Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7295704.5                      23 PI      86       1939     2676                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:6633112.5                      13 PI      89        783     1706                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6324910.5                      12 PI      93         74      864                T-box protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 80%

 1012768429 Xl3.1-IMAGE:6861212.5 - 77 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                      2     2     2     2     2     3     2     5     3     5     5     7     9    11    10    11    12    15    12    20    12    25    13    26    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    26    27    27    27    27    27    27    27    27    28    28    28    28    28    28    28    28    28    28    28    28    29    29    29    29    29    30    30    30    30    30    29    29    28    29    29    30    29    30    29    30    29    30    29    30    29    30    28    30    29    30    29    30    29    30    29    30    28    30    26    29    26    29    26    29    25    29    23    28    24    28    24    28    23    28    21    28    22    27    20    28    17    25    16    24    14    24    14    24    14    23    12    22    12    22    11    22    10    22     9    22    10    24    10    22    10    22    10    22    11    22    11    22     9    19     9    18     9    16     9    13     9    12     9    12     9    12     9    11    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    10    13    11    13    11    13    11    13    11    12     8    12     7    12     6    12     6    12     6    12     5    12     4    11     5    11     5     9     5     9     5     9     5     9     5     9     5    10     5    10     5    10     4     9     4     9     4     9     4     9     3     8     3     8     2     8     2     8     3     9     3     9     3     9     3    10     3    12     4    12     4    12     4    14     4    14     4    15     5    15     6    13     4    13     6    13     6    13     6    13     5    13     9    13     7    12     7    12     9    14     9    14     9    14     9    15    11    15    10    15    10    15    12    16    12    15    13    17    16    22    15    22    15    22    19    22    19    23    18    23    20    25    22    25    22    26    21    25    24    26    24    25    25    27    25    27    26    29    25    28    25    28    25    28    24    28    24    28    26    29    25    29    26    29    25    29    26    28    26    28    24    28    26    27    26    27    26    27    27    29    28    29    28    28    28    28    28    28    28    28    28    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    27    29    28    29    28    29    27    29    23    29    22    29    23    29    23    29    22    28    21    27    21    27    21    27    21    26    21    26    21    26    16    23    11    17     8    11     8    11     6     8     3     4
                                                                   VAR                                                                                                                             ATTAGTTTAGGAACATGCATTCTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 G-C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------G
                                               BLH ATG      62     238                 
                                               BLH MIN      20     146                 
                                               EST CLI      99      20                 
  5   1   2       bld Ga18      in                      xlk137a01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGAGTCACAAGAGGGATGATGTTTTAAAGATTCTACAACAAAGTCCCAGTAAAAGGCAGAAGAGGAAGAAGTGGGAGGACAGTCCTGAGGCTGATATTTCAGATTTCCCCAAGGCTATATGTGTGAAGGAGGAATCCATTATGGACCCAGCAGGAGTTTATCAGAACTGGGTTTCAGATCACGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGCCAATCAGGAGCAGCAAGTCCCCACATCTTCCTCTAACTTCTACAACAAGAGCCATTATCGAAGGATTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAAAGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGNNNCCATGTACAGCCCTTATGGAGCAGANCAGTGGTTGGNNCCAGCTCAAGGNCAATATCGACCTGTGGGCTATACTGCATACCCAACAGACTTAAGCACACAAGGAGNAGTAGCTCACCCACATAGTGCGATGTCAGACTGGNGCCAATACTCTCTCNNCCCTACAGCTGTNNNAAATGGGTNAAGGGAAA
  5   1   2       bld Ga18      in                       xlk81m13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATCCATTATGGACCCAGCAGGAGTTTATCAGAACTGGGTTTCAGATCACGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGCCAATCAGGAGCAGCAAGTCCCCACATCTTCCTCTAACTTCTACAACAAGAGCCATTATCGAAGGAGTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGTGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACTGCATACCCAACAGACTTAAGCACACAAGGAGCAGTAGNTCACCCACATAGTGCGATGTCAGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTggggggggAGCGGNNNNTGTNGNTTTGCATCTCTGAGGNTTAAGGNNCTCCNTAAAAANCNTGCATTGNGAGGTNCATGGAGAGGTTTGANTNNNNTATTTGTNNACTAAANNGNGTCANTTATCA
  5   1   2       bld Oo1                             IMAGE:6642453.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTATGGACCCAGCAGGAGTTTATCAGAACTGGGTTTCAGATCACGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGCCAATCAGGAGCAGCAAGTCCCCACATCTTCCTCTAACTTCTACAACAAGAGCCATTATCGAAGGAGTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGGTGCCATGTACAGCCCCTTATGGAGCAGATCAGTGGTTGGTTCCAAGCTCAAGGGTCAATAATCAACCCTGTGGGGCTATAACTGCAATACCCAAACAGAACTTAAGCCCCACAAGGGAGCCAGTTAACTTCACCCCACCATAATGGGGAAAGTCCCAAAATGGGAAGCCCAATAAATCTTCTCTTTTCCCCTTAAAAGGTTGTTGGGGAAAATGGGGGTTAAGGGGAAAAATGGGGTAATTCCCACAAGCCCCTTTACCCCCTTTCCCTGGGCAAAAAACCCCCCAGACCCCCGAGATTCCtttttttttgggggggnggggagaaaaagcccccccttgggggggggttttttggcacacctcccgggggggggaaaaaaaacccctcgggggagctctcctttaaaaaaaaacccccctctttgtgggaagggggtttctccttttaaaaaaaatttttttttataaaaaaaataatatttttgggggggaaaaaaaaaaaaaggggggggccccctttttttttgttgccccaaaaaaaaaccgggggggggtgcgccccccccccggggttttttgggggacaccggggggggaggaaaactcccccccccccggggggggg
  5   1   2       bld Egg1                               PBX0048E09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTATGGACCCAGCAGGAGTTTATCAGAACTGGGTTTCAGATCACGAGGCTAACCAAGGCTTGACACCCCACTCCCCTGAGTCTGAGGGTGCCAATCAGGAGCAGCAAGTCCCCACATCTTCCTCTAACTTCTACAACAAGAGCCATTATCGAAGGAGTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGGTGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACT
  5   1   2       bld Oo1                    IMAGE:6640977-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACTCCCCTGAGTCTGAGGGTGCCAATCAGGAGCAGCAAGTCCCCACATCTTCCTCTAACTTCTACAAGAGCCATTATCGAAGGAGTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGGTGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACTGCATACCCAACAGACTTAAGCACACAAGGAGCAGTAGCTCACCCACATAGTGCGATGTCAGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTC
  5   1   2       bld DMZ       in                         xl260d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTATCGAAGGAGTTCCCAACATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGGTGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACTGCATACCCAACAGACTTAAGCACACAAGGAGCAGTAGCTCACCCACATAGTGCGATGTCAGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTgggggggggggAGCGGGCTGTGTGGTTTTGCATCTCTGAGGCTTCAGGACCTCCTTAAAAACCCTGCATTGGGAGGTTGCATGGAAAGGTTTGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAA
  5   1   2       bld DMZ       in                         xl318f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCTCTCCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTAGCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCAGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGGGTGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACTGCATACCCAACAGACTTAAGCACACAAGGAGCAGTAGCTCACCCACATAGTGCGATGTCAGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTggggggggAGCGGGGCTGTGTGGTTTTGCATCTCTGAGGCTTAAGGACCTCCTTAAAAACCCTGCATTGGGAGGTTGCATGGAGAGGTTTGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAATTGTGAGAAACCGTggggggggTGCGTTAAAG
  5   1   2       bld Ga18      in                       xlk65l03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTCGCCATTTGAATTGGGAGAGCCCTCTAGCAGACGTCTTACCCCTGACATTGCTACAGTGCCGGATTCCGATCCAGATTCTTTACCAGTGTTTCATGTCATTCCAACACAGAATTCTGCTCCGGAACGCACATGTTCTATGAACTTTTCCATGGAAGCTCCAATGAAACAGCCCCTCCGGNGCCATGTACAGCCCTTATGGAGCAGATCAGTGGTTGGTTCCAGCTCAAGGTCAATATCGACCTGTGGGCTATACTGCATACCCAACAGATTTAAGCACACAAGGAGCAGTAGNTCACCCACATGCGATGTCGGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTgggggggggAGCGGGNNTGTGTGGNTTTGCATCTCTGAGGNTTCAGGACCTCCTTAAAAACCCTGCATTGGGAGGNTNCATGGAGAGGNTTGATTACATTATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTANGTTGNCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAANCGTGGGGGGNNNGCGTTAAAGCAGATCTNCAGAAGAGAANCNNGGAAAGCAGNTNNNGATTTATA
  5   1   2       bld Oo1                             IMAGE:6642403.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTTGGTAAACCGGTCCGGAATTCCCTGGGATCATACCCAACAGACTTAAGCACACAAGGAGCAGTAGCTCACCCACATAGTGCGATGTCAGACTGGAGCCAATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTggggggggAGCGGGGCTGTGTGGTTTTGCATCTCTGAGGCTTAAGGACCTCCTTAAAAACCCTGCATTGGGAGGTTGCATGGAGAGGTTTGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTggggggggTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGtgtttgtgcttttgtgcactgctcgggaaatgtgtgtgtatttgggggggagtgtgtgtTCACTAAAGAATGTACTGCTGACTATGAGACTAACGCTGTGCCATATTCACAGGGATAGCCAAAATTTGGTGGTCCATCTAAAGCCAAAGCTACAGCTTCCCAGTATTTGCCTCTANATGAGAGCACTACTTCTGGCAATACCAGGGTCACCCAAAGGTTGGCCTAACTCTGCATATTTTCCCATTAAA
  5   1   2       bld DMZ       in                         xl274b10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATACTCTCTCTTCCCCTACAGCTGTTGGTAAATGGGTTAAGGGAAATGTGTATCCACAGTCCTTACCCATCCATGCCAATACCTCAGTCCTGATTTCTTGTTgggggggggggAGCGGGCTGTGTGGTTTTGCATCTCTGAGGCTTCAGGACCTCCTTAAAAACCCTGCATTGGGAGGTTGCATGGANAGGTTTGATTACAATATTTGTTGGACTAAAAGGNGTCACTTTATCANCACAAACAGTAGGTTGCCCCTGNGCTTGNGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTANCAAGTAAATGTGANAAACCGNGGGGGGGTGCGTTAAAGCAAATCTCCANAAAANAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAANGGGGCCATGAACANAAGCAGTTTTCNCTTGACTTTAAGNGGNGGTACAGCCATCTAACTCTCCATTTTCTTAANGTCCCCAATTATTGCCTTTCACTCAATTATACNANGGNCNGttttgttttttgtttttttAAACTANAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGNGGNGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGG
  5   1   2       bld Egg3                            IMAGE:3377791.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGCTGAGGCTTCAGGACCTCCTTAAAAACCCTGCATTGGGAGGTTGCATGGAGAGGTTTGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTGGGGGGGTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTATGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACT
  5   1   2       bld Egg1                            IMAGE:4678427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGAGGGGGAGGTTGCATGGAGAGGTTTGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTggggggggTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGT
  3   1   2       bld Ga18      in                       xlk65l03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNTGCANGNNGANGTTTGANTACATNATNTTTGTTGGNCTAAAAGGNNTCNCTTTATCAGNANAACAGTAGNTTGCCCCTGNGCTTGNGATCAGGGGAATCTCTACCTGTNCTTGANCTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTGGGGGGTGTGCGTTAAAGCAGATCTCCAGAAGAGNNCCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGNCCATGNACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTATTCATTTTCTTAATGTCCCCAATTATTGCCATTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTTAAACTATAATTTTGATTACAGTTTTNCNCCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTNTTCNCCNNCTGGTT
  5   1   2       bld Egg1                               PBX0142E03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGAGGGATTACAATATTTGTTGGACTAAAAGGTGTCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTggggggggTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGtgtttgtgcttttgtgcactgctcgggaaatgtgtgtgtatttggggggagtgtgtgtTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCT
  3   1   2       bld Ga18      in                      xlk137a01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACNAAANGNNNTCACTTTATCAGNNCAAACAGTAGNNTGCCCCNGNGCTNGTGATCAGGGGAATCTCTNCCTGTNCTTNNACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTGGGGGGGTGCGTTAAAGCAGNTCTCCAGAAGAGNACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGNCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTNCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTTCNCCANCTGNTT
  5   1   2       bld Egg3                            IMAGE:6325029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCCGGGCACTTTATCAGCACAAACAGTAGGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTGGGGGGGTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGgtgtttgtgcttttgtgcactgctcgggaaatgtgtgtgtatttggggggagtgtgtgtTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTTGCATTCTGTGATTAGTTAAATAAACATGGGGATGGTTTGTNTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTTAAAGGGTTTGGTGTAATTTGCTTGTAAAGCTANGGTTTTGTGGGGAAGGCTGCAGGCAAAAACAGNAATGGTATTCTGGAATAGAACACATCCTGTTAA
  3   1   2       bld Ga18      in                       xlk81m13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GNNGNCNAAAAGNNNNNNTTTANCAGNNNAAACANTANGNTGCCCNGTnnnnnnnnAGGGNATCNCTNCCNGTNCTTGACCTAATGTNTTNTTTTAANNNTNGCANGTNANTNTGAGAACCGTGGGGGGGGTNCGTNAAAGCAGNNCTCCAGAAGAGACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGNNCATGAACAGAAGCAGTTTTCTCTTGNCTTTAAGTGGTGGTANAGCCATCTANCTCTCCATTTTCTTANTGTCCCCAATTATTNCCTTTCACTCAATTATACTATGNTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCNCCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTNCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGNTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGNCNNAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTNNNCNCCANC
  5   1   2       bld Ga12      in                         XL213b04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTGCCCCTGTGCTTGTGATCAGGGGAATCTCTACCTGTACTTGAACTAAATGTATTTATTTTAAAGATTAGCAAGTAAATGTGAGAAACCGTGGGGGGGTGCGTTAAAGCAGATCTCCAGAAGAGAACCCGGGAAAGCAGTTATGGATTTATAGAACAAAGTAATGGGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCANTATTGCCTCTANATGANAGCACTACTTCTGC
  3   1   2       bld DMZ       in                         xl318f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGAAAAGCAGTTATGGGATTTATAGAACCAAAGTAATGGGGNCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGATAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGANGCAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTT
  3   1   2       bld Ga18      in                       xlk63e04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCNGGNAANGNANTNNGGATTNANNGANNNAAGNAATGGGACCNNNNACAGAAGNNANNTTTCTCTTGNCTTTAAGTGGTGGTACAGCNNNCTANCTNTTCNTTTCNTANTNNCCCCNAATTATTNCCATTCACTCANTTATNCTATGGTCTGTTTTnnTTTTTTGTTTTTTTTAANCTATAATTTTGATTACAGTTTTGCACCTTNNNNTTTTCCAGGGTGGTGGTTTGCAGCACTANTCTGTGACTGTGTGTACAGCAGGTGTTTGTGCTTTTGTNCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGNCTAACGNTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGNAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTNNNNCNCCNNCNGNTT
  5   1   2       bld Egg3                            IMAGE:6870360.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGATTCCCCGGGATAGAACAAGAATGCGGCCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTAtttaagaattgtttttgactatgaaatgtgttttaatgtgacttttatttaATGGCATGAATTGAGGAAGGAAACAATGAAGTGTCATTTGGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCCTTATTTCaaaaaaaaaaaaaaaaaaaaGCGGGCCGCCACCCGCGGGTGGGAGCTTCAAGCTTTA
  3   1   2       bld DMZ       in                         xl317i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGTAATGGGACCATGAACAGAAGCAGTTTTCTCTTGACTTTAAGTGGTGGTACAGCCATCTAACTATTCATTTTCTTAATGTCCCCAATTATTGCCATTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAAGCAGTANGTATTCTGTATAGAACACATCNGTAAATAGATTTTNTNTAAGAATTGTTTTCGNACTATGAAACTGNGTTCTNATGTGACTTGTATNTAACGGCATNAATCTGANGAAGGNAAACAATGAA
  3   1   2       bld DMZ       in                         xl223o12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGTACAGCCATCTAACTCTCCATTTTCTTAATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTnGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAATCAGTATGTATTCTGTATAGAACACATCTGTAAATAGATNTTATTTAAGAATTGTTTNCGACCTATGAAATGTGTTNTAATGTGACTTTTATA
  5  -1   2       bld Bla2                            IMAGE:7299651.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTGACTAGTGTGACAGCTCTACTTCATTCTATGTCCCATATGCCATCATCATATACATGTCGtttgttttgttttttAAACTATATTTGATACAGTTTGCACCTACATTTCCAGGGTGGGGTTTGCAGCACTAATCTGTGACTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTAtttaagaattgtttttgactatgaaatgtgttttaatgtgacttttatttaATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTC
  3   1   2       bld Ga12      in                         XL213b04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGTCCCCAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTAT
  3   1   2       bld DMZ       in                         xl223m12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTT
  5   1   2       chi Emb1                            IMAGE:6632881.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATTATTGCCTTTCACTCAATTATACTATGGTCTGttttgtttttttgtttttttAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCNAGCANAACAGCATGNATCCTGGCTAGAAACCCTCTGTAAATAAATTTAATTTAAGAAATTGTTTTTGGACTATGAAAAGGCGCTCTTATGGGACTTTTAATTTAATGGCTTGGAACTGGAGGAAGGAAACAATGGAAAGGCCCATTGGTTTTGCCCCCCCATCTGGGTTATCCACCTTTCCAAAAAATTGTTTTTCCCTTATTTTCCAAAACAAGGGGTTATTGGGGTTTCAAACCTTTCCAAAATAACAATTTTCTAAACAAAAAGCCCCTTTTAAGTGGGGGAAAAATCCCCCCCTCTGACCCGCATTTT
  3   1   2       bld DMZ       in                         xl235a18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTGTCTCCA
  3   1   2       bld DMZ       in                         xl260d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTT
  3   1   2       bld DMZ       in                         xl252p05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAATTATTGCCTTTCACTCAATTATACTATGGTCTGTTTTGTTTTTTGTTTTTTTAAACTATAATTTTGATTACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTGTCTCCA
  3   1   2       bld DMZ                                 rxl314l22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTAAACTATAATTTTGATNACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCNCTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTG
  3   1   2       bld DMZ       in                         xl274b10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAGTTTTGCACCTTACATTTTCCAGGGTGGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTGTCTCCATCT
  3   1   2       bld Ov1       in                    IMAGE:8328112.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTGCACCTTACTTTTTCCAGGGTGGTGGTTGCAGCCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Egg1      in                    IMAGE:3301141.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCCAGGTTGTGGTTTGCAGCACTAATCTGTGACAGTGTGTACAGCAGGTGTTTGTGCTTTTGTGCACTGCTCGGGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTANAGCANAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCAAA
  3   1   2       bld Egg3 5g3  in                    IMAGE:3378006.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACTAATCTGTGACAGTGTGTACAGCAGGTGTTGGTGCTTTTGTGCACTGTCGGNAAATGTGTGTGTATTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAANATTTGGTGTTCCATCTAAAGCANAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCT
  3   1   2       bld Ooc1                             Ooc1-db32a12.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGTTTGTGTTTTTGTGCATTGTTCGGCAAATGTGTGTGATTCTGGGGGGAGTGTGTGTTCANTAAAGATTGTACTGCTGACTATGACACTCATGCTGTGTAATATTTATAGGGATAGGTAAAATTTGGTGTTCTATCTAAAGTACAGCTACAGCTTCCAGTATTGCTTCTAGATGAGAGCATTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCAAAAAAAAAA
  3   1   2       bld Egg3 5x3  out                   IMAGE:3377793.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTTTGTGCTTTTGTGCACTGCTCGGAAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCGCTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCT
  5   1   2       bld Egg1                               PBX0086H03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAATGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTTTCTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGNGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGTGTGTATTTGGGGGGAGTGTGTGTTCACTAAAGATTGTACTGCTGACTATGAGACTAACGCTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGTATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTC
  3   1   2       chi Emb1      in                    IMAGE:3401312.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGTGAGATCTTGGCGAGAAGTGTGAGTTCACAAAAGCTTGCACTACTGAAAATGACCCTAATCTGGAGCAATATTCCAAGGATAGCGAAAATGTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCAGCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCAAAAAAAAA
  3   1   2       bld Gas6                            IMAGE:3474170.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTGCAATATTCACAGGGATAGGCAAAATTTGGTGTTCCATCTAAAGCAAAGCTACAGCTTCCAGTATTGCCTCTAGATGAGAGCACTACTTCTGCAATAGCAGGGTCACCAAAGGCTGCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCCTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCCTGTAAATAGACTTTTATTTAAGAACTTGTTTTTGCACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGACCTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTAT
  5   1   2       bld Ga12      in                         XL162h08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTAACTCTGCATATTTTNNCATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTAtttaagaattgtttttgactatgaaatgtgttttaatgtgacttttatttaATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCaaaaaaaaaa
  3   1   2       bld Ga12      in                         XL162h08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCCTAACTCTGCATATTTTCACATTAGCATAACCTCTGGCAATGATTGGGACAATTGACTCCAAAAGTGGGGTAAACATGTAACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTAGCAGCTCAGCAGTTAAAGGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAACAGTATGTATTCTGTATAGAACACATCTGTAAATAGATTTTATTTAAGAATTGTTTTTGACTATGAAATGTGTTTTAATGTGACTTTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTC
  3   1   2       bld Ga11                            IMAGE:3475057.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAAATATTAATCCTTGCATTCTGTGATTAGTTAAATAAACATGGGATGGTTTGTTTGCTCTTTGTTCTACAGATTCAGTACCAGCTCAGCAGTTAAAGTGGTTTGTGTAATTGCTTGTAAAGCTAGGTTTTGTGGGAGGGCTGCAGGCAGAGCAGTGTGTATTAAAAATAGAACACATCTGTAAATAGATTTTATTTAAGAAAAAAATTAGACTATGAAATGTGTTTTAATGTGACATTTATTTAATGGCATGAACTGAGGAAGGAAACAATGAAGTGTCATTTGTTTTGTCTCCATCTGGTTATACACCTTCAATAAATGTTTTCCTTATTTCAAAAAAAAAAAAAAAAAAGCGGCTGCGTCGACACTAGTTCTCTCCCGGGGATTCCCCGGGCCCGGGGAATTCAGATCTGCCAAAGTTGAGCGTTTATTCTGAGCTTCTGCAAAAA

In case of problems mail me! (