Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl275e04.3                           17 END     15         25       88                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl275e04.3                           17 PI      85        747     1333                (no blast hit)

 This cluster: approximate FL confidence score = 79%

 1012768492 Xl3.1-XL438m04ex.5 - 58 ESTs
                                                                       .....-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL438m04ex.5                          GGCTACTGCTGGAGGCTTCATTGCATTGTGGGTGTCAGTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATT
                                                  Xl3.1-CHK-1012686370                                TGCTGGAGGCTTCATTGCATTGTGGGTGTCAGTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATTTATTAC
                                                      consensus depths                               2     2     2     3     2     3     2     4     4     6     4     6     7    10    11    14    13    18    18    27    20    28    23    31    23    33    24    34    26    35    28    36    29    38    34    40    35    41    41    41    40    41    42    42    42    42    40    42    42    42    42    42    43    43    43    43    42    43    41    43    42    43    43    44    43    44    43    44    43    45    44    44    44    44    43    44    41    43    40    43    40    43    38    43    38    43    40    43    39    42    38    42    39    42    34    41    36    40    37    40    25    40    36    40    37    42    35    41    35    41    32    40    31    38    30    38    30    40    32    40    24    36    25    36    27    37    11    25    13    26    14    26    13    25    12    25    13    25    13    25    13    25    11    24    12    22    13    21    13    20    12    20    11    18    11    16    11    15    11    15    10    15    10    15    11    15    11    15    11    14    10    13    10    13    10    13    10    13    10    13    10    13    10    13    10    13     9    13     8    12     8    12     7    12     8    12     8    12     8    12     8    12     8    12     7    12     8    12     7    12     4    12     8    12     7    12     7    12     6    11     6     9     3     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGCCAGATCGAT
                                                                   SNP                                                                                                                                                  A-----------
                                                                   SNP                                                                                                                                                                          ---------A--
                                                                   SNP                                                                                                                                                                                      ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                              ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                          -----A-----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                      -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                  -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                          -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------TA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A-C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      G-----T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---G--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----T-T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------C-A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---------CT-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------G
                                               BLH ATG     191     169                          
                                               BLH MIN     161      47                          
                                               BLH OVR     179      41                          
                                               EST CLI      81      21                          
                                               ORF LNG     179       1                          
  5   1   2       bld Te2  5x3                        IMAGE:7394670.5p TGAAGGGGGGCTGCCCAGGGACACGGGCTACTGCTGGAGGCTTCATTGCATTGTGGGTGTCAGTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATCAACAGAGTTTTCATTGAAAAGAGTTATA
  5   1   2       bld DMZ  5g3  out                        xl275e04.5p                          GGCTACTGCTGGAGGCTTCATTGCATTGTGGGTGTCAGTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACA
  5   1   2       bld Ga12 5g3  in                         XL218n20.5p                                CTGCTGGAGGCTTCATTGCATTGTGGGTGTCAGTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACAC
  5   1   2       bld Brn2 5g                          Brn2-za34c06.5p                                                             ttttttttgttttttGATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAG
  5   1   2       bld DMZ  5g3  in                         xl224p08.5p                                                               GTACATGTGACGCCATATCTGCCGGTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATNAACAGAATTTTCATTGAAAA
  5   1   2       bld Ga18      out                      xlk59f05ex.5p                                                                  TACATGTGACGCCATATCTGCCGGTNCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGNATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGNAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGNCGAAACAGAGCGTAATGNAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGANGGGNTCATCAAATGCATTTTGAATAATTTCTTTNNTCAAAGGCTGCTGAACACAAGATAAGATTTTACATATTAACAGANTTTCANTGAAAAGAGTNTACGNTATTNCTGGNTCtttttttttttNAGNG
  5   1   2      seed Ga15 5g3  out                      XL438m04ex.5p                                                                                       GTGCCGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttA
  5   1   2       bld Ga15 5g3  out                      XL409p09ex.5p                                                                                        TCCGGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCttttttttttttAANC
  5   1   2       bld Tad1 5x3                        IMAGE:6940433.5p                                                                                         GGGGCCGCTGTAAACAACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACCGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCCGATCTTTCTGCATACCAGATGGGGTTCTTCAGATGCATTTTTGAATAAAttttttttGTTTCAAAGGGCTGCTTGGAACACAAGGAATACCGATTTTTTACCCTATTAAAACCAGAAATTTTTCCTTTGGAAAAAGAAGTTTTATAAAGTTTATTTTAACCTGGGCCGtttttttttttttttttttttAAATCTCGAAAGTGCCAATGGGGGTTTCCCTGGGCGTAACATATTTGGTCTTTATATGGAAACGC
  5   1   2       bld Em10 5x3                        IMAGE:8321021.5p                                                                                            CGCCGCTGTAAACACAAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAG
  5   1   2       bld Tbd5 5x3               IMAGE:3579727-IMAGp.IMAGp                                                                                                      ATGGATTTCCCCCGGGGGAGGGAGAAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGGTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCttttttttttttttAAGCGAGTGGATGGTTTCTGCTACATTGCTTCTAAATTACAATATATTTACCTTTTATTCCATGTAC
  5   1   2       bld Em10 5x3                        IMAGE:7979854.5p                                                                                                           CAAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATCAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttAAGCGAGTGCATGGTTTCTGCTACATGCTTCTAAGTTACATATATTACATTTTATCATGTACTTACACAGCCGAGTCTACATTTATACATACTTTGTGTTTAAACCTGCAGACTTTTTGCATAATTGGTTGAACATTGGATTACGATGAAACTACGTT
  5   1   2       bld Ga15 5x3                           XL461c18ex.5p                                                                                                            AAAAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttAA
  5   1   2       chi Tbd7      in                         XL067c01.5p                                                                                                              AAGTGTCTGAGGGAGACAGACAAGAGCCGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTAAGAATTATATATTTTCCATCCCTTTGGTTTGTTTTTAAATCACAATGAAAGGGTCAGTTAGTAAGATGTGTCCAGTGAATCTAATTGATAATCATGGAACTTCTTTT
  5   1   2       bld Neu7 5g3  in                         XL016o24.5p                                                                                                                  GGNCTGCAGGNAATTCGGCACGAGGCTCCAGTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTC
  5   1   2       bld Egg3 5x3                        IMAGE:6323799.5p                                                                                                                     GATTCCCGGGCAGAAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttttAAGCGAGTGCATGGTTTCTGCTACATTGCTTCTAAGTTACAATATATTTACATTTTATTCATGTACATTAACACAAGCCGAGTCCTACCAATTTAATACAATACATTTTGTGTNTTTAAGGACACTGGCATGACtttttttttgccctatagattttgtggttggnaaatcaatttttgttttttttACCTTGGATTGGGAAATCCCTTTTATAAGTTTTTCAATTTaaaaaaaaGACCAAAATTTGGCAACN
  5   1   2       bld Tbd5 5x3                        IMAGE:3579727.5p                                                                                                                       AGGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAAAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCAT
  5   1   2       bld DMZ  5g3  out                        xl298i16.5p                                                                                                                        GGGAGACAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttNAA
  5   1   2       bld Ga18 5g3  out                      xlk54g11ex.5p                                                                                                                           GGAGNNAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNCCCGCCAGTAACCCCGGCTTGNAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGANTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGNCGAAACAGAGCGTAATGNAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGNCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGNTATTNCTGGCTCttttttttttttAAGCGAGTNCATGGNTNCTGCTACATTGCTTCTAANT
  5   1   2       bld Ga18 5g                           xlk137b22ex.5p                                                                                                                           GGAGNNAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNCCCGCCAGTAACCCCGGCTTGNAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGNTTCTAATAGTAATCAGGNTCCTCAGAGCAAGTATGCAGAACTTCNNTNNATCATTGAAGNGCTGGGNAAANAAA
  5   1   2       bld Ga18      out                     xlk156m14ex.5p                                                                                                                           GGAGNNAGACAAGAGCCNNTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNCCCGCCAGTAACCCCGGCTTGNAGGCTGGGAGTGCCCATTCCCCTTCAACAAGNATGGNATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGNATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGNAAAAGNGCTATGGAGAGATTTAAAAGAGGNATCATCCACGCTAGGGGCTTGGNCCGGGAATGTTTGGCCGAAACAGAGCGTAATGNAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGNCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAANNCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGNTATACGNTATTCCTGGCTCtttttttttttttAAGCGAGNNCATNGGTTNCTGCTACATTGCTTCTAAGTTANNNTATATTTACATTTTATTCATGTACNTTNACACAAGCCGAGNCCNANCAATTTNNTACAATACATTTTGTGTTTTAAAGACACTGCATGACttttttttNCCTATNGATTTNNGTTTNANATCATTTNNANTTNACTGGA
  5   1   2       bld Tad1 5g3  out                   IMAGE:6878329.5p                                                                                                                            GGGAGACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCTCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGANACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTTGATAATTTCTTTGTTCANAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAAGTATACGTTATTCCTGGCTCttttttttttttttAAACGAGTGCATGGTTTCTGCCACATTGCTTCTAAAGTTACCATATATTTTACATTTTAATTCCATGTTACCTTTAACACCAGCCCGAAGTCCCTTACCAATTTAAATTACAATAACATTTTTG
  5   1   2       bld Tbd7 5x3                             XL099j03.5p                                                                                                                            AATTCGGAACGAGGCTCCAGTGGATCTCAGGNACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTCTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAA
  5   1   2       bld Egg1 5x3                           PBX0071G05.5p                                                                                                                               GGCACGAGGGCGGGGATGGTTTCCAGGAAAGAAGTAAGCCCCCCGGGGTGAGAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACG
  5   1   2       bld Thy  5g3  out                   IMAGE:8550355.5p                                                                                                                                GACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttagcgagtgctggtttctgctacttgcttctaagtacatatattacatttatcatgtacatacacagcgagtctacatttatacatacattGTGTTAAGACCTGAGACTTTTTGCCAAGATTGTGTGAACATTTGATTAGGATGNATCTACGTTCATAAACATTGCCCTGTCAAATT
  5   1   2       bld Ga18 5x3  out                       xlk1m18ex.5p                                                                                                                                   ACAAGAGCCGCTCCAGTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGNATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGNAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGNTCttttttttttttttttttAAGCGAGT
  5   1   2       bld Gas5 5g3  in                    IMAGE:3748074.5p                                                                                                                                     GAGCCGATCCACTAGATCTCAGGACATTTTATTTGTTGTTGTTGCCATATTCCTGCCCTGTCTGCGGCGGTCATGTCTTTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGGCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGAGAATGTTNGGCAGAAACAGAGCGTAATGCAAGATCC
  5   1   2       bld FaBN 5x3                        IMAGE:8074676.5p                                                                                                                                                GTGGATCTCAGGACATTTTATTTGTTGTTGTTGCCGGATTCCTCCCCTCTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAGGCTGCTGAACACAAGATAAAATTTTACATATTACAGATTTTCTTGAAAGATTATAGTTATCCGGCTCtttttttttttAGCAGTGCTGGTCTGCACTTCTTTAGTACATAATTACTTTATCTGACTTACCAGCGATCTACATTATAATACTTGGTTTAGACCGAGATTTTTGCAAATGGTGATC
  5   1   2       bld Ga15 5x3                           XL479i05ex.5p                                                                                                                                                      CTCAGGACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCttttttttttttAA
  5   1   2       bld Ga18 5x3                          xlk132j06ex.5p                                                                                                                                                        TCTCANNNNNTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCNNNNNNCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGNATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTNNCATATCCAACCTTTCTGAAGCCAANNNNNTTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACGATTACGATTACGAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGNTATAAGTTATTACTGGCTCttttttttttAAGCGAGTNCATGGGTCCTGCTACATTGCTTATGAGNTACAATATATTTATGTTTTATNCATGTACATTAACACAAGNCGNGNCCNNNNAANTTAAATCC
  5   1   2       chi Tbd7      in                         XL068c01.5p                                                                                                                                                           GACATTTTATTTGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTANTNNTAATCAGGTGCCTCAGAGCANGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTANAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTAAGAATTATATATTTTCCATCCCTTTGGTTTGTTTTTAAATCACAATGAAAGGGTCAGTNAGTAAGATGTGTCCAGTGAATCTAATTGATAATCATGGAACTTCTTTTTGCTaaaaaaaaaTGCACCTGGNCGAAAAAGAAGATGTAAAGTCGCTAAAACTTCTATACTGATGCTCTGGCCCTGAACAGAGTAAGGAAACACTGGCAATATAGACAAAGATATTAACACAGCACAGGCAAATATCAGTGAAACCTACTGAAAAGAAT
  5   1   2       bld Neu7 5g3  in                         XL047i05.5p                                                                                                                                                                  TTTGTTGTTGTTGCCAGNATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGNAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACGATTACGATTACGAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCTT
  5   1   2       bld Ga12 5g3  in                         XL204f05.5p                                                                                                                                                                     GGGTTGTTGTTGCCAGATTCCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACACATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCtttttttttttttAA
  5   1   2       bld FaBN 5x3                        IMAGE:8077149.5p                                                                                                                                                                                 CGGTCCGGATTCCCGGGATGCGGCGGTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCttttttttttttAAGCGAGTGCATGGTTTCTGCTACATTGCTTCTAAGTTACAATATATTTACATTTTATTCATGTACATTAACACAAGCCGAGTCCTACCAATTTAATACAATACATTTTGTGTTTTAAAGACACTGCATGACttttttttGCTATAGATTTGTGTTGATATCA
  5   1   2       bld Ga12 5g3  in                         XL178k13.5p                                                                                                                                                                                        GCTCCCCTGTCGGCGGCGGTCATGTCTCTGGGAATGTCATACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCttttttttttttAAGC
  5   1   2       bld Tbd7 5g3  out                        XL079m16.5p                                                                                                                                                                                                          GTCATGTCTCTGGGAATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATTCATTTTGAATAATTTCTTTGNTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTT
  5   1   2       bld DMZ       in                         xl286f07.5p                                                                                                                                                                                                                CCATCGATTCGGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCttttttttttttAAG
  5   1   2       bld DMZ       in                         xl287f07.5p                                                                                                                                                                                                                  CATCGATTCGGTCTTACAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCGACAAGTATGGCATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCtttttttttttt
  5   1   2       bld DMZ       out                        xl308c23.5p                                                                                                                                                                                                                             CTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttNAA
  5   1   2       bld DMZ       out                        xl292n07.5p                                                                                                                                                                                                                             CTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttNAA
  5   1   2       bld Egg1                               PBX0038C04.5p                                                                                                                                                                                                                                          CCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCTTTGttttttttAAGCGAGTGCATGGTTTCTGCTACATTGCTTCTAAGTTACAATATATTTACATTTTATTCATGTACATTAACACAAGCCGAGTCCTACCAATTTAATACAATACATTGTGTGCTTTAAAGACACTGCATGACttttttttGCCTATAGATATGCGTTTGATATCAT
  5   1   2       bld Gas5                            IMAGE:3749191.5p                                                                                                                                                                                                                                                                                   CTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCGCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTATTTCTTTTTGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTCTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCT
  5   1   2       bld Ga12                                 XL210m04.5p                                                                                                                                                                                                                                                                                                                                              GTTAATGACTATGGACCTCCATCTTTAGGATATACACAGATATCTAATAGTAATCAGGTGCCTCAGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCttttttttttttAA
  5   1   2       bld Egg1                               PBX0113E09.5p                                                                                                                                                                                                                                                                                                                                                                                                              AGAGCAAGTATGCAGAACTTCTTGCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCTACATATGCTGGCAGTAAAAGTGCTATGGAGAGACTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTGCGGGAATGTTTGGCAGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCATATCCAACCTTTCTGAAGCCAACGGCTATTTCTTTCTGGATTTGTGAAAACGCCAGATCGATCTTTCTGCATACCAGATGGGTTCTTCAGATGCATTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACACAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCtttttttttttttAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTT
  5   1   2       bld Ga18      out                      xlk80c12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             TGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTAGCTCTGCCACGTCCCAACTTTCTGAAGCCAACAGCTAtttttttttGAATTTGCGAAAATGCCAGAGCTGTCTTTCTGCGTACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCttttttttttttttttAAGCGAGTNCATGGTTTCTGCTACATTGCTTCTAAGTTACAATATATTTACATTTTATTCATGTACATTAACACAAGCCGAGTCCTACCAATTTAATACAATACATTTTGTGTTTTAAGGACACTGCATGACttttttttgcctatagatttgtgtttgatatcattttgttttttACTTGATTGTAATCCTTTATAGTTTTCATTTAAAAAGACAAANTTGCAGCACCATGTTCGAGAATATTTTTCCCAGTAACTGATGTCACTTTTCGGGGAGAAGATTCTCGGATATATGGNANTTGCAAAATCTTTAAAAGTGCCCAACAAACAGTAGACGAGTATTGTTTATTTTCGGTNNGAGATTGANG
  3   1   2      shim Tbd7      in                         XL068c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTGCATACCAGATGGGTTCTTCAGATGCATTTTTGAATAATTTTTTTGTTCAAAGGCTGCTGAACGATTACGATTACGAAGATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTATAAGTTATTACTGGCTCTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCATGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTCTGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATGTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATAGGGATTGTATTACTGGTCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGTATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTT
  5   1   2       bld Ga18      out                     xlk139j22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNACCAGATGGGTTCATCAAATGCATTTTGAATAATTTCTTTGTTCAAAGGCTGCTGAACACAAGATAAGATTTTTACATATTAACAGAGTTTTCATTGAAAAGAGTTATACGTTATTCCTGGCTCtttttttttttttAAGCGAGTGCATGGTTTCTGCTACATTGCTTCTAAGTTACAATATATTTACATTTTATTCATGTACATTAACACAAGCCGAGTCCTACCAATTTAATACAATACATTTTGTGTTTTAAAGACACTGCATGACttttttttGCCTATAGATTTGTGTTTGATATCATTTTGTATTTTACTGGATTGTAATCCTTTATCGTTTTCATTTAAAAAGACAAATTTGCAGCACCATGTTCGAGAATATTTTTCCCAGTAACTGATGTCACTTTTCGGGGAGAAGATTCTCGGATATATGGAATTTGCAAAATCTTTAAAAGTGCCCAACAAACAGACGAGTATTGTTTATTTTCGGTTAGAGATTGAAGAGATTGAAGTATTGAAAGGGANTGTATAACTGGCCTATGCACTTGCATGTCTGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAAAAACGAGAACATTTACTTTTCTATAGGTGGATCTAGGNGTCTGCCATAACTGCAGNTAATATACACAAAAAGGCTGTGTTGGGAAAATGAAAACTAACAATTTGCATCTTTGTATCTANTNATTACTTGATGNAATAAAGCTTNTTTTCACTaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl286f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACGATTTTTACATATAAACAGAATTTTCATTGAAAAGAGTTNTAAGTTATTACTGGCTCTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCCGCCATAACTGCAATTAATATACACANAANGGCTGTGTTGGGAAAATAACTAACAATT
  3   1   2       bld DMZ       in                         xl287f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATACGNTTTTTACATATAAACAGAATTTTCNTTGAAAAGNGTTATAAGTTATTACTGGCTNTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCNGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTT
  3   1   2       bld Neu7 5g3  in                         XL047i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAAAAGAGTTATAAGTTATTACTGGCTCTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCATGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTCTGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATGTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGTCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGTATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTG
  5   1   2       add Egg1                            IMAGE:4783733.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAGTTATTACTGGNTCttttttttttttAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATTTCTTTTACTACATTGACTGTAATCCTTCGTAGTTCTTGTTTTTTTGTTCCTCAAAACGCGCAGGTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGA
  3   1   2       bld Ga12 5g3  in                         XL204f05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGNTTTTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATTTATTACTTAAGTAATAAAGC
  3   1   2       bld DMZ  5g3  in                         xl224p08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTNTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGCAAAATAACTAACAATTTGCATCTTGTATGATTATACT
  3   1   2       bld Ga12 5g3  in                         XL218n20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGGATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATTTATTACTTA
  3   1   2       bld Ga12 5g3  in                         XL178k13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTAAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATTAAGAAAAATATTGAAAGGGATTGTATTACTGGCCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGANCTAGGGATCGNCCATAACTGCAATTAATATACACATAAAGGCTGTGTTGGGA
  3   1   2       add Neu7 5g3  in                         XL016o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCATGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTCTGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATGTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATAGGGATTGTATTACTGGTCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGTATCTGCCANAACTGCAATTAATATACACATAAAGGCTGTGTTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATTATACTTAAGNAATAAAGC
  3   1   2       add Tbd7      in                         XL067c01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGCGAGTGCATGGGTCCTGCTACATTGCTTATGAGTTACAATATATTTATGTTTTATTCATGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTCTGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATGTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTGATTAGAGATAGGGATTGTATTACTGGTCTATGCACTTGCATGTTCGTAAACATATTTGCTAACCACTCAACATGCATGATTTATTTAAAGGAAAAATGAGAAAATGTACTTTTCTACAGGTGGATCTAGGTATCTGCCATAACTGCAATTAATATACACATAAAGGCTGTGTGGGAAAATAACTAACAATTTGCATCTTTGTATGTATTTATACTTAATGAATAAAGCT
  3   1   2      shim Gas5 5g3  in                    IMAGE:3748074.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTTTTATTCCTGTACATTAACACAAGCCGAGTCCTATCAATTTAAATCCATTCAGTTTGTATTTTCAGGACAATGCATGACTTCTTTTGCCTTTAGATTTGTGTTTGATATCATCTACTACATTGACTGTAATCCTTCGTAGTTCTTGTCTTATTGTCATTTAAAAAGACATATTTGCAGCTCCATTTTTGAGAACATTTTTTCCAAGTCACTGATGCCACTTTTCTGGGACAAGATTCTCTGATATATGGAATCTGCAAAATCTGCCCAAAAGTGCCCAAACAGTAGACTAGTAAGTGTTTATTTTTCATTAGACATTAAGTCAAATATTGAAAGGGACTGTATTCATGGCATAGGCCCTGGCATGTTAGTTCACATATTTGCTACCCACCCATCAGGCATGATTCATTTAAAGCAATAATGACGATATGGACTTTTCTCATGGTGGATGCAGGGGTCTGCCATAGCAGCAATTAAAAGACACATAAAGGGTGTGTTGGGTCAATAACTGACAGTTTGCATCTTTGTATGTATTTATGAGTTAATGTAATAAAGTTTATTTTCACACAAAAAAAAAAATAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)