Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012768516 Xl3.1-IMAGE:6869702.5 - 184 ESTs
                                                                       .........-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6869702.5                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTGAGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTACTTTTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGAAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012685215                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCCTTTTCCTCGGTCAGTCACACAGTGAGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTxCTxTTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAxAxAxTATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTAAxxxxAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                   3     8     3     9     8    16    13    19    19    27    23    37    26    42    27    43    28    43    28    44    25    45    30    45    31    45    43    45    43    45    40    45    41    45    43    46    42    46    45    47    44    47    45    47    44    46    44    45    44    46    45    46    44    46    45    47    46    47    46    47    44    46    45    47    45    49    43    48    44    48    43    49    47    49    46    48    45    48    43    48    45    48    46    49    45    49    44    48    41    48    43    49    41    48    42    47    41    46    37    45    37    45    39    45    35    45    35    45    36    45    33    45    33    45    29    45    24    44    25    44    26    44    22    43    20    41    20    39    20    37    18    37    20    35    17    32    17    30    18    29    18    27    16    25    16    25    15    25    15    25    14    24    14    22    14    22    15    21    14    22    16    22    16    22    16    23    16    22    16    21    14    20    16    21    17    22    18    26    19    25    21    24    24    27    24    27    24    26    23    27    22    28    24    28    23    29    25    29    25    29    24    28    21    29    25    29    26    29    26    30    22    32    29    30    28    30    28    29    23    30    28    30    27    30    30    31    29    31    26    32    30    32    31    32    31    32    31    32    31    32    30    32    32    32    31    33    31    33    32    34    32    34    32    34    33    34    33    35    34    35    33    35    34    35    28    36    32    36    32    36    30    36    33    37    30    35    31    35    30    32    31    32    29    32    28    31    27    31    24    32    28    32    27    31    25    31    27    32    24    31    24    30    24    30    21    29    21    30    23    30    20    29    19    30    21    29    20    29    24    30    22    29    24    30    24    29    22    29    23    27    22    27    22    27    23    27    23    27    22    28    24    30    24    30    24    29    24    28    27    31    29    32    29    32    28    34    29    36    28    36    29    35    27    34    25    34    26    34    16    32    26    32    28    35    27    34    28    34    27    33    28    33    27    32    27    32    26    31    26    32    29    36    30    37    31    38    32    39    29    39    27    40    32    41    33    43    34    45    36    46    37    45    36    46    35    45    35    48    40    52    37    53    43    53    40    53    40    52    41    53    41    53    44    54    45    54    46    54    39    55    38    55    41    55    40    56    43    56    29    56    28    56    29    54    29    53    27    52    27    51    20    51    21    51    20    49    21    50    23    42    24    43    23    43    24    44    26    45    21    45    25    45    26    46    26    47    27    48    27    48    27    48    27    49    28    49    28    48    28    48    20    48    27    48    28    48    28    49    27    49    29    49    28    49    26    49    29    49    27    43    27    43    26    38    18    36    16    32    16    30     9    27    15    27    10    24     8    22     6    18     6    17     4    13     4     8     4     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCCTCGGTCAGTCACACAGTGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCATGTGAAGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGATGAGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGTAGACGTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGTAAGGGGT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T--T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------C---T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T---------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-----G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  T------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -G--------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------GT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C-----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-----C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----A--A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------A--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -T-----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C--C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T--A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -A--------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C--A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C-----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----T---A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C-----T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --------C--A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C-----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -------C-A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --A-------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      A-----T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                               BLH ATG     203    2580                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MIN     200     403                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH MPR     185     403                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               BLH OVR     203      34                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               CDS MIN     203     403                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               EST CLI      48      20                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                               ORF LNG     203       9                                                                                                                                                                                                                                                                                                                                                                                                                                              
  5   1   2       add Ov1  5g                         IMAGE:6315913.5p GCCATATTGGATTTGATGTGAATAAATTGCCCAGTCACGCCGCTCAGCCAGTTGAATGACAAGCGCTTCTTCCAATCAGCAGCAGACAGCTACCGGCTTCCTCCCCAAGCTCCGCGTTTGTTTCTCTTTTTGCAGCTTCTTCCTGGTGACCCGCCTCTTTTTTAATTTCTGACCAATCCGAACCGGCCAGACCCGCAGTTGCTAGGAGCTATTACGAAATACGCTGTAGCCTCCCGTGCGCCTTCAACTGTACCAACCAATAGGAAGCGGTCAGCGGGAAAGTGTCTAGAGGCGTGGCCTATTTCCCATCGTGCCTTTCTGCTCATCCGTCAGTTCTAGCCGCCGCTGATTGGCTGAGCTATTAAGACGCATGCGCAGACTGTGAAGAGTGATACTGCACTTTACCCTCCTGTGTGTGTAGTCCCTCCCAGCCGCCGGCGCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCANATCCGATGACTTGTCTACAGCAATCCTGAAGCANAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATNCATGANNGACACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGNTCCTGCTGAAGGNGAAGAAGAGGAGAGAAGCGGTTTGCATCGTN
  5   1   2       bld Ga15 5g                            XL490p24ex.5p                                                                                                                                                                                                                                                                                              TATCTCCCATCATTCCTTTCTCATCCCCCGTCAGTTCTGGGCCCCGCTGATTGGTTGCGGTGTTAAGACGCAAGCGCAGACCGTGAAGAGTGATGCTGCACTTTACCCTCCTGTGTGTCTAGTCCCTCCCAGCCGCCGGCGCTCCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAAACGAGTCCATGTTCTGCCCATAGACGA
  5   1   2       bld Emb1      in                    IMAGE:3401782.5p                                                                                                                                                                                                                                                                                                                                                       TGCGGTGTTAAGACGCAAGCGCAGACCGTGAAGAGTGATGCTGCACTTTACCCTCCTGTGTGTCTAGTCCCTCCCAGCCGCCGGCGCTCCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGATGCTGTTTGCATCGGTCTCTCAGATGACTCCTGCTCTGATGAGAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCGTCGAGATGTTATCAGCATTCAGCCGTGCGCACATGTGAAGTATGGCAGACGAGTCCTTGTGCTGCCCATAGACGACGCAGTGGAGGGC
  5   1   2       bld Te2N 5g                         IMAGE:7205429.5p                                                                                                                                                                                                                                                                                                                                                                 TCCCCGGGAATTTTCCCGGGATTGATGCTGCACTTTAccctcctgtgtgtctagtccctcccagccgccggcgctcctcctcctcctccttttcctcGGTCAGTCACACAGTGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCACTCACGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAGAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGCTGAGGGGAACCCATTAAGCTTGAAGATGAGGAGGATTCCCTGGATGAAGTTGGGCTTTACATGATTTTGAAGGCTCCAGGAAACCACCGGGTTTAGAATTTTAAAAG
  5   1   2       bld Te2  5g                         IMAGE:7390853.5p                                                                                                                                                                                                                                                                                                                                                                                   AAGAGTGATGCTGCACTTTACCCTCCTGTGTGTCTAGTCCCTCCCAGCCGCCGGCGCTCCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTNATCTCAGCCTTACTTCCTGGAAGCTACAGACCATCANGGAAGGTGACATTTTCAGGTACGCGGAGCATGAAGCCGTGGAGTCAAGTGGTGGAGACGATCTTCCCATCTGCATGTGGCCCCGAACGTCATCATGTGAGGGAGCCA
  5   1   2       bld Sp1  5g3  in                    IMAGE:4173702.5p                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCCTCCCAGCCGCCGGCGCTCCTCCTCCTCCTTTTCCTCGGTCAGTCACACATTGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAATCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACTACACAGTGGATGGCATCACTGGGAATCTGTTTGAGTGTATCTCAAGCATTACTTCCTGGAAGCCTACAGACCAATCAAGGATAGGTGACATTGTGCAAGTACGCGGAGGCATGAGAGCCGGGGAGTCAAAGGTGGTGGAG
  5   1   2       bld Ov1  5g                         IMAGE:6317166.5p                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAGCCGCCGGCGCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTTCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGGATGNAGGAGGAGTCCCTTTGAATGAAGTGGGCTTATGATGATATTGNGGAGGCTGCAGGA
  5   1   2       bld Sp1  5g                         IMAGE:5511601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTgagagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTTTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCTACAGACCATCAGGAAGGTGACTTTTCAGGTACCGGAGCTGAGAGCGTGGAGTCAAGTGGTGAACGATCTTCCCTACGATGTGCCCGATACGCTCATGGAGGGACCATAGCTG
  5   1   2       bld Ov1  5g                         IMAGE:8331233.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGCTCCTCCTCCTTTTCCTCGGTCAGTCACACAGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTNCAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTG
  5   1   2       chi Emb4                            IMAGE:5570653.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGGTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAAACAGAGTTGTCCCGTAACAACCTGAAGGGTGCCGGCGTCGGGAGATGTTATCCAGCATTTCAGCCCGTGCCCAGAATGTTGAAAGTATGGGCCAAACCGAGGTCCCATGGTTCCTGGCCCCATTAGGAACGAACAATGGtggggagggggcgattcacctggggggaaatcctggggtttggaagggggggAATCCTCCCAGGGAGCCTTTTTAACCTTTTCCCGTGGGAAAAGACCCCTTTACACACGGAACCCCGCACTTCCCACGGGAGAACAGAGGGGGGGAACTGATTTTTCTTTGCCCCGAGGCGTGAACCGCGCGGGGTAGGGGCCGTCTGGAGAGATAACCCCGCCTGGGAGAGAGCTTCACACAACGCCTGGGCGTGGCGAAAGAACCGTGTATATCACTTTTCACGCCCCATTAGCGTGAGGCCAATTGGTGGGGGGCGCCCCCCTGGAATATACACGCGGACCATGCCCACTTGTCGCGCAAAGGGGGGGAAGGCCCCACCTCAATAGCGGGGGTAGAAAAAGTAGACGGGAGCGGACATGCGCCTCTGAAGGTGGGAAAGGGGGGGCCCCTCGGATGGGAAACCGCGGCAGGGAGCCTGGCGAGGAAAAACGAAGAGAGGGCCCACGAACA
  5   1   2       bld Emb4 5g                         IMAGE:5570677.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAAGCCGTGGAGTTCAAAGTGGGTGGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACGTCATCCAATTGTGGAAGGGGAGCCCATTAAGCGTGAAAGAATGAAGGAGGAGTCCTTTGAATGGAAGTGGGGCTATGAATGGATATTGGGAAGGCTGTCAGGGAAAAACAACTGGGCTCAGAATTCAAAAGAAAATGGGTGGGAAAACTTGCCTTTT
  5   1   2       bld Te2  5g                         IMAGE:7210306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATGTGGCCCCGATACGTCATCATTGTGAAGGGGAGCCATAGCGTGAGATGAAGAGAGTCNTGATGAGTGGCT
  5   1   2       bld Tail 5g                         IMAGE:8544416.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCAGTCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAGGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCTGATCTGTCATCCATGTGAAGGGGAGCCATAGCGGAAGATGAGAGATCCTGATGAGTGGCTAGATGATATGAGCGCAGAACACTGCTAATCAA
  5   1   2       bld Tbd4 5g                         IMAGE:4059899.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCGGGCACACAGTgagagagagagaACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGNTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAAGAAAGGTGACATTTTCCAAGTACGCGGGAGCATGAGAGGCCGTGAAGTTCAAGTGGTGGAGACTGATNCTTTCCCATACTGCATTGTGGCCCCCGATACCGTCATTCCTTGTGAAGGGAGCCCC
  5   1   2       bld Ov1  5g                         IMAGE:6316135.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTTTTCCTCGGTCAGTCACACAGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAGCCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGGAGTATGGGAAGCGAGTCCATGGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCGAGCCTTACTTCCTGGAAGCCTACAGACCAGTCAGGAAAAGGGACATTTTTCGTGGTACGTGGAGGGATGAGAGCAGTGGGAGTTCAAAGTGGTGGGAGACGGATCCTTTCCCCATACTGGCATTGTGGGCCCCAGATAACCGGAAATCCATTTGTGAAAGGGGGAGGCCCAATTTAAACCCTGGAGGGATGCAAGAAAGGAAGTCCCTTGGGAAATGGAAAGTGGGGCTTAATGGAACGAACCATTTGGGGGGGCCCTGGCAGGGGAAAAACAAACCTGGGGCTTCTCCGAATTCCCAAAAGAAAAAAGGGGCGGGGGAAAACCTGGGCGCT
  5   1   2       bld Spl  5g                         IMAGE:8459996.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGTCAGTCCACAGTGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTNCAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGAAGGCATGAGAGCCGTGGAGTCAAAGTGGTGGAGACGGGATCTTCCCATACTGCATGTGGCCCCGATACGTCATCCATGTGAGGGGAGCCTATAGCGTGAGATGAGAGGATCCTGATGAGTGGCTATATATATGAGCTGCAGAACA
  5   1   2       chi Kid                             IMAGE:7008176.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCACGCGTCCGGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAATCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAGATCCGCATGAACAGAGTTGTCCCGTACACCCTGAGGGTGCGGCTCGGAAATGTTATCAGCATTCAGCCGTGCCCAGATGTGAATATGGCAAACGAGTCCATGTCTGCCCATAACGAACCCATGGGAGGGATCCCTGGGGATCTGTTTGAAGGGGTTTCCCAGGCCTTATTCCTGGAAACCCAAAAAACCATCCaggaaaggggaatttttcccgggccccggggggtgaaaacccgtgggattaaaaaggggggaaaagggttcctcccccaaacgggttggggcccccccaaaccccccccTTTGGAGAGGGGGGCCCTTTTAAGGTGAAAAAAGGGGGGCCCTTTAATGGGGG
  5   1   2       bld Spl  5g                         IMAGE:8460113.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAGTGAGAGAGAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCCGATCCGTCATCCATGTGAAGGGAGTCCATAGCGTGAGATGAAGAGAGTCCTGATGAGTGGCTAGATGATATGAGCTGCAGACACTGCTAATCAGAATGGTGATGCTCTAGCTCGCATCTAG
  5   1   2       bld Lu1  5g                         IMAGE:4056075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CACGCGTCCGGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGAACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGACGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGTCCAGATGTGAAGTATGGGCAGCGAGTTCCTGTGCTGCCTATAGACGAAACAGTGTAGGGCTTCACTGGGGAACTG
  5   1   2       bld Tbd7 5g                              XL093p18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGNAGAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAA
  5   1   2       bld Spl  5g                         IMAGE:8460865.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACACAGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCAGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCAGATACCGTATCCATGTGAAGGGGAGCATTAGCGTGAGATGAGGAGAGTCCTGATGAGTGGCTATAGACATGGGGCTGCAGACACTGCTCAATCAGAATGTGAC
  5   1   2       add Li1  5g                         IMAGE:3396992.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTGAAAGCGAGAGAACGGGCGCGCGGGACACACAGCGGAGCAGCGAGAGGAAACAGCGGGACAGACAGTCGTTCAGTGACCGCAGAGCTTGAGCCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGAACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACTGTTCTGCTGAATGGGAAGAAGAGGAGAGAGGCCGTTTGCGTAGTTCTCTCAGATGACACCTAGTTTGAGTGAAAGAT
  5   1   2       bld Sp1  5g                         IMAGE:5513037.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCACGCGTCCGGGGCATTACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTTTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTNAGCGTNGAGATGAAGAGGAGC
  5   1   2       bld Kid  5g                         IMAGE:7010274.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAATCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATGG
  5   1   2       bld Int2 5g                         IMAGE:8527422.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAATCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTAACATACCAGTCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAAAGTCGTGGAATTCAATTGGTGGATACGGATTCTTCCCATACTTGCATTGTGGCCCCCGAAAACGTCATCCTTGTGAAGG
  5   1   2       bld Emb4 5g                         IMAGE:4970059.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACGGGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTNAGCGTGAAGATGAAAGAGAGTCCNTGATGAAGTNGCTATGATGATATTGGAGCN
  5   1   2       bld Emb4 5g                         IMAGE:4680256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAGCCT
  5   1   2      seed Ga15 5g                            XL411h23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAA
  5   1   2       bld Egg3 5g                         IMAGE:6869702.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCGCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAAGCTAATGGTGTCAAGCCTCCCAAGGGGCATTCTGCTGTACGGACCCCC
  5   1   2       bld FaBN 5g3  in                    IMAGE:8075769.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGAGAACGGGCGCGCGGGACACCAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGAACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGACGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCGTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCCGTGGAGTTCAAGTGGTGGAGAGGATCCTTCCCATACTGCATGTGGCCCAGATACCGTATCCATGTGAAGGGAGCCATNAGCGTGAGATGAGGAGAGTCCTGATGAGTGGCTAGACACATGGGGCTGCAGAAC
  5   1   2       bld Gas4      in                    IMAGE:3420795.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGGCAGACAGCGGAGCAGCGAGGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACCAGGNNNCCGGNACCACTTGNACCAATTGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCCTGCAATCTTGA
  5   1   2       bld Emb4 5g3  in                    IMAGE:4960069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGGCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAAGAGAGAAGCCGTT
  5   1   2       bld Emb4 5g                         IMAGE:4930569.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCAGTGGAGTTCAAGTGGTGGAGACGGATCCTTCCCATACTGCATTGTGGCCCCAGATACCGTAATCCATTTGTGAAAGGGAGCCCAATTAAGCGTGAGGGGATGAGGAGGAGTCCCTTAAATGGAAGTGGGCTATGAACGACATTTGGGGGGCTGGCAGGAAAACAACCTGGGCTCAGAATCAAAAGAAGATGGGTGGAAACTGCCCTTCTCAAGGCACCCCGGGCCCCTCCTTTTTGGGCTATTTGGGGAGGTAAAAGCCCCTCCCCAGGGGGGAATTTTCCTGGT
  5   1   2       bld Te2  5g                         IMAGE:7389920.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCGGGGCAGACAGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACGTCATCCATGTGAAGGGAGCCATTAGCGTGAAGATGAGAGAGTCCTGATGAGTGGCTAGATGAATGG
  5   1   2       add Lu1  5g3  in                    IMAGE:4632889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGCCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAgggggggggAGAAGGCCGGACACCGAGTTTGGCTTCCGGATCAGATACCAAATCCGATGACTTGTTTACAGGAATCCTGAAGCAAAAGAGCCGGCCCAATTGGCTAATT
  5   1   2       bld Emb4 5g                         IMAGE:5571505.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGGGCGCGCGGGACACACAGCGGAGCAGTGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTATGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGGAGGGATGAGAGCAGTGGAGTTCAAAGTGGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCAGATACCGTAATCCCATTGTTGAAGGGGAGCCAATTAAGCGTGAAGAATGGAGAGGAATCCCTTGAATGAAAGGGGGCTATGAACGACATTTGGGGGCCTGCAGGAAAAACACTGGGCTCAGAATCAAAGAAAAggggggggAACTGGCCTTCTCCAGGAACCCGGGCCCCTTCTTTAAGGGCT
  5   1   2       add Ga18 5g3  in                      xlk163k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGAGAACGGGCGCGCGNNNACACAGNGNNGGCGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGNNNNGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGNNNNNACAGGCCGGACACCGAGTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGNTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGNATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAANCTGTTTGAGGTGTATCTCAAGNCTTACTTCCTGGAAGCCTACAGANCAATCAGGAAAGGTGANATTTTCCTGGTACGTGGAGGGATGAGAGCAGTGGAGNTCAAAGTGGTGGAGNNGNATCCTTCCCCATACTGCATTGTGGCCCAGATACCGTAATCCATTGTGAAGGGAGCNATTNAGCGTGANG
  5   1   2       bld Emb4 5g                         IMAGE:4679837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGACAGCGGAGCAGCGAGAGGAAAGAGCGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCTTTCCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGAC
  5   1   2       add Emb4 5g3  in                    IMAGE:4202579.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCGCGGGACACACAGCGGAGCAGGGAGAGGAAACAGCGGGACAGACAGTCGCTCAGTGACCGCAGAGCTTGAGTCGACACAGGGATCCAGCGCTCATTCTCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACCGATTATGGCTTCCGGATCAGATACCAAATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCNAATTGTGGANGAAATCATCAATGAGGACAACAGTGTGGTGTCGCCGCCTCAGGCCAAGAAGGACGAGCTGCAGttttttttAGGAGACACG
  5   1   2       bld Ov1  5g3  in                    IMAGE:8329458.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCGGAGCAGCGAGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGA
  5   1   2       bld Ga16 5g                              DN828614.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGCAGCGAGAGGAAAGAGATTTNCAGACCGGCGTTCAGGGAAGGGACCGNGGGGTGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCNCAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTTTGTCTCANGCCANGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAANAAGAGGAGAGAAGCTGTTTGCATCCGTTCTCTCANATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGANGGTNCTGTTCGGAGATGTTCATCAGCCATTTCAGCCCGT
  5   1   2       bld Neu7 5g3  in                         XL013j10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACGAGGGAGGAAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAATCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTC
  5   1   2       bld Emb4 5g                         IMAGE:5541829.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGAGAGGGACAGACCGGCGTTCAGGGAAGGGACCGCGGAGCGTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCANAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGGTGCAAGAAACAACTGGGCTCAGATCAAAGAAATGGTGGGAACTGCCTCTCAGGGGATCCCGGCACTTCTTTAAAGGCTATTGGGGGTCCAAGCCCTCCCCAGGGGGCAATCCTGGCTGGTACGGGAACCCCCCCAGGGGAAATTGGGCAAANAAACCCCTCCATTTGCGCAAGGAGC
  5   1   2       bld Emb4 5g                         IMAGE:5537065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGCCCACGCGTCCGGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGGTCATCCCTTTGTGGAAGGGGACCCCATTTAAGCGTGAAGATGAGGGAGGAGTCCTTTGAATGAAGTGGGGCTATGGATGATATTGGGAAGGCTGCAGGAAAACAACTGGGCTCAAATCAAAGAAAATGGGGGAAACTGCCCTCTCAGGGAATCCGGGAACTCTTTTAAGGCTATTTGGGGGTCAAACCCTTCCCAGGGGCAATTTTGGTTGGTAGGGGACCCCCAAGAAAATGGCCAAAAACCCCTCCTTTGCGTAAAGCTTGG
  5   1   2       bld Brn3 5g                         IMAGE:8539120.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGGACCGCGGAGTTTGAGGAGACACAGGGACCGAGCTCTCAATTTCAATTCCTCGTTACCGGCAGCGGAGCGGCACAGGCCGGACACTGACAATGGCTTCCGGATCAGATTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATTACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGNGCTATGATGATATTGGAGGCTGCGGGAAACAACTGGCTCAGAT
  5   1   2       bld Te2N                            IMAGE:7206318.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTGTCAGTCCCAGACAGTTCCAAATCCGATGATTTGTCCACTGCAATCTTGAAGCAAAAGAGCCGGCCCAACCGGCTGATTGTGGATGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGNCAAACCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCNNTGATNATGGACGGGAAATCATGAGCCAAGCCTGGCGGGGTGAGTTCTGAAGAGTAACTTGCCCCAAAAGCTTTTTAAGG
  5   1   2       bld Oo1                             IMAGE:5083767.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATCCGATGACTTGTCTACAGCAATCCTGAAGCAAAAGAGCCGGCCCAATCGGCTAATTGTGGATGAATCCATCAATGAGGACAACAGTGTGGTGTCGCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGACGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCGTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCAGATACCGTAATCCATTGTGAAGGGGAGCCAATTAAGCGTGAGGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGACGACATTGGGGGCTGCAGGAAACAACTGGCTCAGATCAAAGAGATGGTGGAACTGCCTCTCAGGCACCCGGCCCTCTTTAAGGCTATTGGAGTAAAGCCTCCCAGGGGAATTCTGCTGTATGGACCCCCAGGCACTGGGGAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACCCGGAGGCTTTCTTCTTCCTGGATTAATGGGACCCGGAGATCATGGAGCAAGCTGGGCGGGGTGGAGTCTGGAGAAGTAACCCTGGCGGCCAAAGCTTTTTGGAGGAGAGGCCTGGAAAAAGTAATGTGCCCCCTGGC
  5   1   2       bld Emb4                            IMAGE:5440116.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCCACGCGTCCGTGAATCCATCAATGAGGACAACAGTGTTGTGTCTCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACAGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCNCATGAAACTGGAGCTTTCTTCTTCCCTGATTATGGNACGGAATCATGAGC
  5   1   2       bld Ooc1      in                      xlnoc003a22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGTCTCAGGCCAAGATGGATGAGCTGCAGCTCTTTAGAGGAGACACGGTCCTGCTGAAGGGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGACGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGGACCCTGTTTGAAGTGTATCTCAAGCCTTACTTCCTGGAAGCGTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCAGATACCGTAATCCATTGTGAAGGGGAGCCAATTAAGCGTGAGGATGAGGAGAGTCCTTGAATGAAGTGCGCTATGACGACATTCGGGGCTGCAGGAAACAACTGGCTCAGATCAAAGAGATGGTGAACTGCCTCTCAGCACCCGGCCCTCTTAGGCTATTGAGTAAGCCTCCCAGGGATTCT
  5   1   2       bld Emb4                            IMAGE:5572247.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGCCCACGCGTCCGAGAAGAGGAGAGAAGCTGTTTGCATCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCANGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGGAATCATGAGCAAGCTGGGGGGTGAGTCTGAGAATAACCTGCGCAAAGCTTTTGAAGAGGGTGAAAAAAATGGCCCTGCCATCTTCTTTATAAACGAACTGGATGGCCTTTGccccccaaagaggagagaccccccggacagggggaaacccccGATTGGGGGTCTCGCCTACTAACCACTGAGTGGAGCGGCTTTAAAACCACCGGGCCATGGCCCTTGGTCAAGGGGAGGCCCCCCATCCAACACCACCAGGATT
  5   1   2       bld Int2                            IMAGE:8821015.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGCTTCGGGCTATCAGAGGAGGGCAACCCATACGAATTCGTCCCCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATTACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAAGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTACACTGATGGACGGCTGAACACGGCGCATGTCATGTCATGGCAGCCACCACGGACCACAGCATCGATCCAGCGCCTTAAGGCGGATTTGGTCGT
  3  -1   2       chi Bla2      in                    IMAGE:7297052.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAGGGGAAGAAGAGGAGAGAAGCTGTTTGCGTCGTTCTCTCAGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAACAACCTGAGGGTGCGGCTCGGAGATGTTATCAACATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGTAGGCATGAGAGCCGTGGAGATCCAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGACCCCCGATGCCGACGTCCATTGTGAAAGGGAGTCCATTAAGCGTGAAGATGAGAAGGACTCCTTGAATGAAGTGAGCTATGATGATATTGGATGATGCATGAAACAACTGGCTCAAATCAAAGAAATGATGGAACTGCCTCTCAGGCATCCGGCACTCTTTTAAGTTATGGATATCAAGACTCCCGGTGCCTTCGCCTGTTATGTCCCCGAGAACATGGAAAACCCCCTTCCTAGATTTTTTCAATTTAATCTTTTACTTGCGTCCTCGTAACTACGACCGTAATCTGAATACCTATCTTTTATACGACTTCACCTTAGANAANTTTATGTCGTAA
  5   1   2       bld Em10                            IMAGE:7982190.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGAAGAAGAGGAGAGAAGCCGTTTGCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCAGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCAGATACCGTAATCCATTGTGAAGGGGAGCCAATTAAGCGTGAGGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGACGACATTGGGGGCTGCAGGAAACAACTGGCTCAGATCAAAGAGATGGTGGAACTGCCTCTCAGGCACCCGGCCCTCTTTAAGGCTATTGGAGTAAAGCCTCCCAGGGGAATTCTGCTGTATGGACCCCCAGGCACTGGGAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAGATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACTGCGCAAAGCTTTGAGGAGCTGAGAAGAATGCCCTGCATTATCTTATAAACAGCGGATGCATGCTCTAAAGAAGA
  5   1   2       bld Emb9      in                    IMAGE:7976301.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCATCGTTCTCTCAGATGACACCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAATAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCCTGCCCAGATGTGAAGTATGGCAAGCGAGTCCATGTTCTTCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCTGGTACGTGGAGGGATGAGAGCAGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCAGATACCGTAATCCATTGTGAAGGGGAGCCAATTAAGCGTGAGGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGACGACATTGGGGGCTGCAGGAAACAACTGGCTCAGATCAAAGAGATGGTGGAACTGCCTCTCAGGCACCCGGCCCTCTTTAAGGCTATTGGAGTAAAGCCTCCCAGGGGAATTCTGCTGTATGGACCCCCAGGCACTGGGAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAGATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGNCAAGCTTTTGNAGAGGCTGAGAAGAATGCCCCTGCCATTATCTTATAGACGAGCTGGATGCCATTGCTCTAAAAGAGAGAGACACCGGAGAGTTGAACGCGTATGTGTCAAGTACTACACCATGATGGCTCAACAACGTTCAG
  5   1   2       bld Tail                            IMAGE:8544915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCTCGATGACTCCTGCTCTGATGAAAAGATCCGCATGAACAGAGTTGTCCGTAAAAACCTGAGGGTGCGGCTCGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAACCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACAGATCCTTCCCCATACTGCATTGTGGCCCCTGATACTGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCATTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATGCCCCCAAAGAGAGAGACCACGGAGAGGTGAGCGCGTATGTGTCTCACTCTACACTGATGACGACTGAACACGGCGCTGTATGTCTGCAGCCACACGACCACACTCATCACGCTAGCAT
  5   1   2       bld DMZ       in                         xl224k05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGAGATGTTATCAGCATTCAGCCGTGCCCAGATGTGAAGTATGGCAAACGAGTCCATGTTCTGCCCATAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGAC
  5   1   2       bld FaBN                            IMAGE:8074583.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACGAGTCCATGTTCTGCCCTAGACGACACAGTGGAGGGCATCACTGGGAATCTGTTTGAGGTGTATCTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACACGGGCGCATGTCATGTCATGCAGCCACCACCGACCCACAGCATGATCAGCGCTANGCGATTTGTCGTTTTGACGGAGGTGATTCGCATCCC
  5   1   2       bld Emb9                            IMAGE:7974230.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAAGCCTTACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCTTGGCAGCCACCAACCGATCCAACAGCATTGATTCAGCGCTTAGGCGATTTGGCCGTTTTGACCGGGAAGTTGAAATCGGCTCCCGGACTCCACTGGAGTCTGGAATCTGGCAATTCATCTAAAAACTGATCTTTCGGAGATTGGATCTGAACAGTTCTATGAAC
  5   1   2       bld Brn2                             Brn2-za99e04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTTCCTGGAAGCCTACAGACCAATCAGGAAAGGTGACATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACCTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAG
  5   1   2       bld Emb9                            IMAGE:7977438.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATTTTCCAGGTACGCGGAGGCATGAGAGCCGTGGAGTTCAAAGTGGTGGAGACGGATCCTTCCCCATACTGCATTGTGGCCCCCGATACCGTCATCCATTGTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAAACATGAAGCTTTCAGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGTTGCCGATTTGGCTGCTCTGTGCTCAGAGCTGCTCTCCAGGCATACGAGAGATGGACCTCATAGACCTGGAAGATGAAACATAGAATGTCTGAGAGTGTAA
  5   1   2       bld Te2                             IMAGE:7394541.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAAGGGGAGCCCATTAAGCGTGAAGATGAGGAGGAGTCCTTGAATGAAGTGGGCTATGATGATATTGGAGGCTGCAGGAAACAACTGGCTCAGATCAAAGAAATGGTGGAACTGCCTCTCAGGCATCCGGCACTCTTTAAGGCTATTGGTGTCAAGCCTCCCAGGGGCATTCTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGG
  5   1   2       bld Emb4                            IMAGE:5572397.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAGTCCTTGAATGAAGTGGGCTATGACGACATTGGGGGCTGCAGGAAACAACTGGCTCAGATCAAAGAGATGGTGGAACTGCCTCTCAGGCACCCGGCCCTCTTTAAGGCTATTGGAGTAAAGCCTCCCAGGGGAATTCTGCTGTATGGACCCCCAGGCACTGGGAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAGATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATTATCTTTATAGACGAGCTGGATGCCATTGCTCCTAAAAGAGAGAAGACACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGCGCACACGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTTGATATCGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCTGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGGAAGAAGATGGACCTCATAGACCTGGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGGCACTATGGATGACTTCAGGTGGGCGCTTAATCAAAGTAACCCCTCGGCTCTACAAAAAACCCTTGGGGGAAGGGCCCCAGGTCCACTGGGAGAGGATATTGGGGGGTCTG
  5   1   2       bld FaB                             IMAGE:8070049.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGCTGTACGGACCCCCAGGAACTGGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACGATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCANG
  5   1   2       bld Em10                            IMAGE:7979054.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAGATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATTATCTTTATAGACGAGCTGGATGCCATTGCTCCTAAAAGAGAGAAGACACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTCGATATTGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCATCGGCTCTACGAGAGACCGTTGTGGNAGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGAAGACGTCAAGAGGGAGCTCCAGAGCTGGTTCATATCCTGTGGACATCCAGACAGTC
  5   1   2       bld Em10                            IMAGE:7983129.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGCAAAACCCTCATTGCTAGAGCTGTGGCCAATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACTCAAGAGGGAGCTCCAGGAGC
  5   1   2       bld Em10                            IMAGE:8318989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCCATGAAACTGGAGCTTTCTTCTTCCTGATTAATGGACCGGAAATCATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAG
  5   1   2       bld Kid                             IMAGE:7010861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATGAGCAAGCTGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATTATCTTTATAGACGAGCTGGATGCCATTGCTCCTAAAAGAGAGAAGACACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTCGATATTGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCCATCAAGGGTGTCCTATTCTATGGTCCCACTGG
  5   1   2       bld Spl                             IMAGE:8461645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGCGGGTGAGTCTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTGCTGGCTANNGCATTGCNNNACGATGCAGCNACTTCATCTCATCAAGGGCNGAACTCTCCTATGG
  5   1   2       bld Emb9                            IMAGE:7974912.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCGGTCCGGATTCCCGGGATAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCACGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAACTGGTTCAGTATCCTGTGGAGCATCCAGAACAATTCCTGAATTTCGGAATGACTCCATTCAAGGTGTACTTTTTACGGTCCCCCTGGAAGTGGTTAGGACTTTGCGGGTAAAGCCTT
  5   1   2       bld Ooc2      in                    IMAGE:3746375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGAGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATTATCTTTATAGACGAGCTGGATGCCATTGCTCCTAAAAGAGAGAAGACACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTCGATATTGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTNTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCATGTCACATGGGAGGATATTTGGTGGTNTTGAGACGTCAANAGGGAGCTCCAAGAG
  5   1   2       bld Brn1                            IMAGE:6954730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTGAGAGTAACCTGCGCAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATTATCTTTATAGACGAGCTGGATGCCATTGCTCCTAAAAGAGAGAAGACACACGGAGAAGTTGAACGGCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCACGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTTGATATCGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTCCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAAGCCAATGTCC
  5   1   2       bld Brn1                            IMAGE:6951968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAGAGTAACCTGCGCAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAAAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAAGTGCCCCAAGTCACTTGGGAAGATATTGGTGGTTTGGAAAACGTCAAAAGGGAGCCCCCGGAACTGGTTCAGTATCCTGGGGAACATCCAGAAAATTCCCGAAATTCGGAATGACTCCCCTTGAAAGGAGTAATTTTTCACCGTCCCCCCTGGATTTGGTAAAAACTTTTGCCTGGCTAAGGGCCATTGCCCAAAGCAATGCCCCGGGCCAACATTCATCCGTCAATCAAAAGGGCCGAAAACTTCCTTACCTTTTTGGTTTTGTGAATAGTATCGTAGACCCAATGGTTTAGAACAAAACTTTTCAACAAAAGACTCCATTAAGGCTGGACTCACCTTGA
  5   1   2       bld Tail                            IMAGE:8545928.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGAGTAACCTGCGCAAAGCTTTTGAGGAGGCTGAGAAGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGACTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTGACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGAGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGATGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGATAAGTTCCTGAAGTTCGGATGACTCATCGAAGGTGTACTTTCTATGGTCACTGGATGTGTAGACTTGCTGCTANGCATGNCACGATGNCAGCACTCTCTCATCAAGGCGACTCTCCTAGTGTTGGAATCGAGCACGTAAAATCTGATAGTCGAGTGTCTGGT
  5   1   2       bld DMZ       in                         xl336h10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCAGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCANGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGNTCAGTATCCTGTGNAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCC
  5   1   2       bld DMZ       in                         xl229d22.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCAGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACG
  5   1   2       bld DMZ       in                         xl232a06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCAGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAA
  5   1   2       bld DMZ       in                         xl282p09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAATGCCCCTGCCATCATCTTTATAGACGAGCTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCCCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCAGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCNTCGAAGGGTGTACTTTTCTACGGTC
  5   1   2       bld Te2                             IMAGE:7393093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGATGCCATTGCCCCCAAAAGAGAGAAGACACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAANGGCATTGCNACGAAATGCAGCAACTTCATCTCATCAAGGGCGGAACTCTCATATGTGTTTGGAAGTCTGAGCATGTAGAGAATCTTGATAGCTCGCAGCTGCTCTGTGTCTCTCTGAGAATGACTCACCTA
  5   1   2       bld Int2                            IMAGE:8527956.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTGCTCCAAAAGAGAGAAGACACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTCGATATTGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCATCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTCTCACTATGTGGTTTGGAGAGTCTGAANGCAACGTCCGAGAGA
  5   1   2       bld Ov1       in                    IMAGE:5073622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCACGCGTCCGCACACGGAGAAGTTGAACGCCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGCGCACACGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTTGATATCGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCTGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTTAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAG
  5   1   2       bld Spl                             IMAGE:8463503.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGAGAGAAGAACACGGAGAGGTGGAGCGCCGTATTGTGTCTCAGCTACTAACACTGATGGACGGGCTGAAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGTCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAA
  5   1   2       bld Spl                             IMAGE:8460194.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAGTTGAACGGCGTATTGTGTCCCAGCTACTAACACTCATGGATGGGCTCAAACAACGGGCTCACGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTTGATATCGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTCCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCCATCAAGGGCCTGACTTCTCACTATGTGGTTGGGAGAGTCTGAGGCCNATGTCGAGAGATATTGATANGGCTCGCAGCTGCTCCTGTGTNCTCTCTTGATGAATGACTCATCGCTAGTCGAGTGGGACATGAGATGGGG
  5   1   2       bld Int2                            IMAGE:8822112.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACAACGGGCGCATGTCATTGTCATGGCAGCCACCAACCGACCCAACAGCATCGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTAGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGAGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTATGGTCCACCTGGATGTGGTAAAACTTTGCTGGCTAAAGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGCCAACGTTAGAGAGATCTTTGATAAGCTCGGCAGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAGCCCGAGTGGGAACATTGGAGATGGTGGTGGAGCTGCTGACGAGTATACCAAATCCTACTGAGAATGGATGATGTCTACAGAGATGTCTCATCATCGAGCACACCGACAGATATCATCGACCTGCATCTGCGTCTGACGTCTAGATCAGCTCATACTCCGCTGGCGATGAAAGTCGCATGGGCCATCTGAGGGCCACCTGAAGAGGAGTC
  5   1   2       bld Ooc1                             Ooc1-db30c12.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGTCGACCCACGCGTCCGCCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTCGATATTGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCATCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTT
  5   1   2       bld Bone                            IMAGE:8743350.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACCCAACAGCATTGATCCAGCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGCCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACGATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAAGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCCAACGAATGCCAGCCCAACTTCATCTCCATCAAAGGGCCCGGAACTTCTCACTATGTGGGTTTGGAGAGTCTGAGCCAATGTTAGAGAGATCTTTGATAAGCTCGGCAGCTGCTCCCTGTGTCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGTGGGAACATTGAG
  5   1   2       bld Lmb1      in                    IMAGE:8531479.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACCCACAGCATCGACCCAGCGCTTAGGAGATTTGGTCGTTTTGACAGGGAGGTTGATATCGGAATCCCCGACTCCACCGGACGCCTGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGG
  5   1   2       bld Kid                             IMAGE:4032149.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACGCGTCCGCTTAGGCGATTTGGTCGTTTTGACCGGGAGGTTGATATCGGCATCCCCGACTCCACTGGACGGCTGGAAATCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCACAAGCTGCTCTCCAGGCCATAAGGAACAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGACACTATGGATGACTTCAGGTGGACGCTAAGTCAGAGTAACCCCTCAACTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGATGGTTTGAAAGACGTCCAGAAGGAGCTCCAGGAGCTGGTTCAGTATCCTGAGGAGCATCCAGACAAGTTCCTGAAGCTCGGAATGACTCCATCGAACGGTGTACTTTTCTACGGTCCGCCTGGATGTGGGAATACTTTGCTGGCTAACGACATTGCCAACGAATGCCACGCCAACTTCATCTCCATCAAAGGCACGGAACTTCTCACTATGTGGTTTGGAGAGGCTGAAGACAATGTTAGAGAGATCTTTGATAATGCTCGGCAGGCTGCTCCCTGTGACCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCTAGGTGAGAACATTGGAGATGGCGATGGAGCTGCCGACAGAATTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTGACAACAACAATGTCTTCATCATTGGAGCCCACATCAGACCAGACGTCATCGACCCTGCCAGTCTGCGTACTGACCGTCTAGATCAGCTCATGTACATCCCCTGGCCCGATGAGAACGTCCCGCATGGGCCAC
  5   1   2       chi Int2                            IMAGE:8821797.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAACGTAGATTCATCACGTATTCAAACTTTTTCTGAATTCGTCCCCTGCAGATTCATACTAAGAACATGAAGCTTTCGGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCACAGACCAGACATCATCGACCCTGCATCTGCGTCCTGGCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAGTCCTGCCATGTCATCTGAAGGCACTGAGAAGTCTCAGAGCAGGACTAAACGTCACTCTGTCAGATGACATTGAATCTCTCAGGTGCCGATATGCA
  3  -1   2       bld Bla2      in                    IMAGE:7296168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGAAATCCTGCAGATTCACACGAAGAACATGAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCACGGACATGTAGGTGCTGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTTAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCACGTCCGAGAGATATTTGAAAGGCTCGGCGGCTGCTCCTGTGTCTCTTCTTGATGATTGGATCCTCCTAAGCTCGAGTGGACATGAAAATGGGGTGGACTCTGACAATATTACAATCTATGAATGACGATGCATAAAGATGCTCTCTCGACACACAACAATTCTACGCTCTGTCTGCTCATATCTATCCTCATAATCTAGCCAGCCTGA
  5   1   2       bld FaB                             IMAGE:8073910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGCTTTCTGATGATGTGGATCTGGAACAGGTTGCTAATGAAACCCATGGACATGTAGGTGCTGATTTGGCTGCTCTATGCTCAGAAGCTGCTCTCCAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCATCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACCAGTTTCTTGAAGTCGGAATGACNTCCTCAAAGGGTGTCCTAATCTATGGTCCACCTGGTTGTGTAAAGACTTTGCCTGGCTAAGCCATTGCCAACGAATGCCAGGCCAATTTCTTCTCCTTCAAGGGCCCGGACTTTTCTCCTTTGGGGTTGGGAAGTTTGAACCCAACTTCCCAAAAAATATTTAAAAGGGCTGGGGGGGTTGCCCCGGGGGCCCTCTTTTTGAGAAATGGGAAccccccccaaagccccgggggggaactttaaatagggggggggaccccttccaatttttttccccattctttcggggggggggggggtttttaagaaaaaatttttttttttgggccccaaaaaaaaaaaT
  5   1   2       bld Em10                            IMAGE:7982103.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAACAGGTTGCTAATGAAACCCACGGACATGTTGGTGCCGATTTGGCTGCTCTGTGCTCAGAAGCTGCTCTCCAGGCCATAAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCAATTACATCCCGCTG
  5   1   2       bld Te2                             IMAGE:7209601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGGCCATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCATCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACTN
  5   1   2       bld Em10                            IMAGE:7980421.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CATCAGGAAGAAGATGGACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTTAGTCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGG
  5   1   2       bld Spl                             IMAGE:8460471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTCATAGACCTGGAAGATGAAACCATAGATGCTGAAGTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCGCATGGCCATCTGAANGCCACTGAGGAGTCTCAGTTGCAGGACTAGACTCACTTCTGGCAGATGACATGGATCTCCGTGCGTCTGATGAATTGCAGCAGCTGTACTGGCTCAGGATCATGAATAGTCGAGAACGGAAGGACTACTCCTAGATGAGAACACGTCGAT
  5   1   2       bld Emb4                            IMAGE:5543058.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTGATGAATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCCTCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCACGATGAGAAACCCCGCATGGCCATCCTGAAGGCCCACCCTGCGGAAAGCCCCTTCTCGCCCAAGGTACGTCTACCTCTTACTCTCGCGCCCTAAAAAGGCCCAAGGCCTCCCCCCGGGGCCGAAGACATTTTGGCCTTTTCCCCCCGCCCTCCCTACACCCGTGGCCCTCTCGCTTGCCCTCCATCTTCTCCCCGTCCACCCCCACTGCGCGCGGGCGTACAGGTCCATACACACCTCTTGTCTCCATATCTGCGACATTCCCCTCGCCATCTTCTGGCTACCACCATTCAGTCCGCGCTACTGCTATATCCCC
  5   1   2       bld Emb1                            IMAGE:6634293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTCTTTGGCTGTCACTATGGATGACTTCAGGTGGGCGCTAAGTCAGAGTAACCCCTCAGCTCTACGGGAGACCGTGGTGGAGGTGCCGCAGGTCACTTGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCGAAGGGTGTACTTTTCTACGGTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCCGGGCCGGTCTGACTGAGATTTGCCCAGCGAGCCTGTTAAACTGGGCCATCAGGGAATCCTATTGGAGATTGAAGATTCCGAAAGAGAGCGGGAAAAGGGCAGAACATTAACCCCTTCCCCGCTATTGGGAAAAGA
  5   1   2       bld Ga18      in                      xlk161l06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCAGAGTAACCCCTCGGCTCTACGAGAGACCGTTGTGGAGGTGCCNNNGNNACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGNCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGNNAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAANATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGNCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGANCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGNCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGNNG
  5   1   2       bld Emb1                            IMAGE:6633241.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGCAGGTCACATGGGAGGATATTGGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCCTCCGCTATGGAAGTTGGAAAGAGGACGACCCCGNTACCCGGAAATCCGGCAGGGGATCACCTTTGGAAGAA
  5   1   2       bld Eye1      in                    IMAGE:6948531.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTCCGGAATTCCCGGGGATGTGGTTTGGAAGACGTCAAGAGGGAGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAAAAGACGACCCCGTACCGGGAAATCCGCCAAAGATCACTTTGAAAGAGGGCCATGCGATTCGCCCCGCCCGCTTCATTCCGCGAATAAACGATAATCCGGCAAATAACCAGAAGTTTCGCACAAAACTTCTTTCGGCCAAACCCAGAAGGAATTCG
  5   1   2       bld Ooc1      in                      xlnoc003m02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCCAGGAGCTGGTTCAGTATCCTGTGGAGCATCCAGACAAGTTCCTGAAGTTCGGAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTTCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGGCCAACCTGAGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTNCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGC
  5   1   2       bld Neu4                            IMAGE:4084448.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAATGACTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATCGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTTCAGTTGCCAAAGATGTG
  5   1   2       bld Bone      in                    IMAGE:8740162.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTCCATCAAAGGGTGTCCTATTCTATGGTCCACCTGGTTGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTCATCCCGCTGCCCGATGAAAAGTCTCCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGAGAACCAATGGTTTCTCCGGTGCCCATCTACTA
  5   1   2       bld Ga12      in                         XL180k21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTCCGCCTGGATGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGATGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACG
  5   1   2       bld Emb4      in                    IMAGE:4958861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTGGTAAGACTTTGCTGGCTAAGGCCATTGCCAACGAATGCCAGGCCAACTTCATCTCCATCAAAGGGCCCGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAA
  5   1   2       bld Int2                            IMAGE:8822581.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGCCGTGACTGCCCTAGGACCCGCCCCCACCCTATTCGTCCACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGGTCAAGCCCAGGAGCCGGGGAGCAGTGGCGGGGGCCATTTCACTGAAGAGACGACGATCTCTTGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCAATCGATTCTTCGTTAATGAACCTTGCTTTTCATCCCAGTCCAACTAGAAGCCACCCCCCACGTCCGTTCA
  5   1   2       bld Ga18                                xlk5e14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATCAAAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCNNNGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGNGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGNTCGCGCAAACTCTTCAGCAGAGNNGAGGANTNNNAGCTTCAGATTTCCCGCTGGGGTCAAGCTGGNG
  5   1   2       bld Oo1                             IMAGE:6639202.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGGGCCGGAACTTCTCACTATGTGGTTTGGAGAGTCTGAGGCCAATGTTAGAGAGATCTTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGATGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCCGCTGNGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTTAGAGGGTGGTCCGACCCCTCCCTCGTTGTACAGCCAATCGATCCCTAACGGTATTGGACACTTTGCTTTTTCATTTCCCCCAACTAGATGGCAGCCCCCACTCCTGGTCCTATCATTTTTGGTTACACC
  5   1   2       bld Ga15      in                       XL505j16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GTCTGAGGCCAACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAG
  5   1   2       bld Eye1      in                    IMAGE:6957259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGAGGCCACGTCCGAGAGATATTTGATAAGGCTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCTGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAAGAGCCGGGGGGAAGCAATGGCCGGGGCCATTTCCCTGAAGAAGACGACGATCTCTATGGTTAAAGGTGGGTCCGACCCCTCCCTTGTTGTACAGCCCATCGATTCCCTCGTTAATGGGAACTTTGCTTTTTCATTCCCCCGTCCAAACTTGAAAGccccccccccTTCGGTTCCAGGAATTTGTTTCACCCGGTGGTGAAAAAAA
  5   1   2       bld Spl                             IMAGE:8460883.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCGGCAGGCTGCTCCCTGTGTCCTCTTCTTTGATGAATTGGACTCCATCGCTAAGGCCCGAGGTGGGAACATTGGAGATGGTGGTGGAGCTGCCGACAGAGTTATTAACCAGATCCTTACTGAGATGGATGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCTAGTCCAAGAGCCNGGGAGGCAGCGACGGGAGTCATTTTACTGAGAGAGACGACTCTATGGTAGAGGTGGTCGACCCTCCTCTTGTACGCCATCGATCCTACGTATGACACTGCTTTCATTCCACTAATCACCACTCTGTCATCTTGTACCGGTGTAAAGGAGCAGTCTCGG
  5   1   2       bld Emb4                            IMAGE:4957817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGATGTTTTGGACTCCATCGCTAAGGCTCGAGGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATCGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGTCAATCTGACCAACTCTgggggggggggggATGTTAACCTNNACTTCCTGGCCAAGATGACCAATGTTTTCTCCGGTGCCGATCTGATTGAGATTTGCCACCGAGCCTGTAAACTGGCCATCAGG
  5   1   2       bld Ov1       in                    IMAGE:8329159.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGCGTCCGTGGGAACATTGGAGATGGGGGTGGAGCTGCTGACAGAGTTATTAACCAGATCCTTACTGAGATGGACGGAATGTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGNGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATG
  5   1   2       bld Ga15                               XL471b16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCTCCGGGAATGTCTACAAAGAAGAATGTCTTCATCATTGGAGCCACCAACAGACCAGACATCATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGATGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCAACCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTT
  3   1   2       bld Tbd3                            IMAGE:3548843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGAATGTCTCAAAATAGAATGTCTTCATCATTGTAGCCGCAGCCAGACATGACATCATCGATCATGCCATCGTGCGTCTTGACAGTCTAGATCAGCTCATTCACATCCCGCTGCCTGATGAGAAGTTCCGCATGACCATCATGAAGGCCAACCTGAGGAGTCTCCAGTTGCTAAGAACGTAGACGTCAACTTCCTGGCTAAGATGACCAATGGATTCTCAGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCTTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTT
  5   1   2       bld Skin      in                    IMAGE:8640310.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTATAAAGAAGAATGTCTTCATCATTGGAGCCACAAACAGACCAGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGGGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTACACGGGTGTGAGAAGAGGGGGAGCCAGTCTCTCAGGATTCTAACTTTTACTTTCTCTCTTNCCTCCTGTTCNNNGAGCGCCTGTGTTGCAAGAGTCTCAGGGGGGATGAAGTCTCACCCTGATGATGGGCTCATACCCCGTGG
  5   1   2       bld Te2N      in                    IMAGE:7203534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATATCATTGACCCCGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCANGATTCTTAAACTTTTACTTTTCTCTTCTTTNCCTCCCTGTTTCCGAAGCGGGCCCTGTGTTTGCAGAAGTCGTCCANGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTAccccccccgtggtggatcctggccgatattttccttttttttCTTCTTCCCGATCCAGCTTGTTTTGCCTTTCACCTGTTTCTTC
  5   1   2       bld Ga15                               XL413b08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAG
  5   1   2       bld Skin                            IMAGE:8644382.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGACCCTGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCAACCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCNAGTCTCTCAGGATTTCTAACTTTTTCTCTCGTTCCCNTCCTGTTCTGAAGC
  5   1   2       bld Bone                            IMAGE:8742715.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGCCATCCTGCGTCCTGGCCGTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCTGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCAACTAGAAGCACCCCACTTCTGTTCTATGATTTTGTTACACGGTGTGAGAGAGGGGAGCAGTCTCTCAGATCTAAACTTTACTTTCTCTTCTTCTTCTGTTCGAGCGCCCTTTGTTTGCAGAGTCGTCAGGGGATGAAGTCTCATCCATGATGACTGGATTCATACCCCGTTGGATCTGCGAATTTCTTCTTCAGT
  5   1   2       bld Brn3                            IMAGE:8539543.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCTAGATCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGACGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCTTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGA
  5   1   2       bld Egg1      in                    IMAGE:4783841.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCAGCTCATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCATACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAG
  5   1   2       bld DMZ       in                         xl235m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTACATCCCGCTTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGGGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCAGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCC
  5   1   2       bld DMZ       in                         xl278d13.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATTTACATCCCGCTGCCCGATGAGAAGTCTCGTATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGATGTGGACGTGGACTTCCTGGCCAAGATGACCAATGGTTTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGGGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCAGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8329458.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTACATCCCGCTGCCCGATGAGAAGTCCCGCATGGCCATCCTGAAGGCCAACCTGAGGAAGTCTCCAGTTGCCAAGGACGTAGATGTCAACTTCCTGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCGTTGTACAGCCAATCGATCCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAA
  3   1   2       bld Lmb1      in                    IMAGE:8531479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTACGGGCTCTGGGCGTTTCAGATCAGTCATTACATCCGTGCGATGGAAGTTCTGAAGCATCTAAGCAACTGAGAGTCTCCAGTGCAGATTGGACGTGGACTCTTGCAGATGACCCATGTTTCTCCGTGCCGATCTGACTGAGATTGCAGCGAGCTGTAAACTGGCCATCAGGAATCTATGAGATGAGATCAGACGAGAGCGGGACAGGCAGACTACCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCTGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATTGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCAGCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTTATCCACTGATTGACTTGGGGCTCCATTACCCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATGAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCTTTCTACTCTCGGCAATACGAAAAGGTTTATATAAA
  3   1   2       bld Sp1                             IMAGE:4968843.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGCCAAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCTTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAA
  5   1   2       bld Gas7      in                    IMAGE:4061732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGGAGATGACCAATGGATTCTCCGGTGCCGATCTGACTGAGATTTGCCAGCGAGCCTGTAAACTGGCCATCAGGGAATCTATTGAGAATGAGATCCGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATGCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACT
  3   1   2       bld Emb1      in                    IMAGE:3401782.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATGATAATCGNATTTTCTGGTGCTGATCTGATTGAGATTTGCTAGTGAGCCTGTAAACTGGCCATCAGGGAATTTATTGAGAATGAGATCTGAAGAGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAAC
  3   1   2       bld Eye1      in                    IMAGE:6948531.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGCCAGGGTGAGCCTTGTAAAACTGCCCCTTCCAGGGGAATCTTTTGGGAAAGAGATTCCGGAGAGGAGGCGGACCAGGGCAGACTAACCCCTTCCCGCTTAGGAAGTGGAAAGAAGGACGACCCCCGTACGGGAAATCCCGCAGAGAACACTTGAAAGAGGCCATGGGATTCGCCCCGCCGCTCAGTCAGGGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGTTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCGAGCAGTGAATGGGTCGCTT
  5   1   2       bld Skin                            IMAGE:8644237.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGAGAATGAGATCAGACGAGAGCGGGACAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGGGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCAGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCAAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTCAGCTGGTTGCCTTNCACTGTCATCCAAGTGATTCTGTTGGGAATAATGCTGAGATNACTGTTTGCTGCAGTGTGCTGTGATGTTAGCTGGCCTATGCATAAAGGGTATACGAGTACAGGCCCGGTGNTGCAGTCTCACTGGATGGTCCTCCTCCTGTGGTAGAAGCTATAGACTAATTAGTAGTT
  5   1   2       bld Brn1                            IMAGE:6952859.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGACCGGTCCGGAATTTCCGGGATCTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCGGAAATCCGCAGAGATCACTTTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTTACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGCCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTTATAAGGACCTAAAATATTAAGTAAGGGGttttttttCCTTTTCGTTTCCCAGGTTGGGATTGAAATACCGGAGGCTTCATACGTTCT
  3   1   2       bld Bone      in                    IMAGE:8740162.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATGGAGATTGGAGATACGACGGAAGCGGACAGACGACTAACCTTCGTATGAATGGAGAAGACGATCGTACGAATCGCAGAGATCACTTGAAAGAAGCATGCGATCGCCGCCGATCAGTCAGCGATAACCGATATCGCCAAATACGAGATGTTCGCACAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCGCTGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCACGTTGGATTGAAATACGGAGGCTCTAGCCACCTTCACCGCGACCAAACAAACCCG
  3   1   2       bld DMZ       in                         xl232a06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCAACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAGGGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCT
  3   1   2       bld DMZ       in                         xl282p09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCGGGAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCAACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAGGGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCT
  3   1   2       bld DMZ       in                         xl336h10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCGGNAAAGGCAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCAACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAGGGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCC
  5   1   2       bld Ga18                              xlk134k15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAAAGGNAGACTAACCCCTCCGCTATGGAAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGNCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCANNNNGAGGATTCNNNNCTTCAGATTTCCCGCTGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGNAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCAACCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAA
  3   1   2       bld Eye1      in                    IMAGE:6957259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCCGCCTATGAAAGGGAAGGAGGACGACCCCCGTTCCGGGAATTCGCAGAAAATCATTTGAAAGAGGCCATGGGATTTCCCCGCCCGTTCAGTCAGGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTTTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCTGCTGGGGACAAAGTGGAGCGGGTCCAAGCCCAGAAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATAAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGGTACA
  3   1   2       bld DMZ       in                         xl229d22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGTGGAAGAAGACGACCCCGTACCAGAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCAACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAGGGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCT
  5  -1   2       bld Bla2      in                    IMAGE:7297052.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTGGAAGAAGACGACCCCGTACAGAAAATCCGCAGAGATCACTTCGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCGACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAggggggggAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCTCCTGTGGGTATGAGAAAAGCATAATAAAG
  5  -1   2       bld Bla2      in                    IMAGE:7296168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTACCCTCGTATGAGGGAGAGAGACCCNTACCGAATCGCGGATCACTTGAGAGCATGCGATCGCCGCGTCAGTCAGCGATACGATTCCGCAATACGAGATGTCGCACAACTCTTCAGCAGAGCAGAGGATCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGATTCGTCCAGGGGGGGAATGAAAGTTCTTCTTCCACGGAGTGACTTGGGGTTCCATTACCCCCCCGTGTGGATCCGGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATaaaaaaaaaagaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCTAAGAGC
  3   1   2       bld Te2N      in                    IMAGE:7765641.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGTAGACTCGTGCGAAGCTCAGTGTGACTCTAGAGCCGGACGTCACTCGACTTACTAGCGCGGCGATACATTCACCAGAACAGTAGACATAGCTATTAGTGCCTATAGACAGTTTCGTCGGAATTCCCGGATCGCTGGGGACAAAGGGAGCGGTCCAGCCCAGAGCCGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTTTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTTTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       chi Tad2                            IMAGE:6931882.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGTGAAGAGGCCATGCGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTAccccccccTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCACCTGTTTGGCCTTCCACTGTTCATCCAAAGTGATTCTGTTGGGGAAACGAATGCTGGAGATTAAACTGTTTTTGCTGCCATTGGGGCCCTGTGAATGGTTTAGCTGGGGCACCTATTGGCCAGTAAAAAGGGGTCTAATACCCTGAATGCTCAGCCACGGGCCCCCCCGGGGGCGGTTTGGCCAGGGTTTTTCTTCCCCAGCCTTGTTGA
  5  -1   2       bld Sp1                             IMAGE:5507023.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGCCCTCCGGATCCCGATCCTTAAGGCTTGATTCCCGCGTCATTAGGAAAGATTCCCAATCGGAAGTTGCCCACTTTCGCGAGCAGAGATTCGCAGCTCAGATTTCCGTTGGGGACAAGTGGAGCGGTCCAAGCCCAGAGCCCGGGGGAGGCAGTGCGGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTNTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTAcccccccccccGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGttttttttCCTTTCGTTTCTC
  3   1   2       bld Ga12      in                         XL180k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCATGCGATTCGCCCGCCGCTCAGTCAGCGACAACGACATCCGGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCAACCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCTCCTGTGGGTATGAGAAAAGCAT
  5   1   2       bld Ga15      in                       XL463h04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGATTCGCCCGCCGCTCAGTCAGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTAcccccccccccGNGNGGATCCTGCAAATATTTCTCTTCTTTTCACTCCTCCAGTTCAGNTGTTTGGCCTTCAA
  3   1   2       bld Emb9      in                    IMAGE:7976301.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGCGCTCAGTTCAGCGAATAACGATATCCGCAAATACGAGATGTTCGCACAAACTCTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACAGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAAAAAAAACCGTACA
  3   1   2       bld Ga18      in                      xlk161l06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCCNCNGCTCAGTCAGNNANAACGATATCNGNAANTNCGANNTGTTCGNACAAACNCTCANNAGAGCAGAGGATTCGGCAGCTTCAGATTTNCNCTGGGGGACAAAGTGGAGCGGGTCNAAGCCCAGGAGCCGGGGGAGGCAGTGNCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATACGGNNNNCTANNNNNCACGTGA
  3   1   2       bld Neu7 5g3  in                         XL013j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTCAGTCAGCGACAACGACATCCGAAAATACGAGATGTTCGCGCAAACTCTTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCAACCCTCCCTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCGGGGGGAATGAAAGTTCTTCCTCCACCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCTCCTGGGGTATAGAAAAGCATAATAAAGAAATANAA
  3   1   2       bld DMZ       in                         xl278d13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGCGATAACGATATCCGCAAATACGAGATGTTCGCACAAACTTTTCAGCAGAGCAGAGGATTCGGCAGCTTCAGATTTCCAGCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTTGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATGAAATA
  3   1   2       bld FaBN 5g3  in                    IMAGE:8075769.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCAAATACGAGATGTTCGCACAACTCTTCAGCAGAGCAGAGATTCGGCAGCTTCAGATTTCCAGCTGGGGGCAAAGTGGAGCGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGCCATTTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTTGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATCAAATACAGCTGTCTACCCCCAGAATAGTTACACTTATTT
  3   1   2       bld Emb9                            IMAGE:7975665.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCGCAATACGGATGTCGCCAACTATCAGCAGACATAGATAGGCAGCTCAGATTCCCGCTGGGGAAAAGTGAGCGGTCCAAGCCAGGAGCGGGGAGGGCAGTGGGGGGGCATATCACCGAAAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGACAATCGATTCCTTAATTAATGGACACTTTGCTTTTCATTCCCCCATCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACAGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTCGGATGAAATACGATACTCAGGCTCCAACGACCACCCCTCC
  3   1   2       bld DMZ       in                         xl224k05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTCAGCAGAGCCGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTNTATGGTTAAAGGGTGGTCCAACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGANGCAGCCCCACTCCTGTTNTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTNTNTCAGGATTNTTAAACTTTTNTNTTCGTTCCCTCCCTGTTTNTGAAGCGGCCGCTGAGCTTGCAGAGAAGCCTCCCAGGGGGGGGAATGAAAGTTNTTCCTCCNCCGAGTGACTTGGGGCTCCTTTAACCCCCTGTGAGGATCCTGCAGATATTTNTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATNTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCNCTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAANGGGTCGCTCCCCCCTCC
  3   1   2       bld Skin      in                    IMAGE:8640310.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCGCATAGAGATGTGCACACTCTCAGNGACAGAGATCGCAGCTCAGATTCCGTGGGGACAAGTGAGCGGTCCAGCCCAGAGCGGGGGAGCAGGGCGGGGCCATTCACTGAAGAGACGACGATCTCTATGGTAAAGGGTGTCCGACCCCTCCTCGTTGACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATTAAATACGGAGGCTCAGCGTCTCACGACAAAACTTTCTTTCTT
  3   1   2       bld Te2N      in                    IMAGE:7203534.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAGTCGCCAACTCTCAGCAGACAGAGATCGCAGCTCAGATTCCGTGGGGACAAGTGAGCGGTCCAGCCAGGAGCCGGGAGGCAGTGGCGGGGCCATTTCACTGAAGAAGCGACGATCTCTATGGTAAAGGGTGGTCCGACCCCTCCTCGTTGACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTGGATTGAAATACGGAGGCTCTAGCTCTCACGGACAATAACGACATTCTAGCG
  3   1   2       bld Gas7      in                    IMAGE:4061732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAAAGGGTGGTCCGACCCTCCTTCGTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTATTCGTTCCCTCCCTGTTTCTGA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173702.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCTTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGA
  3   1   2       bld Gas4      in                    IMAGE:3420795.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCCGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCTTTGTACAGCCAATCGATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAG
  5   1   2       bld Bla1                            IMAGE:3381299.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGGATTCGGCAGCTTCAGATTTCCCGCTGGGGGTCAAGCTGGAGCAGGTCCAAGCCAAGGAGCCGGGGGAGGCAGCGACGGGAGCCATTTTACTGAAGAAGAAGACGATCTCTATGGTTAGAGGGTGGTCCGACCCCTCCCTCGTTGTACAGCCAATCAATTCCTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTAT
  3   1   2       add Ga18 5g3  in                      xlk163k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CANCTTCANNNTNNCCGCTGGGGGNNAAAGTGGAGNGGGTCCAAGCCCAGGANCCGGGGNNGGCAGTGGCGGGGGCCATTTCNCTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGNCCCCTCCTCGTTGTACANCCAATCGATTCCTTCGTTAATGGANNCTTTGCTTTTCATTCCCCAGTCCANCTAGAAGCNCCCCCNCTTCTGTTCTATGATTTTGTTACNCGGGTGTGAGAAGAGGGGGANCCAANTCTCTCAGGATTCTTAANCTTTTNCTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTNGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCNCCGAGTGNCTTGGGGCTCCATTACCCCCCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCNNNNNGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGG
  3   1   2       bld DMZ       in                         xl235m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGCTTCAGATTTCCAGCTGGGGGACAAAGGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTTGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATGAAATACGGAGGCTC
  5   1   2       bld Te2N      in                    IMAGE:7765641.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTGGGGGACAAAGTGGAGCGGGTCCAAGCCCAGGAGCCGGGGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTTAAGTaaaaaaaaaaaaanaaaanaaaaaaaaaGG
  5  -1   2       bld Tail                            IMAGE:8544781.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAGGCAGTGGCGGGGGCCATTTCACTGAAGAAGACGACGATCTCTATGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGttttttttCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGACGAATATTATTATGACTCTCT
  5   1   2       bld Bone                            IMAGE:8743401.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCGTACCGGAAATCCGCAGAGATCACTTTGGTTAAAGGGTGGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTAccccccccTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACGAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCACTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAAGGGGttttttttCCTTTCATTTCTCATGTTGGATTGAAATACGAGCTCTAGCGTCTCACGTGACATAAACTGACTGATCTCTAGaaaaaaagaaaaaTAGCGCGCAGCTGATTTCTCTAGACGCGCTCGAGCCCTCGCTAAATGATCGTATTACGTGAATCGACTGATAAGATCTGATATGACAATCCAACTAATGCATGAAAAATGCCTTATTGGGACTGGATGCCATGC
  3   1   2       bld Ov1       in                    IMAGE:8329159.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGTCCGACCCCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCACGTTGGATTGAAATACGGAGGCTCTAGCGCCTCACGTGACAATAAACTGACTGATCTCTAATGAAAAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Ga12      in                         XL215h01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCTCCTCGTTGTACAGCCAATCGATTCCTTCGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTAC
  3   1   2       bld Egg1      in                    IMAGE:4783841.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTCCTTNGTTAATGGACACTTTGCTTTTCATTCCCCAGTCCAACTAGAAGCACCCCCACTTCTGTTCTATGATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGGCCCCGGGTGTTGCTATGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAAAAAAAAAAAAATAAGGAAAGCGGCCG
  3   1   2       bld Eye1                            IMAGE:4757583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTACGTTATTGGACACTTTGCTTTTCATTCCCCAACTAGATGCAGCCCCACTCCTGTTCTATCATTTTGTTACACGGGTGTGAGAAGAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTCTCTTCGTTCCCTCCCTGTTTCTGA
  3   1   2       bld Ooc1                              xlnoc003m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATAAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTT
  3   1   2       bld Ooc2                            IMAGE:3745439.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAGGGGAGCCAAGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCCTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACGAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCACTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTAATGTGAA
  3   1   2       bld Ooc2      in                    IMAGE:3746375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTCTCTCAGGATTCTTAAACTTTTACTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCCTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTATGTTGGGAAACGAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCACTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTAATGTGAA
  3   1   2       bld Ooc1      in                      xlnoc003m02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTTCTCTTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATAAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTT
  3   1   2       bld Emb4                            IMAGE:4202774.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTAAAAAAAAAAAAAAA
  3   1   2       bld Ooc1      in                      xlnoc003a22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTTTCCCTCCCTGTTTCCGAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4958861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGCGGCCCCTGTGTTTGCAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAACTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAA
  3   1   2       bld Emb4 5g3  in                    IMAGE:4202579.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAGAGTCGTCCAGGGGGGGAATGAAAGTTCTTCATCCACCGAGTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATTGAAATCGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTA
  3   1   2       bld Lu1  5g3  in                    IMAGE:4632889.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGGGAATGAAAGTTCTTCATCCACTGATTGACTTGGGGCTCCATTACCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATAAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTACATTTCTACATGTTGGATTGAAATACGGAGGCTCTAGCGCCTCACGTGACAATAAACTGACTGATCTCTAATGTGAAAAAAAA
  3   1   2       bld Ga15      in                       XL463h04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATNCCCCNNGGCNCNGGGGGGTCCNNTNCCCCCCCCCCCGTGTGGATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAANGGTTTTTTTTCCTTTCGTTTCTCATGNNGGATGAAATCC
  3   1   2       bld Ga18      in                      xlk116c19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTAGCTGGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGNTTTCTCCAGCTGTGAATGGNNNNNNCCCCCNCTGTNGGTANGAGAAAAGC
  5   1   2       bld Ga18      in                      xlk116c19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAACCCCCTGTGAGGATCCTGCAGATATTTCTCTTGTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTAAATCTATTGGGAAATCAATGCTGAGATTAACCATTTGGCTGCCAGTGTGCCTGCGAGCGTTTNNNNGGCACTATTGCAGTGAAAGGGTTAATACGGGGGGCTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCCCCTCCTGTGGGTATGAGAAAAGCATAATAAAGaaaaaaaaagaaaataaaaaaaaaa
  3   1   2       bld Ga12      in                         XL215h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCCCCGTGTGGATCCTGCAGATATTTCTNTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACNGTTCATCCAAAGTGATTCTGTTGGGAAANTAATGNTGAGANTAANTGTTTTGCTGNCAGTGTGCCTGNGAATGATTAGNTGGGCNCTATTGCAGTAAAAGGNNTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTT
  3   1   2       bld Ov1       in                    IMAGE:5073622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCCTGCAGATATTTCTCTTCTTTTCACTCCTCCAGTTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAACTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGACAAAATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCATCTGTGGGGGGATCTCTCGGTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAGTAAGGGGTTTTTTTTCCTTTCATTTCTCACGTTGGATTGAAATACGGA
  5   1   2       bld Ga15                               XL497e08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCAGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGCTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGCTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCTTAATAAAGACATAAAATATTAAGTAAGGGttttttttCCTTTCGTTTCTCATGTTGGATTGAAATACGGAGGCTCTAGCGTCTCACGTGACAATAAACTGACTGATCTCTaaaaaagaataaaaaaaaaa
  3   1   2       bld Ga15      in                       XL505j16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCTGTTTGGCCTTCAACTGTTCATCCAAAGTGATTCTGTTGGGAAATTAATGNTGAGATTAACTGTTTTGCTGCCAGTGTGCCTGTGAATGTNTAGCNGGNCACTATTGCAGTAAAAGGGNTAATACAGAACTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAAGCTGTGAATGGGTCGCTCCCTTCTCCTTCTGGGTATAAGAAAAGCNTAATAAAGACATAAAATATTAAGTAAGGGTTTTTTTTCCTTTCGTTTCTCATGTTGGATGAAATACGAGGC
  3   1   2       bld Emb4 5g3  in                    IMAGE:4960069.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTGTGAATGTTTAGCTGGGCACTATTGCAGTAAAAGGGTTAATACAGAGGTAGCAGGGCCCCGGGTGTTGCAGGTTTCTCCAGCTGTGAATGGGTCGCTCCCTTCTCCTGTGGGTATAAGAAAAGCTTAATAAAGACAAAATATTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)