Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012768402 Xl3.1-XL448i09ex.5 - 78 ESTs
                                                                       .........-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL448i09ex.5                                                                                                                                                                                                                  CCGGGACTTAAACTTCTGTGCCAAAACGAGCATAGAGAAAGCTGTGTAGGAAAAGAACATGCAGATAGTATAACTCCCGCCCTTCTTTCTGAAATCTGCAGCTTATTAAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGAAAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTTCAAAAACCTAGTTCAGCGAAATCGTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAATGGGGAAAATAAACTGAT
                                                  Xl3.1-CHK-1012685878                                                                                                                                                                                                                        CTTAAACTTCTGTGCCAAAACGAGCATAGAGAAAGCTGTGTAGGAAAAGAACATGCAGATAGTATAACTCCCGCCCTTCTTTCTGAAATCTGCAGCxxxTxxAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGAAAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTTCAAAAACCTAGTTCAGCGAAATCGTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAATGGGGAAAATAAACTGATATCCTT
                                                      consensus depths                                                                                                                                                                                                                       2     2     3     3     3     3     3     5     3     5     3     7     3     8     4    10     4    12     6    16     7    18    12    20    20    23    28    32    28    33    31    34    32    35    34    37    37    40    38    40    36    40    35    40    35    38    36    38    36    38    35    38    37    38    36    38    38    38    38    38    38    38    37    38    36    39    40    40    40    40    37    40    39    40    40    40    39    40    40    40    40    40    37    38    37    39    37    39    37    39    36    36    36    36    33    36    31    38    35    37    34    36    32    34    31    33    30    33    30    33    31    33    27    29    28    29    28    28    24    25    24    24    22    22    16    17    14    15    14    15    13    14    11    11     9     9     6     7     6     7     6     8     6     9     6     9     6     9     5     8     3     9     4     9     5     9     6    10     6     9     8    11    10    11     9    11    12    13    11    13    10    13    10    13    13    14    15    15    15    15    16    17    19    21    20    22    23    24    23    25    24    25    26    28    26    28    25    28    26    29    29    29    27    29    24    29    29    29    24    29    28    29    27    29    26    29    27    28    24    28    26    28    26    29    28    29    26    30    27    30    26    30    25    29    24    29    22    29    24    29    22    30    25    30    22    28    23    29    22    29    22    29    24    29    22    26    21    25    19    24    17    22    14    22    14    22    14    21    14    21    12    19    11    19     7    17     6    14     5    12     3     5     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                      TAAGATAGGAGGCTAGGCGCCTGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                              ACAGCAGGGAGC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                          GGTGTCGTATTTGTCTTGTGCATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACTGATGTGTAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTGTTGAGATACAACTTCGGGAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                          -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                  -------T---A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                              -A---T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                          --T------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                      -C-G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --A--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---CA-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -G--G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----C-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T---C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                               BLH ATG     188    1174                                                                                                                                                                                                                  
                                               BLH MIN     176     291                                                                                                                                                                                                                  
                                               BLH OVR     188     566                                                                                                                                                                                                                  
                                               EST CLI     114       6                                                                                                                                                                                                                  
                                               ORF LNG     188      79                                                                                                                                                                                                                  
  5   1   2       bld Emb4 5g3  in                    IMAGE:5536732.5p CGCCTGCAGTTAACAGCTTTTATCGGGAGGTGTAAGTAGCGATGCGGGACTGCGGGCTGAATAAGGAAAAGCAGGGCTGTGGGGCAGTATGCGCTTACCTGCATTGTCGGGCCCCCTGCTGCCAGTGAGCTGCACACTTCGGAAGGGAGGGCGGGAGCTAAGGTTCAGTTTGAACTTCCCCCAAGCCTATCCAATCCCTATAGGCTTTACCGGGACTTAAACTTCTGTGCCAAAACGAGCATAGAGAAAGCTGTGTAGGAAAAGAACATGCAGATAGTATAACTCCCGCCCTTCTTTCTGAAATCTGCAGCTTATTAACAGCAGGGAGCCCGGGAATCCAAGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAATAAAAAAGGGTGAAAGAATGGCAAAGGCTTGCGTCATTTCTCATG
  5   1   2       bld DMZ  5g3  in                         xl331k01.5p                                                                                                                                                                                                                  CCGGGACTTAAACTTCTGTGCCAAAACGAGCATAGAGAAAGCTGTGTAGGAAAAGAACATGCAGATAGTATAACTCCCGCCCTTCTTTCTGAAATCTGCAGCTTATTAACAGCAGGGAGCCCGGGAATCCAAGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCANGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTA
  5   1   2       bld Ga15      in                       XL519p06ex.5p                                                                                                                                                                                                                           AAACTTCTGTGCCAAAACGAGCATAGAGAAAGCTGTGTAGGAAAAGAACATGCAGATAGTATAACTCCCGCCCTTCTTTCTGAAATCTGCAGCTTATTAACAGCAGTGAGCCCGGGAATCCAAGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaaa
  5   1   2       bld Gas5 5g                         IMAGE:3748932.5p                                                                                                                                                                                                                                                GTAGTCTTTGACGCCAGTCTCGCGCGAGGAGACATGCGGCGTTGGGATTTTGTATAAGATAGGAGGCTAGGCGCCTGCAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAGGTGAATAGAATGGCCAAGGCT
  5   1   2       bld Ga18      in                      xlk126c13ex.5p                                                                                                                                                                                                                                                TTNNNNNNGNTCGCNNNNNNACATGCGGCGGTGGGATTTTCTATAAGATAGAAGGCTAGNNGCCTNNAGTTAACAGCTTATTATTCGGGAGGTGTCGTATTTGTCTTGTGCATTTGGTGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGNCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGNTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGNCCTCATACACCTAATACACATTTTGTATCACAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGNCCTACAATGAAGTGGCTGATGAACTGGNTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCNAATGAATCTCAAGCATATGATCAGAA
  5   1   2       bld Tbd7 5g                              XL087b11.5p                                                                                                                                                                                                                                                                    CATGCGGCGGTGGGATTTTCTATAAGNATAGAAGGCTAGGCGCCTGCAGTTAACAGCTTATTATTCGGGAGGTGTCGTATTTGTCTTGTGCATTTGGTGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCGCAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAG
  5   1   2       bld Ga15 5g3  in                       XL498p24ex.5p                                                                                                                                                                                                                                                                         CGGCGGTGGGATTTTCTATAAGATAGAAGGCTAGGCGCCTGCAGTTAACAGCTTATTATTCGGGAGGTGTCGTATTTGTCTTGTGCATTTGGTGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCGCAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTT
  5   1   2       bld Neu7 5g3  in                         XL018n03.5p                                                                                                                                                                                                                                                                                    GTATAACTCCCGCCCTTCTTTNCTGAAATCTGCAGCTTATTAACAGCAGGGAGCCCGGGAATCCAAGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGA
  5   1   2       bld Tbd7 5g3  in                         XL108n02.5p                                                                                                                                                                                                                                                                                             GATTTTGTATAAGATAGGAGGCTAGGCGCCTGCAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAG
  5   1   2       bld Ga15 5g3  in                       XL496k07ex.5p                                                                                                                                                                                                                                                                                              ATTTTGTATAAGATAGGAGGCTAGGCGCCTGCAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAA
  5   1   2       bld Tbd7 5g                              XL076l24.5p                                                                                                                                                                                                                                                                                                             AGGCTAGGCGCCTGCAGTTAACAGCTTTTATCGGGNAGGTGTTGTATTTGTTTGGTGACCTGAGNACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCA
  5   1   2       bld Neu7 5g3  in                         XL006o15.5p                                                                                                                                                                                                                                                                                                                GGCTAGGCGCCTGCAGTTAACAGCTTTTATCTGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCAATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAA
  5   1   2       bld Tbd7 5g3  in                         XL059e05.5p                                                                                                                                                                                                                                                                                                                     GGCGCCTGCAGTTAACAGCTTTTATCGGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACC
  5   1   2       bld Ga12 5g3  in                         XL169e16.5p                                                                                                                                                                                                                                                                                                                     GGCGCCTGCAGTTAACAGCTTTTATCTGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCCGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAAT
  5   1   2       bld Emb1 5g                         IMAGE:6866067.5p                                                                                                                                                                                                                                                                                                                          TCACGCGTCCGCGGGAGGTGTCGTATTTGTCTTGTGCATTTGGTGACTTGAAAACTGTCATCCTGATATCGATCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCACAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACATCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTACAAGAACTTATACTACAGCAAAATGCCTTCAAAAACCTAGTTTCAGAGAAATCGTCTTACAGAACAAAAAGGCAAACGGACCACCCCCACCAAAATTCAGTCATACATTTTACCCTT
  5   1   2       bld Emb4 5g                         IMAGE:4202982.5p                                                                                                                                                                                                                                                                                                                              cacgcgtccgcggacgcgtgggcggacgcgtgggTTTGGTGACTTGAAAACTGTCATCCTGATATCGAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATGAGAATCTTAGCCCTGGGTAAGGTGTAGT
  5   1   2       bld Egg5 5g3  in                    IMAGE:3431674.5p                                                                                                                                                                                                                                                                                                                                    CAGCTTTTATCTGGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGT
  5   1   2       bld Bla1      in                    IMAGE:3379706.5p                                                                                                                                                                                                                                                                                                                                        CCGGGGTCGTATTTGTCTTGTGCATTTGGTGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCACAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAANANAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAA
  5   1   2      seed Ga15 5g3  in                       XL448i09ex.5p                                                                                                                                                                                                                                                                                                                                                GGAGGTGTTGTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTT
  5   1   2       bld Tbd7 5g3  in                         XL076m10.5p                                                                                                                                                                                                                                                                                                                                                 GTGTTGTATTTGTTTGGTGACCTGNNNACCTGCCATCCTGNCTTCTAGGNATCTGATAACATGGCAAAAGNATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTA
  5   1   2       bld Thy  5g                         IMAGE:8551208.5p                                                                                                                                                                                                                                                                                                                                                         GTATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTANATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGNAAAGACAAGAAGACTTTGACGAATAAGCAAAGCAGTCTCAGCTGCAGAACTATACTACACAATTGCTTTCAAACTAGTCAGCGAATCTCTACAGACAAAGCAACGACACCCCACAATCATCTACTTACCTCTCATGGACACACAGAGAGGATGA
  5   1   2       bld DMZ  5g                              xl272m01.5p                                                                                                                                                                                                                                                                                                                                                           ATTTGTTTGGTGACCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAA
  5   1   2       bld Ga12 5g                              XL201g06.5p                                                                                                                                                                                                                                                                                                                                                            ATTCGGNACGAGGCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATANAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACNGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGA
  5   1   2       bld Ga12 5g                              XL144o18.5p                                                                                                                                                                                                                                                                                                                                                                   GGTGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCACAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAAT
  5   1   2       bld Ga12 5g3  in                         XL207e14.5p                                                                                                                                                                                                                                                                                                                                                                   GTGGACTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCGCAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAAATAAAGTGGA
  5   1   2       bld Ga12 5g3  in                         XL214p21.5p                                                                                                                                                                                                                                                                                                                                                                   GGTGACCTGAGACCTGCCATCCTNACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAG
  5   1   2       bld Ga12 5g3  in                         XL188i10.5p                                                                                                                                                                                                                                                                                                                                                                     GAGGCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGG
  5   1   2       bld Ga12      in                         XL179p21.5p                                                                                                                                                                                                                                                                                                                                                                      AGGCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTaaaaaaaaaa
  5   1   2       bld Ga12 5g                              XL143k01.5p                                                                                                                                                                                                                                                                                                                                                                       GCTTGAAAACTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCGCAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAA
  3   1   2       bld Ga12      in                         XL179p21.3p                                                                                                                                                                                                                                                                                                                                                                        GCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGT
  5   1   2       bld Tbd7 5g3  in                         XL056d24.5p                                                                                                                                                                                                                                                                                                                                                                          CTGAGACCTGCCTCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAA
  5   1   2       bld Egg4 5g3  in                    IMAGE:3743768.5p                                                                                                                                                                                                                                                                                                                                                                              CTGTCATCCTGATATCTAGCATCCGGTAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAAAACAGCTGCTGCCCGAAAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCGCAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACATCCTACAATGAAGTGGCTGATGAACTGGTTGCAGA
  5   1   2       bld Tbd7 5g3  in                         XL101a22.5p                                                                                                                                                                                                                                                                                                                                                                                        CTGACTTCTAGGATCTGATAACATGGCAAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGAT
  3   1   2       bld Bla1      in                    IMAGE:3379706.3p                                                                                                                                                                                                                                                                                                                                                                                                     ATCCGGTAACATGGCGAAAGATGTGGGTCTTATAGCAGCAAATGAAGACTCAAGGGTTTTCGTAGATCAGATTCTTAGCCCTGGGAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAGTTCCCTTGGAAACAGCTGCTGCCGATAACGTTTGGACAGTCCACAGTAAACATTTCCCAGCAAGTGGTTCTTGGAACCCCACAAAGACAATCTGCACCAAATACTATCCTTATAGGAAGTCCTCATACACCTAATACACATTTTGTATCACAGAACCAAGCTACAGACTCTTCACCGTGGTCTGCTGGGAAGAGGAATAAGAAAGGTGAAAAGAATGGCAAAGGCTTACGTCATTTCTCCATGAAGGTTTGTGAGAAGGTGCAGAAGAAAGGCACAACGTCCTACAATGAAGTGGCTGATGAACTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCGCCAAATGAATCTCAAGCATATGATCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCT
  3   1   2       bld Ga15      in                       XL519p06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                         TNACATGGCAAAAGATGTNTGGTNTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACNCCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGANCCAGANGAATATTAGACGACGAGT
  5   1   2       bld Ga18      in                       xlk59c07ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                   AAAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGNCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTTCAAAAACCTAGNTCAGCGAAATCGNCTTACAGAACAAAAAGCAAACAGACNACCCCCCA
  5   1   2       bld Tbd7                                 XL060e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGATGCTGGTCTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGNGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACANCATCCTACAA
  5   1   2       bld Neu7      in                         XL041b01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                CTTATAGAAGCAAATGGAGAACTCAAGGTTTTTGTAGATCAGAATCTTAGCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGACTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCT
  5   1   2       bld Egg6      in                    IMAGE:4436058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                  TATATAATCAAATGGAGAACTCAAGGTTTTTGTAAATCAAAATCTTACCCCTGGAAAAGGTGTAGTGTCATTATTGACTGTCCATCCATCATCAATCAATTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACATAGGCAATCTGCACCAAATACTATCCTTATACGAAGCCCTCATACGCCTAATACACATTTTATATCTCAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGCGAAGAGA
  5   1   2       bld Ga12      in                         XL197p14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGGCTGAGACCTGCCATCCTGACTTCTAGGATCTGATAACATGGCAAAAGATGTGTAGTGTCATTATTGACTGTCCATCCATCATCAGTCAGTTCCGTTGGAAAACAGCTGCTGCCGAAAACGTTTGGACAGTCCAATGTAAACATTTCTCAGCATGTGGTTCTTGGGACACCACAGAGGCAATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCANAATTTGGAGGT
  3   1   2       bld Egg5      in                    IMAGE:3430486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCCCCGGGCGCAGAGGCAATTTGCGCCAAACCCTATCTTTATAGCAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGCAATAAAAAAGGTGAAAAGAATGGCCACAGGCTTGCGTCAT
  5   1   2       bld Egg5      in                    IMAGE:3430486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATCTGCACCAAATACTATCCTTATAGGAAGCCCTCATACGCCTAATACACATTTTATATCACAGAACCAAGCTACAGACTCTTCACCATGGTCTGCTGGGAAGAGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAGGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTaaaaaaaaaaaaaa
  5   1   2       bld Ga12      in                         XL178f17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAAATAAAAAAGGTGAAAAGAATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGGATAATCATATATCTCCGAATGAGTCTCAAGCATATGAC
  5   1   2       bld Ga15      in                       XL474m22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGGCAAAGGCTTGCGTCATTTCTCCATGAAGGTTTGTGAGAAAGTACAGAAGAAAGGAACAACATCCTACAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATATATCTCCGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTTCAAAAACCTAGTTCAGCGAAATCGTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGNCTGTA
  5   1   2       add Emb4                            IMAGE:4203685.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGCGTCCGACCCACGCGTCCGCAATGAAGTGGCTGACGAATTGGTTGCAGAATTTAGTTCAGCAGATAATCATTGATAGGATGAATGAGTCTCAAGCATATGACCAGAAGAATATTAGACGACGAGTCTATGATGCCTTAAATGTGCTAATGGCTATGAATATTATTTCTAAAGAAAA
  3   1   2       chi Ga18      in                      xlk126c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANGNAAAGGCANNACNNCCTACAATGAAGTNGCTGATGNCTGNTTGCAGNNNTANNCAGCAGANAATCATANATCGCCAAATGAATCTNAAGCATATGATCAGANNANTNTTAGACGACGAGTCTATGATGCCTTAAATGTGCTTATGGCTATGAATATTATTTCTAAAGAGAAAAAAGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGANCGAATAAAGCAAAAGCAGTCTCAGCTACAAGAACTTATACTACAGCAAATTGCCTTCAAAANCCTAGTTCAGAGAAATCGTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGTAGCATTTCTAATGACAAGTTCGAATACCTATTTAATTTTGACAACACATTTGAAATACATGATGATATAGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAACTGTTCAGCTGAGGATCTTAAGACTGCGAAAAGCTTGGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGCACAGATGGCATATTAGCTACAAGTTCAAATGGATCCCAGTACAGTAGTTCCCGAGTTGAGNCTCCCGTGTCGTATGCTGGAGAGGAAGAGGACGATGATGAGGATGGTTCTAATGATGAAGAGGATGACTGATGTGTANC
  5   1   2       bld Ga18      in                      xlk131c04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TATTTCTAAAGaaaaaaaaGAAATAAAGTGGATTGGTTTACCTACAAACTCTGCTCAGGAATGTCAAAATTTGGAGGTTGAAAGACAAAGAAGACTTGAACGAATAAAGCAAAAGCAGTCTCAGCTGCAAGAACTTATACTACAGCAAATTGCCTTCAAAAACCTAGTTCAGCGAAATCGTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGNTCAAATGGATCCCAATACAGTAGNTCCCGAGTTGAGACTCCTGTGTCGNATGTTGAAGAGGAAGANGAcgatgatgatgatgatcttgatgatgactgatgTGTAGCACATTTTTTCTGTGTTGAGATACNACTTCGGGAAAAAANTNTG
  3   1   2       add Ga18      in                      xlk131c04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNGNNCGAATAAAGCAAAAGCAGTCTCAGCTGCAAGNCTTATACTACAGCAANTNNCCTTCAAAANCCTAGTTCAGNGAAATCNTCTTACAGANCAAAANGCAAACANNCACCCCCNCCAAATTCAGTCATACATTTNCCCTTCATCATTGTGNNCNCCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATNCCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGANCCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGNCTTGNCTGGCTGTACAGATGGCATNTTGGCTNCGAGTTCAAANNGATCCCAANANAGTAGTTCCCGAGTNGANNCTCCTGTNNCNNATGTNGAAGAGGNAGANGNCGATGATGATGANG
  3   1   2       bld Ga18      in                       xlk59c07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ANGNAGTNTNAGCTGNANNNCTTANNCTACANNAANTNNCNTCAAAANCNTANTTNNGNNNNAATCGTCNTNNAGANCAAAANGNAACAGNNNCCCCCNNCNAAATTNAGTCANNNANTTNCCCTTCATCATTGTGNNCACCAGCAAGAAGACAGTGATTGACTGCAGCATTNCTAATGACNAGTTNGANTACCTATTNNATTTTGNNAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGANTGGGAATGGCTNGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTNCCAAAAGCTTAGTNCCAAAAGCTCTAGANCCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGNNNNNNCCTTAGAATTTTGCNGNAGGGGAAC
  3   1   2       bld Emb4 5g3  in                    IMAGE:5536732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              NAAACCTAGTTCAGCGAATTCTCTTACAGAACAAAAAGCAAACAGACCACCCCCACCAAATTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTGCAGGGGGAAATCATCCACGTACGTATCAAATACGACGTT
  3   1   2       bld Ga12      in                         XL178f17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGCAAACAGACCACCCCCACAAAATTCAGTCATACATTTACCNTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTNTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTNAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTTATTTTTTTTTTTTTATTTCCCCCCCATTCCAAGGAAATATTGAT
  3   1   2       bld Ga12 5g3  in                         XL169e16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCAGTCATACATTTACCCTTCATCATTGTGAACACCAGCAAGAAGACAGTGATTGACTGCAGCATTTTTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTNTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTNTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATNTCATTTTCATCAGGTTCAGTGTTTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCA
  3   1   2       bld Ga12 5g3  in                         XL188i10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCAGTCATACATTTACCCTTCATCATTGTGAACNCCAGCAAGAAGACAGTGATTGACTGCAGCATTTNTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTNTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATNTCATTTTCATCAGGTTCAGTGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATnTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTA
  3   1   2       bld Ga12                                 XL219d11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATACATTTACCCTTCATCATTGTGAACNCCAGCAAGAAGACAGTGATTGACTGCAGCATTTNTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAANGCTNTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGNGTATATNTCATTTTCATCAGGTTCAGTGTTTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATGATnTTGATGATGACTGATGTGTAGCNCATTTTTTNTGTGTTGAGATACAACTTCGGGAAAAAAAATTnTGTTAATGGGGTGATTTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAATGGGGAAAAT
  3   1   2       bld Ga15      in                       XL474m22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTCATCATTGNGGNACACCAGCAAGAAGNCNGTGATTGNCNGCNGCATTTTTAATGACAAGTTNGNATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGNGAATGGGAATGGCTTGTGGTNTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATANGTGNCAGAAATGGCTCAGGGATCAATTAGCAGNGGGNATATCTCATTTTCATCAGGTTCAGNGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCNCATTTTTTCTGTGNTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTGAAGGGGAACTTCATCCAC
  3   1   2       bld Ga12      in                         XL197p14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGCAAGAAGACAGTGATTGACTGCAGCATTTNTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTNTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATNTCATTTTCATCAGGTTCAGTGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAATGGGGAAA
  5   1   2       bld Egg1                               PBX0023B08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACAGTGATTGACTGCAGCATTTCTAATGACAAGTTTGAATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAgatgacgatgatgatgatgatgatcttgatgatgactgatgTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGaaaaaaaaTCTG
  3   1   2       bld DMZ  5g3  in                         xl331k01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATACCTATTTAATTTTGACAATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCNGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGG
  3   1   2       bld Tbd7 5g3  in                         XL101a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATACATTTGAAATACACGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCANNC
  5   1   2       bld Ga15                               XL480i12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGATGATATTGAAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAgatgacgatgatgatgatgatcttgatgatgactgatgTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGAttttttttttCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAANAAGGATCATTCAAGTTTATATTTTTTGNGTGCTGNGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTANCaaaaaacngaaaaaaaaaaaaaanccnnaaaaaaaancccnaaaaaaaaa
  3   1   2       bld Ga15 5g3  in                       XL496k07ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATTGAAGTACNGAAGCGAANGGGAATGGCTTGTGGTNTAGAATCAGGAAGCTGTTCAGCTGGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGGGACAGAAATGGCTCAGGGATCAATTAGCAGTGGGTATATCTCATTTTCATCAGGTTCAGNGTCTAATGGCAGAAGGTTTTCATCAAGNGACTTGACTGGCNGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCNCATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGNGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCCTAGAATTTTGCCTGNAGGGGAACTTCATCCACA
  3   1   2       bld Ga15      in                       XL503b12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGNGTATATCTCATTTTCATCAGGTTCAGTGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGnGTAGCNCATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTGAAGGGGAACTTCATCCACATAA
  5   1   2       bld Ga15      in                       XL503b12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGTACTGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCANGGATCAATTANCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACNAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAgatgacgatgatgatgatgatcttgatgatgactgatgTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGAttttttttttCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAANAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAAAATTTTGCTTGAAGGGGAACTTCATCCACNTTAATGGGGAAAATAAACTGATATCCTTTGTnnnnnnnnA
  3   1   2       bld Tbd7 5g3  in                         XL059e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGCGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTT
  3   1   2       bld Ga12                                 XL211c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGCGAATGGGAATGGCTTGTGGTNTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTNTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGNGNGTATATNTCATTTTCATCAGGTTCAGTGTTTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTNGTATGTTGAAGAGGAAGATGACGATGATGATGATGATGATnTTGATGATGACTGATGTGTAGCNCATTTTTTNTGTGTTGAGATACAACTTCGGGAAAAAAAATTnTGTTAATGGGGTGATTTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAA
  3   1   2       bld Egg4 5g3  in                    IMAGE:3743768.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGAATGGGAATGGCTTGTGGTCTAGAATCAGGAAACTGTTCAGCTGAGGATCTTAAGACTGCGAAAAGCTTGGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGCACAGATGGCATATTAGCTACAAGTTCAAATGGATCCCAGTACAGTAGTTCCCGAGTTGAGACTCCCGTGTCGTATGCTGGAGAGGAAGAGGACGATGATGAGGATGGTTCTAATGATGAAGAGGATGACTGATGTGTAGCACGTTTTTTGTGTTGAGATACAGCATCAGGAAAAAAAAATTGTTTTTTTTTTTTTTTATCTTTCCCCTGTTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCGAGTTTATATTTTATTTTTCTTTGTGTGTGCTGTGAAAATTGACAGTATTTTGTTCAAATCTATTTACTTTCCCATTTATAGTTATGTTTGCCCCTTTTAATTAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4436058.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTGTGGTCTAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGANCCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCA
  3   1   2       bld Tbd7 5g3  in                         XL108n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGAATCAGGAAGCTGTTCAGCTGAGGACCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCANAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGNCTTGAAGGGGAACTTCATCCACATTAA
  3   1   2       bld Tbd7 5g3  in                         XL056d24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ANCAGNAANNTGTTCAGNTGAGGACNTTAAGANTGCCAAAAGNTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATNGATTCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGNCGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTNAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATGTTTGCCCCCTTAGAATTTTGC
  3   1   2       bld Neu7 5g3  in                         XL018n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTNTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCNTAGAATTTTGCCTTGNAGGGGAACTTCATCCACATT
  3   1   2       bld Tbd7 5g3  in                         XL076m10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTAAGACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACANAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTAC
  3   1   2       bld Neu7 5g3  in                         XL006o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTGCCAAAAGCTTAGTGCCAAAAGCTCTAGAACCATATGTGACAGAAATGGCTCAGGGATCAATTAGCAGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCAGAAGGTTTTCATCAAGTGACTTGACTGGCTGTACAGATGGCATGTTGGCTACGAGTTCAAATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTT
  3   1   2       bld Egg5 5g3  in                    IMAGE:3431674.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCTATGTCCCAACAATGGCTCAGGGATCAATAACCGGTGTGTATATCTCATTTTCATCAGGTTCAGTGTCTAATGGCACAAGGTTTTCACAAAGTGACTTGACTGGCTGTACAGATGGCATGTTGCCTAACAGTTCACATGGATCCCTATCCGGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAACAGCAAGATGACGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATGTATAGTTATGTTTGCCCCCTTAGAATTTTGCTTGAAGGGGAACTTCATCCACATTAATGGGGAAAATAAACTGATATCCTTTGTAAA
  3   1   2       bld Neu7      in                         XL041b01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGGATCCCAATACAGTAGTTCCCGAGTTGAGACTCCTGTGTCGTATGTTGAAGAGGAAGATGNCGATGATGATGATGATCTTGATGATGACTGATGTGTAGCACATTTTTTCTGTGTTGAGATACAACTTCGGGAAAAAAATTTCTGTTAATGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAG
  3   1   2       bld Ga12 5g3  in                         XL214p21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCTGTGTNGTNTGTTGAAGAGGAAGATGACGATGATGATGATGATTTTGATGATGACTGAnGTGTAGCnCATTTTTTTTGNGTTGAGATNCAACTTCGGGAAAAAAATTTNTGTTAANGGGGNGATTTTTTTTTTNTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTNTTACAACCAAGAAGGATCATTCAAGTTTATATTTTTTGTGTGCTGTGGATTTTGACAGTATTTTGCTCAAATCTATTTACTTTCCCANGTATAGTTATGTTTGCCCCC
  3   1   2       bld Ga15 5g3  in                       XL448i09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CNCATTTNTTCTGTGTTGAGATACAACTTNGGGAAAAAAATTTCTGNTAANGGGGTGATTTTTTTTTTCTTATTTCCCCCCCATTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCAAGTTCTATATTTTTTGTGTGCTGTGGANTNTGGACAGTATTT
  3   1   2       add Ga15 5g3  in                       XL498p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCCGTTTTTTGNGNNGGGANNCCNCCNCNGGAAAAAAAAATTGTTTTTTTTTTTTTTATCTTTCCCCTGTTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCGAGTTTATATTTTATTTTTCTTTGTGTGTGCTGTGAAAATTGACAGTATTTTGCTCAAATCTATTTACTTTCCCATTTATAGTTATGTTTGCCCCTTAGA
  3   1   1       add Ga12 5g3  in                         XL207e14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGAAAAAAAAATTGTTTTTTTTTTTTTTATCTTTCCCCTGTTCCAAGGAAATATTGATACAGTACTTGGTTCTTACAACCAAGAAGGATCATTCGAGTTTATATTTTATTTTTCTTTGTGTGTGCTGTGAAAATTGACAGTATTTTGCTCAAATCTATTTAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)