Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6637711.5                      87 PI      78        750     1067                Growth differentiation factor 1 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 93%

 1012768469 Xl3.1-xl317b11.3 - 47 ESTs
                                                                       ........-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl317b11.3                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGATTGTTGGAAATAAATGTGATTTAACAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGGGGG
                                                  Xl3.1-CHK-1012686828                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGATTGTTGGAAATAAATGTGATTTAACAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGGGGGGGCCCG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                        7     8    11    13    15    16    16    17    17    18    17    18    18    19    18    19    18    19    18    19    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    21    20    22    21    22    21    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    22    23    21    22    21    22    21    22    21    23    22    23    21    22    22    23    22    23    22    23    22    23    22    23    22    23    23    24    23    24    23    26    25    27    24    25    21    25    21    26    21    28    16    26    18    28    14    24    17    25    15    26    17    26    19    27    20    27    18    26    21    27    21    26    21    25    21    25    21    25    22    25    23    25    24    26    24    26    24    25    24    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    23    25    24    25    24    25    24    25    23    25    23    25    23    25    23    25    23    25    22    25    22    24    22    24    22    24    22    24    21    24    22    24    22    24    21    24    21    24    20    24    20    24    20    24    19    21    16    18    12    14     2     4     1     3     1     3     3     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -A----------
                                               BLH ATG       2     784                                                                                                                                                                                                                                                                                                                                                                                                                                   
                                                                                                                                                                    PROTEIN --- Dm ---- 6e-033     NP_477340.1 glass bottom boat CG5562-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-033     NP_504709.1 decapentaplegic / Bone morphogenetic protein Like, transforming growthfactor-beta homolog, regulator of body size and male tail differentiation (41.7kD) (dbl-1) [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ag ---- 1e-034     XP_317480.2 AGAP007987-PA [Anopheles gambiae str. PEST] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-038     NP_001072008.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED - ?? ---- 6e-038     XP_874937.3 PREDICTED: similar to bone morphogenetic protein 6 [Bos taurus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Sp ---- 1e-047     NP_999793.1 univin [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 2e-061     NP_032134.2 growth differentiation factor 3 [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED - Bt ---- 9e-071     XP_001254181.1 PREDICTED: similar to growth differentiation factor 3 [Bos taurus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 2e-073     NP_065685.1 growth differentiation factor 3 precursor [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Cf ---- 1e-075     XP_534896.1 PREDICTED: similar to growth differentiation factor 3 precursor [Canis familiaris] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Dr ---- 4e-092     NP_571023.1 decapentaplegic and Vg-related 1 [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Gg ---- 3e-106     NP_990542.1 growth factor CVg1 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 0          Q66KL4 Derriere protein precursor (Growth/differentiation factor 3) (Gdf-3) [Xenopus tropicalis]  =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          NP_001080966.1 derriere (posterior determination, TGFb family member) [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xl3.1-xl317b11.3                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG---------------------------ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------TGA---------------------------------TAA------------------------------------------ATG------------------------------------------TAA---TAA---------------------------------------TAG------------ATG------------------------------TGA------------------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  5   1   2       bld Emb1 5g                         IMAGE:5155434.5p                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGCTCCAAGGCAGAAGTGCAGACCTACAGGAGAAGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGGATGTGAACCAATACAGTCTTTCCATTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCCATTGGCAAAAACTCACGAAGCCCAAGAGGAGTACTCCTTTCATCCACCTCCAAACCCCAAGGCAATAC
  5   1   2       chi Ga12      in                         XL194n15.5p                                                                                                                                                                                                                                                                                                                                                                                                                       GTCACTTATATAATTTAACAAAACAGTTCACCCTATGAAGAATGCATCACATGAGGCAAATAAATGGGGGCTTCAACCTTTAACTATTCTGCCTGAACAGAACCCCCTCTGATTATGAAATATATTTCTCTATTCCTTTTTGTTTTTGCAGTGTAGAGCACCCTGTTTCTCTAGAATTGTTTTTGACTTCCTTTGTGTCTTTCCATATATGCATGTTAATATATGAGCTGATAACTAACAGACATCTATTTTTCTATTTTCTCCTAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAGAC
  5   1   2       bld DMZ  5g3  in                         xl232g19.5p                                                                                                                                                                                                                                                                                                                                                                                                                          GAGAAGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCNATTGCAAAACTCAACGAGCC
  5   1   2       bld Emb1 5g                         IMAGE:6633247.5p                                                                                                                                                                                                                                                                                                                                                                                                                           AGAAGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCAAACCCCAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTTCAGGAATGNTGGAATGGCAAC
  5   1   2       bld DMZ  5g3  in                         xl293n03.5p                                                                                                                                                                                                                                                                                                                                                                                                                              AGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCC
  5   1   2       bld DMZ  5g3  in                         xl284j17.5p                                                                                                                                                                                                                                                                                                                                                                                                                              AGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGAC
  5   1   2       bld DMZ  5g3  in                         xl285j17.5p                                                                                                                                                                                                                                                                                                                                                                                                                              AGTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCC
  5   1   2       bld DMZ  5g3  in                         xl317b11.5p                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAACATGGCAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATC
  5   1   2       bld DMZ       in                         xl322d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAGTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAA
  5   1   2       bld Ga12      in                         XL217f14.5p                                                                                                                                                                                                                                                                                                                                                                                                                                          GCACGAGGGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAA
  5   1   2       bld Ga12      in                         XL171j10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTTGTGGCTNTACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCA
  5   1   2       bld Emb1                   IMAGE:6631042-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACACGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAGACCCATCCAATTGCAAAACTC
  5   1   2       bld Emb1                            IMAGE:6631042.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTGGCTATCACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACACGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGGATGTGAACCATTACAGTCTTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAAAACCCATCCAATTGCAAAACTCAACGAGCCCAGAGGAGTACTCATTCATCACCTCCAACCCCCAAGCAATATCTGCAAGAAAAAGAAGATTGGACATTGAACTTTCAGGATGTTGGGATGGCAAAACCTGGGTCATGGCCCCCCCGGGGGTTACATGGGAAACCTACTGGCCATGGGAAAAGGGCCCCTTATCCCACTGGACGGAAAAAGCCTATAGGG
  5   1   2       bld Ga12      in                         XL196f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGGCTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGT
  5   1   2       bld Ga12      in                         XL211b12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACT
  5   1   2       bld Ga12      in                         XL190j10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAGACCCATCCAATTGCAAAACTCAAC
  5   1   2       bld Neu7      in                         XL016e23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCTTGCATGTTCTCCTTGCTTCTACTGACAAATTCATCTCCACTTACCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACC
  5   1   2       bld Neu2      out                   IMAGE:2943166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTGCTTCTACTGACAAATTCATCTCCACTTTCCTTCCAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGAAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTGTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGATGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGATATATATGCAAGCAGTGAACTTGCATGACGCAATCGATCATATGTAGTATGTGAACCAATACAGACTCTCATTACACTTCTCTGCTCACTGTGTTCCTCGACCCATCCATTGCTAACTTAACTAGCCAAGAGGAGTACTCAATTATCACCTGCTACCCCAAGCAATATCTGCAGAAAAAGAGATTGTACATAACTTCAAG
  5   1   2       bld Neu7      in                         XL031e22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTACCTTACAGGAAAGAATGCTCCTTAAAGCCTTGGGGCTGAACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACANTCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGNTCATATCGAGATCAAGGAACCATAGCNGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTCCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGT
  5   1   2       bld Ga18      in                       xlk72o16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACACCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGACATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGNAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCNACCCCAAGNAATATCTGNNGAAAAGGAGANTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGT
  5   1   2       bld Ga12      in                         XL197f16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCAGACCAAACCCCATTGCTCCAGCTCCTGTACCTAAATCTTTAAGAGAAATTTTTGAGAAGGGGATAAACCAGGACAATCCCTGCATGATGGAAGGTTTCGGAGTACCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCA
  5   1   2       bld Gas5                            IMAGE:3750526.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAATTCCCCTGGAAATATTGTCCGCTCATATCGAGATCAAGGAACCATAGCAGCCATAGAGGAGCCACAAGGATCTCTGTGCTTAAAGAAATTTCTCTTTTTTGACCTATCAGCAGTGGAGAACAAGGAGCAATTGACCCTAGGCCAACTGGAAATTAAGTTCAAGCACAACACATATTATGGACAACAGTTCCATCTCCGCCTCTACCGCACCCTTCAGCTATCTCTAAAAGGGATGAGAGACAGCAAGATGAACAGGAAGCTCCTGGTGACTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTNCAACCCCG
  3   1   2       bld Ga18      in                       xlk72o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GNNCCNTCAGCTNNCNNNAAAAGGNNTGAGAGACAGCNAGATGANCAGGAAGCTNCTGNNNNCTNAGTCTTTCCNNNTCCTTCACAANTCCNNNTNTTTCAACTTGACCAAGGTGGCAGANGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGANGCNATCGATCATTTGTAGTATGTGAACCAATACANTCTTTCATTTACNCTTCTCTGCTCNCTGTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCCAAGAGGAGTACTCATTCATCNCCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGNCTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGNANNNCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATNCCATGCGTNNNNNTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTNCCTGAAAATTCCNNGNNTTGCAAGNACAGCNGA
  5   1   2       bld Ga12      in                         XL179f04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCACGAGGCTCAGTCTTTCCGTCTCCTTCACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATAT
  3   1   2      seed DMZ  5g3  in                         xl317b11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACAAGTCCCTCTATTTCAACTTGACCAAGGTGGCAGAGGACTGGAAAAACCCTGAGAAGAATATGGGTCTGATACTGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTGCAAG
  3  -1   2       bld Bla2      in                    IMAGE:7296971.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGAAATATATGCAAGCAGTGAACTTGCAGGAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTNGGTACTGAGGCACTATGAAGATATGGTAGTGGAATGAGTGTGGTTGCAAGTGAGTTTGCTTCTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGATTTAACCTCTTACATAAATTATTGATAGACATATTATTTNGGGTGACTGCCTTTANGTGTTAGCAATGCATGCTGCTCTACAGACTCTGAGAACCATTAAANTAATGTGCATATGTTACTAAATGCAAACAGTGGCGATGCACTCATACATTGAAGTAAAAAACAGCGCNCAGTATGCTCTGACCCCCCCCCCCTCACAC
  3   1   2       bld DMZ  5g3  in                         xl284j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCAGTGAACTTGCAGGAGGCNATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCAC
  3   1   2       bld DMZ  5g3  in                         xl285j17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCANTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGNCTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACT
  3   1   2       bld DMZ  5g3  in                         xl293n03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAGGCAATCGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAAT
  3   1   2       bld Ga12      in                         XL179f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGATCATTTGTAGTATGTGAACCAATACAGTCTTTCATTTACACTTCTNTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGA
  3   1   2       bld Neu7                                 XL025k23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTTTCATTTACACTTTNTTCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACCGAGCCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGC
  5  -1   2       bld Bla2                            IMAGE:7299344.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTGAATGTGATGATACACGATCGGCATGTCTGTGTTGACATCGTTTCATAATCTTGTCAGTTCTCGACCTCATGCAACTCACGGCAGAGAGTATCTCATCCTCAACCCAGCATTTCAGAAAGGAGTGTCATGACTCAGGATGTGGAGGCAAATGGGTCATTGCCCCCGGGTTACATGGCAAATACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGATTGTTGGAAATAAATGTGATTTAACaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGGCCCGTACCCAATCGCCTAAGAGGCG
  3   1   2       bld Ga12      in                         XL194n15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTCTGCTCCACTGTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGAT
  5  -1   2       bld Bla2      in                    IMAGE:7296971.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGATGCGAGCATGTCTGTGATGGACATCAGTTTCATACATCTTGTCATGGTCTCGACATCATGCAAACTCACGACAGAGAGTATCATCATCACTCAACCCAGCATATCTGCAGAAAGGAGATGTACATGACTCAGATGTTGGATGCAGAACTGGTCATGCACCCNGTGTTACATGCAAACTACTGCCATGAGAGTGCCTTATCCACTGACGGAAATGCTAGGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGATTGTTGAAATAAATGTGATTTAACaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGATTGGGGN
  3   1   2       bld DMZ  5g3  in                         xl232g19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTGCTCACTGTGTCCCTCGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATGCCT
  3   1   2       bld DMZ       in                         xl322d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGCTCACTGTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACT
  3   1   2       bld Ga12      in                         XL211b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGA
  3   1   2       bld Ga12      in                         XL196f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTCCCTAGACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGAT
  3   1   2       bld Ga12      in                         XL171j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACCCATCCAATTGCAAAACTCAACGAGCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATATAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGC
  3   1   2       bld Ga12      in                         XL197f16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAATTGCAAAACTCANCGAGNCAAGAGGAGTACTCATTCATCACCTCCAACCNCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGNCTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGA
  3   1   2       bld DMZ                                 rxl272g11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAGAGGAGTACTCATTCATCACCTCCAACCCCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTANTGCCATGGAGAGTGCCCCTATCCNCTGACGGAAATGCTAAGGGGCACAAATCATGNTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTNCTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTNTATTTATTNTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTNACAGAGCTGCTGGATGAAACACATTNTTAAAAAAGTATATTGTNGTCACATAAATGTTTTTATCCTTATATATTGGGCATAGAG
  3   1   2       bld Neu7      in                         XL031e22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ACTCATTCATCACCTCCAACCNCAAGCAATATNTGCAAGAAAAGGAGATTGTACATTGACTTCAAGNAAGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGNTGTGCCCCCACTAAGCTGTCTCCTATNTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGNGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTNAACAGAGCTGCTGNATGAAACACATTTTTANAAAAGTATATTTGTTGTCAATAAATGTTTTTANCTTTATACATTGGGCATAGAG
  5  -1   2       bld Bla2                            IMAGE:7300111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCCTCCATGCAATCACGGCCAGAGATATCTTCTCCTCCACCCAGCATTTTCAGAAGGAGATGACATGACTCANGATGTGATGCAGACTGGTCATGCCACCCGGGTTACATGCAAATTATGGCATGAGAGTGCCCTTTCCCAGGACGAAATGNTAGGGGCACAATCATGCTGTTTACAGACTTTGTGCATTCTGTAGAACCAGAAACAACCCCATTGCCTTGCTGTGCCCCCANTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGGCTGATTGTTGGAAATAAATGTGATTTACCaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCTAAGATG
  3   1   2       bld Ga12      in                         XL217f14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAAGCAATATCTGCAAGAAAAGGAGATTGTACATTGACTTCAAGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGA
  3   1   2       bld DMZ                                 rxl270m11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGCAATATCTGCAAGANAAGGAGATTGTACATNGACTTCAAGGATGTTGGATGGCAGANCTGGGTCATTGCACNCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCNTGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCNTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTNTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTNACAGAGCTGCTGGATGAAACACATTNTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCCTTATATNTTGGGCATAGAGA
  3   1   2       bld Ga12      in                         XL190j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTCAAGGGATGTTGGATGGCAGAACTGGGTCATTGCACCCCGTGGTTACATGGCAAACTACTGCCATGGAGAGTGCCCCTATCCACTGACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTGAAAATTGCCTAGCACTTGCAAGTACAGCTGAT
  3   1   2       bld Neu7      in                         XL016e23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACGGAAATGCTAAGGGGCACAAATCATGCTGTTTTACAGACTCTGGTGCATTCTGTAGAACCAGAAAACACCCCATTGCCTTGCTGTGCCCCCACTAAGCTGTCTCCTATCTCCATGCTATATTATGACAACAATGACAATGTGGTACTGAGGCACTATGAAGATATGGTAGTGGATGAGTGTGGTTGCAAGTGAGTTTGCTTTGGAGATTGTTCTCATTCCCTTATCTAAGCCTTAAACTTATCCTCTAAAGGGACTGCTGCCAACCTAGTTATGAAGCCTCGCGCCTCGTGCGACAGTGACTTTAACCATCTTACATAACATTAATTGATAAGACTATATTTATTTTGGGGTGTACTTGCCCTTTAGGTGGTTTGGCAAATGCCATGCGTGGCTCTTAACAGAGCTGCTGGATGAAACACATTTTTAAAAAAGTATATTGTTGTCAATAAATGTTTTTATCTTTATATATTGGGCATAGAGCTAGGTTGGTGCCTAAAATGCCTAGCACTGCAAGTACAGCNATGTNGAAATAAATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)