Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8071819.5                      24 PI      92          4     1026                hypothetical protein LOC494694 [Xenopus laevis]

 This cluster: approximate FL confidence score = 92%

 1012768507 Xl3.1-IMAGE:3548521-IMAGp.5 - 39 ESTs
                                                                       .......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:3548521-IMAGp.5                            CCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTATATTTTATCTCCTGGTGGATTTGATTTGAATACAATTAAAACAAAAAAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTCAAACAGAATATATGGTCGGGTGTAGGACAATTTTGTCAATTGGTGCT
                                                  Xl3.1-CHK-1012687288                                  GCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTATATTTTATCTCxxxxxxGATTTGAxTxxAATACAAxxxxxxxAAAAxAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTCAAACAGAATATATGGTCGGGTGTAGGACAATTTTGTCAATTGGTGCTGCCTGA
                                                      consensus depths                                 6     7    13    13    20    21    20    21    22    22    22    22    22    22    22    22    22    22    22    24    22    24    22    24    23    24    23    24    26    27    26    27    26    27    26    27    27    27    27    27    27    28    28    28    27    28    26    30    30    30    30    30    30    30    31    31    31    31    31    31    31    31    31    31    34    34    34    34    34    35    36    36    36    36    35    37    37    37    37    37    37    37    36    39    36    38    36    38    32    37    31    37    29    36    29    36    29    36    30    36    29    35    29    34    27    34    28    34    26    34    26    34    25    33    26    33    24    31    20    29    20    27    20    27    20    26    19    24    19    24    18    23    17    23    17    19    17    19    15    19    16    19    15    17    14    17    12    16    11    16    11    15     4    12     4    11     3     7     4     7     3     6     3     6     3     6     3     6     3     6     3     6     3     5     3     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTATCTCAGCAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCAGCTGGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATACAACATTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATTTTTAAAAC
                                                                   SNP                                                                            --T---------
                                                                   SNP                                                                                                                            ----A-------
                                                                   SNP                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                    -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                        -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                -G--T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T------
                                               BLH ATG      20     600                            
                                               BLH MIN      20     103                            
                                               BLH MPR      -1     103                            
                                               BLH OVR      20      73                            
                                               EST CLI      15      39                            
                                               ORF LNG      20       3                            
  5   1   2       bld Te2N 5x3                        IMAGE:7206004.5p GGACAATAAGGTTGCGCTTCCGGTTGTCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTTTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGATCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTACCATACAGTGTTGGGATCACTCCAGATACTCCTCAGATTCTGAATGGGTTACCTTAAAAGTTTCGTTTAAAATTTTTTTAAGGTGGATTCAAGGGCATGAA
  5   1   2       bld Te1  5g                         IMAGE:6927977.5p                GGGTCCGGTTGTCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAACTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACATGTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGGAACAGTATGGGAGGGCCCATTAATGGGCCAGAGGGGAAGTTCACTGCATGTTCATATTCTAACCCAAAAACACCTATTGGGAAAGTCCTGGGAAGGGGAATATTCCATGAAAGCCCAAATTGTAGCCTGGTCCCCGGGAACTCCAGAAATGCCTCCCTTACTGGAAACCAATGGAATTTccccccccaccagaaagaactcccccaattttccccttttttccctttttaccccACTTAACCATGTTGTTTT
  5   1   2      seed Tbd3 5x3               IMAGE:3548521-IMAGp.IMAGp                   AAATTCCCCCGGGGAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGATTGGTTTTTATGGCCAGAAAAGAGCTGAGGTTTAACACT
  5   1   2       bld Te1  5x3                        IMAGE:6930514.5p                    GGGGTTGTCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCAAGAAGCCAAGTGAGCAATTCCCGGACTCAGAAAGCTCATACTGAACTATGAATGTCCACCCACCGAAGACTCCCA
  5   1   2       bld Te1  5g                         IMAGE:6930427.5p                       GGGGTCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAACTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAAGTCATGGAGGGGGAATTTCATGGAACCCAAGTGGAGCTGTCCCGGGACTCAGAAATGCTCATACTG
  5   1   2       bld Tad2                            IMAGE:6934560.5p                       GGGGTCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCCCCAATGTTAAGCCTCTCTATCACAGGGGAACAATTATGGGGAGGCCCCATTAAATGGCCCAAAAGGGAAGTTTCCCCGGCCATGGTCATTATTTCTAACCGAAAANCCAGCTAATTGGAAAAAGTCCTTGGGAAGGGGAATATTTCATGAAAGCCCAAATTTAGTCAATTCCCCGGAACATCCGAAAATGCCTCCATAACTGGAAAATTATAGAGGGTCCACCCCACCCAGAGGAAACTCCCCAGATTCCCCTTTGTTCCTTTAAACCCATTACCCACGTGTGTGGGGGAAATTCCCTCCCAGGGGGATCACTGccccccaaaaatcccccctaaagtgggttcccccctataaacaagttacacatacttccgaaaaaatatattttttaaaaaaGGGGGGAAATT
  5   1   2       bld Te2N 5x3                        IMAGE:7766839.5p                           TCCATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTTTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGATCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCCCCCACAGAGACTCCCACTCCCTTTCCTTACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGGTACCTTAAAAGTTCAGTTCAAAAATAATTTTAATGGGGAATTCAG
  5   1   2       bld Te2N 5x3                        IMAGE:7767079.5p                             CATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTTTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGATCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGATGCTCATACTGACTATGATGTCACCACAGAGACTCCACTCCCTTCCTTANCATACAGTGTGGGATCACTCAGAACTCTCAGATCTGATGGTACCTAAAGTCAGTCAAAA
  5   1   2       bld Te1  5x3                        IMAGE:6928924.5p                              GGGAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCCAGAGGGAAATTCACTGCATGTCATATTTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGAACTCAGAAATGCTCCTACTGAAACTATGATGGTCCCCCCCGAAGACCTCCCACTCCC
  5   1   2       bld Te2N 5x3                        IMAGE:7767239.5p                              ATCAGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGCTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTACTGGAAAGTCATGGAGGGGATATTCATGAAGTCAAGTGAGCAGTCCCGGACTCAGATGCTCATACTGACTATGATGTCATCACAGAGACTCCACTCCTTTNNCTACATCAGTNGTGGATCCTCAGAACTCTCAATCTGATGGTACTTAAA
  5   1   2       bld Tbd3 5g3  in                    IMAGE:3548521.5p                                 AGCCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGNATGACTGGACTGTTNTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTGAGACACACATGCACCAAAGGTTACGTCTCTATTCCAGGA
  5   1   2       bld Te2  5x3                        IMAGE:7210257.5p                                   CCGGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCCACTCCTTTCCTTAACATACAGTGTGG
  5   1   2       bld Te2N 5x3                        IMAGE:7765960.5p                                     GGTGACTGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTTTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGATCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTNANCATACAGTGNTGGGATCACTCANGATACTCCTCAGATCCTGAATGGGTACCTTAAAGTTCAGTTCAGAAATATTTAAATGTGGATTCAGGCCATGATTNGA
  5   1   2       bld DMZ  5g3  in                         xl258f19.5p                                         CGAGGAGATGACGAAGCCTCTNGATGGAGCCGGNTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCANGCAGCGGACAGCAGTCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGCATCCGTGGGCAAACCTCCNCTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGNCATATTCTAACCAAAACAGCTATTGNAA
  5   1   2       bld Te2                             IMAGE:7394731.5p                                           TGAAGATGACGAAGCCTCAGGATGGAGCCGGCTCTTTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGATCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTATTGGCCAGAGGGAAATTCACTGCATGTCATAATCTAACCAAAACAGCTATTGGAAAGTCATGGAAGGGAAAATTCATGAAACCCAATTGAGCCGTCCCGGGATCCAAAAGGCTCATTCTGAAACTAGAAGGtcccccccagaaaaccccccatccccTTCCCTTAACCAAACAAGGGGTTGGGAATCTCCCGGAAAACCCCCCAAAATCC
  5   1   2       bld Ga15 5x3                           XL456p02ex.5p                                             AAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATTGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCTGTCCCGGACTCANAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCANGATACTCCTCANATCCTGAATGGTTACCTTAAAAGTTCAGTTCANAAATATTTTAAATGTGGATTCAA
  5   1   2       bld DMZ  5g3  in                         xl239h10.5p                                             AAGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGCATCCGTGGGCAAACCTCCACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACT
  5   1   2       bld DMZ  5g3  in                         xl257f19.5p                                              AGATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGCATCCGTGGGCAAACCTCCACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACNATACAGTGTTGGGATCA
  5   1   2       bld Te2N 5g3  in                    IMAGE:7203342.5p                                                ATGACGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAACTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCTGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTTCAGGGCATGATTTGTATTGTTGCCCATTCTGCTTGGATTTGTTTTTATGGTCCGAAAAAAAGCCTAAGGTTTTAAAACTGGGGCAAGTTCCCTGGGAACAAAACCTTCTTTTCAAA
  5   1   2       bld Neu7      in                         XL004l18.5p                                                  GGCTGCAGGNAATTCGGCACGAGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGCATCCGTGGGCAAACCTCCACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCC
  5   1   2       bld Ga12      in                         XL171a19.5p                                                   GCGAAGCCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGG
  5   1   2       bld Ga12      in                         XL172j06.5p                                                                      CCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGAGCTTTGCCTCCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAG
  5   1   2       bld Ga18      in                       xlk51i04ex.5p                                                                                                                             CCGAGCTGTCCGTGGTGACCTGCGGCTCAGTGGTCAAGTTGCTCAATATCAAGCACAATGTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGNNNNNNTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGNCCATAAATGGCCAGAGGGAAGNTCACTGCATGTCATATTCTAACCAAAACAGCTACTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCATCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTNCCTTAAAAGTTCAGNTCAGAAATATTTTAAATNNGGATTCAAGGNCATGATTTNNATTNNTNCCCATTCTGCTGGNNTTNNTTTTNTGTCCAGAAANAG
  3   1   2       bld Ga18      in                       xlk51i04ex.3p                                                                                                                               AGCNNTCCGTNGTGNNCNGCNGCTCAGTNGTCAANTTGCTCANNNTCAAGCACAATNTCCGGCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGNGGACAGCAGTCTGTNACAGGCGTCACATCTGTAGACGATGGCAACAGNNNCTGGCGTATCCGTGGGCAANCCTCCACTGTATGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTACTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCATCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCNNTNNCTGGGACAAANCTNNNNNAATATTTNC
  3   1   2       bld Te2N 5g3  in                    IMAGE:7203342.3p                                                                                                                                                                                            GCTCCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCTGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTTATCTCAGCAGCTGGGATTGATCACTAA
  3   1   2       bld Te2N                            IMAGE:7202518.3p                                                                                                                                                                                               CCATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGCGTCACATCTGTAGACGATGGCAACAGTTACTGGCGTATCCGTGGGCAAACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTTATCTCAGCAGCTGGGATTGATCACTAGCATTN
  5   1   2       bld Lmb2                            IMAGE:8637151.5p                                                                                                                                                                                                 ATTCGCATGACGTTCGCTACGGTTCAGGCAGCGGACAGCAGTCTGTGACAGGAGTCACATCTGTAGACGATGGCAACAGTTACTGGCGCATCCGTGGGCAAACCTCCACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAAGTTTACACTGGGCATGTCCTGGGACAAGCTACTTTTATATATATTTATCTCGCAGCTGTGGATTGATACACATTTTAAACaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGCTGATCCTAACGCGCCAGCTCTCCTAATGGCGATACTGATCGATGAAGACTGTGATG
  3   1   2       bld Ga12      in                         XL168o06.3p                                                                                                                                                                                                                                                                      ATGGCAACAGTTACTGGCGTATCCGTGGGCAANCCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATTGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATACACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCTGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATT
  3   1   2       bld Neu7      in                         XL004l18.3p                                                                                                                                                                                                                                                                                                          CCACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTTAATATTATATTTTATCTCAGCAGCGGGGATTNAATACAA
  3   1   2       bld Tbd7                                 XL097k24.3p                                                                                                                                                                                                                                                                                                           CACTGTGTGTGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTTAATATTATATTTATCTCAGCAGC
  3   1   2       bld Ga12      in                         XL172j06.3p                                                                                                                                                                                                                                                                                                                                                        GCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGTATGTCCCGGGACAAAGCACTTTCAATATTTATCTCAGCAGC
  3   1   2       bld DMZ  5g3  in                         xl257f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                         GAAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTTAATATTATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTCAAACAGAATATATGGTCGGGTGTAGGACAATTTTGTCAATTGGTGCTGCCTGATT
  3   1   2       bld DMZ  5g3  in                         xl239h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                          AAACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTTAATATTATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTCAAACAGAATATATGGTCGGGTGTAGGACAATTTTGTCAATTGGTGCTGCCTGATTTTTATCTGCC
  3   1   2       bld DMZ  5g3  in                         xl258f19.3p                                                                                                                                                                                                                                                                                                                                                                                                                            ACCAGGAAGTCAGTGCATTTGGTGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATAAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAAAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTTAATATTATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTCAAACAGAATATATGGTCGGGTGTAGGACAATTTTGTCAATTGGTGCTGCCTGATTT
  5   1   2       bld Ga12      in                         XL168o06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           CATTTGGGGATGATTGGGAANGTGACATCCTGGATGACTGGACGGNTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATACACCAATGTTTT
  3   1   2       bld Neu7                                 XL001c24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                            GAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTGAAACATAATATATGGGTGGGTGTAGGATCATTTTGTCAATTGGTGCTGCCTG
  3   1   2       bld Ga12                                 XL176e09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTATATGTGATGGAGAATTCTGGCAAAGAGATGATGATGTCCGACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGNAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACANAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGNATTCAAGGGCATGATTTGNATTGTTGCCCATTCNGCNGGTATTGTTTTTATGTC
  3   1   2       bld Tbd3 5g3  in                    IMAGE:3548521.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCGACTTAGACACACTCCACCCAATGTTTTCTCTTCTATCACAGGGGAACAGTATTGGAGGCCCATTAATGGCCAGAGGGAAGTCCACTGCATGTCATTTTGTAACCAAAACAGCTATTGAAAGTCATGGAGGGGATATTCATGTAGCCAAGTGAGCAGTCCCGGACTNAGAATGCTCATATTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGCATGTCCCTGGGACAAAGCTACTTTCAATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAAAAAA
  3   1   2       bld Ga12      in                         XL171a19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTATGGGAGGCCCATTAATGGCCAGAGGGAAGTTCACTGCATGTCATATTCTAACCAAAACAGCTATTGGAAAGTCATGGAGGGGATATTCATGAAGCCAAGTGAGCAGTCCCGGACTCAGAATGCTCATACTGAACTATGATGTCACCCACAGAGACTCCCACTCCCTTTCCTTAACCATACAGTGTTGGGATCACTCAGGATACTCCTCAGATCCTGAATGGTTACCTTAAAAGTTCAGTTCAGAAATATTTTAAATGTGGATTCAAGGGCATGATTTGTATTGTTGCCCATTCTGCTGGTATTGTTTTTATGTCCAGAAAAGAGCTGAGGTTTAACACTGGGTATGTCCCTGGGACAAAGCTACTTTCAATATTTTATCTCAGCAGCTGGTGGATTTGAATACAACATTTTTAAAACAAAAATCCTGTGTTTTACTTAAAAGAAGCATGCAACAGGCTCACACAGTTTTCCTATGCTGAAACATAATATATGGGTGGGTGTAGGATCATTTTGTCAATTGGTGCTGCCNATTTTTATCTGCCNATAAAAACC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)