18    22    20    23    20    23    20    22    20    22    20    21    20    21    20    21    20    21    20    21    20    21    20    20    18    20    20    20    20    20    20    20    20    20    19    20    12    20    12    20    12    20    12    20    12    20    12    20    12    20    11    19     9    19     9    19     9    19     9    19     9    19     9    18     8    16     6    13     4    12     2    11     3     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCATCTGCGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCCCTGACTCATCCTACAAGGAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAACAAACTCT
                                                                   SNP                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                               BLH ATG     104     329 
                                               BLH MIN      74      53 
                                               BLH MPR      65      53 
                                               BLH OVR     104      17 
                                               EST CLI      30      12 
                                               ORF LNG     104       1 
  5   1   2       bld DMZ  5g3  in                         xl269b14.5p GCAGCTTGTTCCCAGGCATCAACCGGAAGCGGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGT
  5   1   2      seed DMZ  5g3  in                         xl327i15.5p GCAGCTTGTTCCCAGGCATCAACCGGAAGCGGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCC
  5   1   2       bld Brn1 5x3                        IMAGE:6949854.5p     GTCCGGAATTCCCGGGATCCGGAAGCGGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGGCAGTGAGTCCATATTATTCCCACCAATGGCAAATCTAGATTTGTCCCCTTAGAATTTAACTTCTCTCTTTGTCCCGGAAAGAATGGGAGGGGCAGAT
  5   1   2       bld Emb1 5x3                        IMAGE:6632338.5p                             CCACGCGTCCGCCCACGCGTCCGGGATTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAA
  5   1   2       bld Brn1 5x3                        IMAGE:6951085.5p                               GGAAGTCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGGGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCTCCTCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTACATTTAACTCTCGCTTTGTCACTGAC
  5   1   2       bld Sp1  5g3  in                    IMAGE:4968776.5p                                  GATATCGTCGACCCACGCGTCCGCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6880258.5p                                  GGGCTCGCTGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCATTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAAGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTTCCCCTCCATCTTTTTTTATCCTTAGAGATTTCTTTAAATATTGGTCTTAGCTCCGGAATCANTCAACCCTCCTCCCCCCGCCACCTTTGGTTACAGTCCTGGGATGTCTGCCCCTGGCCATTTAACCAGCACTTATTTTGCAGCACTTATTGGCCCAGACCCTTACAGCCTGGTTACTT
  5   1   2       bld Tad1 5g3  in                    IMAGE:6879507.5p                                         GGGAGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGGCTTTTGCTCTGGAATCACTCANCCCTCCTccccccccTGCCACCCTTGGTACAGTTCCGGGATGTCTGTACCGGCCATTAGCAGCACTAATTTGCAGCACTATTTGCCCTGAACCCTTCGGCTGTGG
  5   1   2       bld Tad1 5x3                        IMAGE:6878464.5p                                          GGGGGACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCTGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGANTCACTCAACCTCCTCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTAATTGCAGCACTATTTGCCCCAAACCTTACAAGCTGTGGACTAATTACCGCCCCCCTGCCAGGTGGAGC
  5   1   2       bld Ov1  5x3                        IMAGE:8329601.5p                                              GACTGCGGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCGCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGC
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532011.5p                                                 TGCGGGTTCCTCCGGTCATGTGATTAGTTCGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTACCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGGGCTTCTCTTGGACTCACGCAGTGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCAccccctcccccccGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGC
  5   1   2       bld Tbd1 5x3                             AW765396.5p                                                    GGGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCGCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTA
  5   1   2       bld Emb1 5x3               IMAGE:6632338-IMAGp.IMAGp                                                    GGATTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCAC
  5   1   2       bld Spl  5x3                        IMAGE:8461747.5p                                                     GGTTCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTACCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGGGCTTCTCTTGGACTCACGCAGTGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCNAcccctcccccccGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTACAGCTGTGACTATACGCCCCTGCAGCGAGTCATATATTCCACCATGCAATCTTATTGTCCTA
  5   1   2       bld Emb4 5x3                        IMAGE:4679902.5p                                                        TCCTCCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCAC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075702.5p                                                            CCGGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCCTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCACCAATGCAAAC
  5   1   2       bld DMZ  5g3  in                         xl228g17.5p                                                              GGTCATGTGATTAGTTGGCTCGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACC
  5   1   2       bld Te2  5x3                        IMAGE:7211492.5p                                                                      GGTTCCGGGAATTNNCCCGGGATGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTGCCACAATGCGAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGGAGGATTGAAGGGCAGACTTTACACATTTTTGGGGGTCTGGTGCTTCTGTACAAAACGCAGGGCTTCCTATAAATTAACAATAAACGTCCTGGTTTTCTTTAAACCT
  5   1   2       bld Brn1 5g3  in                    IMAGE:4740894.5p                                                                                  CGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTACCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGGGCT
  5   1   2       bld FaBN 5x3                        IMAGE:8078597.5p                                                                                  CGGCTGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCACACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTG
  5   1   2       bld Tbd7 5g3  in                         XL080h14.5p                                                                                    GAGGGTCCCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCCTGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCC
  5   1   2       bld Te2N 5x3                        IMAGE:7767726.5p                                                                                           CCGTTCTGTCGGACATGGGCTGTTGTTACAGCGGAGAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCT
  5   1   2       bld Neu7 5g3  in                         XL013a05.5p                                                                                                  GCGGACATGGGCTGTTGTTACAGCGGAGNAGACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGC
  5   1   0       chi Tbd7      in                         XL088i01.5p                                                                                                                                 ACCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACANTAAACANAATGGATCAGAACAGAACCCNACAAATAACCCCTNGGNTCGCACTGATGAACAGGCCCTGCTCTCCCGCATATTGGCCAAGACCGCGCANTGAGTATTGNGCCCCCGGCACGGCTGCTTCACTTGCAATGGGGGGGCCCAGAGGTGCAGCAATGTCT
  5   1   2       bld Ga12      in                         XL197e11.5p                                                                                                                                  CCGACACCGGCAAAGGGGATCAGGGAGAGAGGGAACATCTGCTGCCCCAAAACCAATCTCTTCCCAACAATAAACAGAATGGATCAGAACAGAACCCCACAAATAACCCCTCGGCTCGCACTGATGAACAGGCCATGCTCTCCCGCATATTGGCCAAGACCGCGCAGAACATTATTGATGTGTCAGCGGTGGAGTCACAGGGGATGGAGCAGCACGAATGTATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCTCCTCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCAGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTA
  5   1   2       bld Ooc2                            IMAGE:3746573.5p                                                                                                                                                                                                                                                                                                                                                              TATGGACAGAGCCCGGCAGTACAGCACGAGGCTGGCAAAACTCAGCAGCAATTTGATGGACTGGAAGAACGTGccccccctccccTCACTGACCTCTCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCTCCTCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTAT
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532011.3p                                                                                                                                                                                                                                                                                                                                                                      GTATGCGAGACCAGAGCCTGCAGCTACAGCAGCCGATGCCAACTCAGCAAGCATTGCATCGATCGGAGACCGTGCCCCCCCTCCCTCACTGACCTTTCAGCGCACCAAATACTCGCCAGTGACCTGTCCCTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCGGGATGCACTTGGGCTTCTCTTGGACTCACGCAGTGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCCCTCCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGCGAGTCCATATTATTCCCACCAATGCAAATCTATATTTGTCACTTACATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGAGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACTTAAACCAACTCTATTCGGCTTCTTCTTTATACAAATGTGAGAAATGCTCTTAGACACCTAAAAA
  3   1   2       bld Tad1 5g3  in                    IMAGE:6879507.3p                                                                                                                                                                                                                                                                                                                                                                                                               TTGGCCGGAAGGAAAGTGCCCCCCCTTCCCCTTAAATGACCTTTTCAGCCGCCACCAAATATTCGCCCAGTGACCCTTTTCCCTTTTACAGACATACAGCCGGTGTTTAAGATCGCTGCTTACGCTTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGTTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGTACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGCTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCACACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTTGTATTGGATT
  3   1   2       bld Tad1 5g3  in                    IMAGE:6880258.3p                                                                                                                                                                                                                                                                                                                                                                                                                                      GACGTGCCCCCCTTCCCTTAATTGACTTTTCAGCCGCACCAAATACTTGCCAGTGACCCTTTTCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGATCCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCNTCCATCTTTTTTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCTCCTCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCAGACCTTACAGCTGTGACTATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTACATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGGCACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAAATGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGCATCTGCGCAGAGAAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACTTTAAACAAACTCTATTCGGTT
  5   1   2       bld Brn1                            IMAGE:6956490.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCAGCCGCACCAAATACTCGCCAGTGACCCTGTTCCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTccccccccTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGGAAATCTCTGTAACATTAAAAATTTCTTACTTGTC
  3   1   2       bld DMZ  5g3  in                         xl327i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCTTTACAGACATACAGCAGGTGTCTAAGATCGCTGCTTACGCCTTCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAAT
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACAACAAAGCAGTGTTAGATCGTGCTACGCTTCATGCGTCTCACAGATAGAGGGATGCAAAGGGATTTAGTGTACAGTTGGGATCCCGTACCCCCGGATGCACTTGTCTTCTCTTGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTNTTNGNTNNGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTATACAAAGGGGAAANNCNCGNATAGTACTTATCCTTT
  3   1   2       bld Ga12      in                         XL197e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAGTGCGCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTAGCTCTGGACTCACTCACCCCTCCTCCCCCCGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCAGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTACATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGGCACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAAATGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGCATCTGCGCAGAGAAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACTTTAAACAAACTCTATTCGGTTTCTTTTTTATATAAATTGTGGGAAATCTC
  3   1   2       bld DMZ  5g3  in                         xl228g17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTCTCACAGATACGAGTGGATGCAAAAGAGGATTTAGTTGTACAGTTTGGGATCCCGTAACCCCCGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCATTGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGGCATCTGCGCAGAGGAATGGGGGTGCCCTGACTCATGCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTT
  3   1   2       bld Tbd7 5g3  in                         XL080h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGATGCACTTGTGCTTCTCTTGGACTCACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTACTCNATTTCTTTTTTATATACAATTGTGGGAAATTCTCCGNAACATTAAA
  3   1   2       bld DMZ  5g3  in                         xl269b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGCAGCGTCGCCTCCATCTTTATTTATCTTTAGAGATTTCTTTATATATTGTCTTTGCTCTGGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATT
  3   1   2       bld Tbd7                                 XL087i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATCACTCACCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAAAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTACAGTAACATTAAAATTCTT
  3   1   2       bld Neu7 5g3  in                         XL013a05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCTCCTCCCCCCCCTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCATTGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGGCATCTGCGCAGAGGAATGGGGGTGCCCTGACTCATGCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTNGGAAATCTCTGTAACATTAAAATTCTTA
  3   1   2       chi Sp1                             IMAGE:4969196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCCCCTTGCCACCTTGGTACAGTCCTGGATGTCTGCACTGGCCATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACCTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTTCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTACATTTAACTCTCGCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCATATATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGCGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAATGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACATTAAAATTCTTACTTGTCTC
  3   1   2       bld Tbd7                                 XL089l01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CATTAGCAGCACTATTTGCAGCACTATTTGCCCTGACNTTACAGCTGTGANTAATACGCCCCNTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATNTAGATTTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCG
  3   1   2       bld Tbd7      in                         XL088i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTAGCAGCACTATTTNCAGCACTATTTGCCCTGACNTTACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTANCCCTTCATGGTCCCANNTGCCCTGCCAGTNCTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATNCAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAAAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTNCTTTTTTATATAAATTGTGGGAAATCCTCTGTAACATTAAAATT
  3   1   2       bld Tbd1                                 AW782493.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TACAGCTGTGACTAATACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACATTAAAATTCTTACTTGTCTCAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4968776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACGCCCCCTGCAGGTGAGTCCATATTATTCCCACCAATGCAAATCTAGATTTGTCACTTATATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCTTACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGTGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTCGATTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACATTAAAATTCTTACTTGTCTCAAAAAAAAAAAAAAAG
  3   1   2       bld Brn1 5g3  in                    IMAGE:4740894.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCCCCTGCAGGCGAGTCCATATTATTCCCACCAATGCAAATCTATATTTGTCACTTACATTTAACTCTCTCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTTCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGGCATCTGAGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACTTTAAACCAACTCTATTCGGTTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACATTAAAATTCTTACTTGTCTCAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL452f20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCCGCTTACATTTAACTCTCGCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGCATCTGCGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAAACAAACTCTATTTGGTTTCTTTTTTATATAAATTGTGGGAAATCTCTGTAACATTAAAATTCTTACTTGTCTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL452f20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTACATTTAACTCTCGCTTTGTCACTGAAGGATTGAGGGGCAGACTTGACACATTTGGGGGTCTGTGCTTCTGTACAACACGAGGCTCCCCTATAGTAACAATAACGTCCTGTTTCCTTAACCCTTCATGGTCCCAACTGCCCTGCCAGTACTTAGAGGAGGGAGTGAATGTGGCAGTGCCCAATTGTTGGCTCCTCATACAGCAGAGGATGTTATTGCCCCTAGGTGGTGCCATTACTAAGGGTTACCCTGGGGTGCCGCACACATGATCACACAAGGGGTAATGCTAATGGGTCGTGCGGGGGCATCTGCGCAGAGGAATGGGGGTGCCCTGACTCATCCTACAAGGAAAAAGATTTACATTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)