Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5512253.5                       9 END     1           1       11                MGC80741 protein [Xenopus laevis]
     2   2.0    0Xl3.1-IMAGE:6318291-IMAGp.5                 7 END     1           1       14                MGC80741 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012768569 Xl3.1-IMAGE:6959588.5 - 64 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6959588.5               CTGCGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTAT
                                                  Xl3.1-CHK-1012686209                     GAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTATAAAAAA
                                                      consensus depths                    3     4     8     9    12    14    13    16    14    17    14    18    20    21    21    22    22    24    23    25    25    26    25    26    26    27    27    28    26    28    28    30    28    30    28    30    28    30    29    30    29    30    30    30    29    29    29    29    29    29    28    29    28    30    29    33    28    33    29    33    28    33    31    33    31    33    31    33    31    33    30    32    29    32    29    32    29    32    30    32    30    33    29    33    30    33    29    32    29    33    29    33    31    33    31    33    32    33    30    32    28    31    30    34    31    36    30    36    33    37    28    37    27    38    29    39    28    40    28    40    29    40    29    40    27    37    25    38    27    39    30    40    29    40    28    39    27    38    28    37    28    38    29    38    31    39    27    35    30    36    29    36    29    34    28    35    23    35    23    34    23    33    22    33    22    33    23    32    24    33    24    31    23    29    22    29    21    27    20    25    21    25    20    26    20    26    19    26    18    26    18    26    18    26    17    25    16    22    15    22    15    21    15    20    17    20    16    20    17    20    16    20    17    20    14    20    13    16     8    12     7     9     5     7
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGACTAAAGCCTGATTTTCAGGATAAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               A-----------
                                               BLH MIN     111     156               
                                               BLH OVR     111     758               
                                               EST CLI       4       6               
                                               ORF LNG     111      53               
  5   1   2       bld Ga12 5g3  in                         XL199o15.5p AGGGGCGGAGTCGGCTGCGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACC
  3  -1   2       chi Ga11                            IMAGE:3475303.3p   CTGGAGCTAAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTC
  5   1   2       bld Lmb1 5g                         IMAGE:8535918.5p          GTCGGCTGCGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAATACCACAATGTTGGCTTAGTAATGTGAATTNAGGTGGCTTGTCAANNGACAGTATCACAGCAGCACAGTGGGGACAGAGTGGAGCTCTCTCTAGCCCGTGNAGAG
  5   1   2       bld Brn1 5g                         IMAGE:6951087.5p               CTGCGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCCTTAGTAAATGTGAAAATTANGGTGGCTTTTGTCAAAGGGAACAGTATCAGCAGCAGCAGCAGTGGGGGGACAAAGAGGTGGAGGGCTCATCATCTAGGCCCCCGTGGAAAGAGGAGGTTTTAAGCCAGAGCTGGGAGCCCAGGGATATAGTAAACTACCTGGAATTCCAAAGCTACAGCCAGTTATGGATACAACCAA
  5   1   2       bld Tail 5g3  in                    IMAGE:8541968.5p                 GCGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGGAAAGAAATACCANCATGTTGGCCTTNAGTAATGTNGAATTNANGTGGGCTTGTCAANNGACAGTATAGCAGCAGCAGCAGTGGGGAACAGAGTGGAGCTCATCTCTAGTCCGTGNNAGAGAGTTNAGCAGACTGGACAGGATTATACTCTGGATCAGCTCGCGTT
  5   1   2       bld Egg1 5g                            PBX0109E07.5p                  CGGGAGCGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAAT
  5   1   2       bld Ov1  5g                         IMAGE:8331422.5p                  cccacgcgtccggTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTATAGAATATCATGGNNAAAGAATACCACCATGTTGGCCTTAGTAAATGTGAAATTAGGTGGCT
  5   1   2       bld Brn1 5g                         IMAGE:6953510.5p                        CGAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCCTTAGTGAGTGTGAAATTAAGGGGGGCTTTGTGCAAAGGAACAGGATCAGGCAGCAGCCGGCAGTgggggggacaagaagggggggAAGGCTCCAGTCATCTTAGGCCCCCGTGTGGAAAGAGGGAGGGTTTGAAGGCCCAGAAGCCTGGGAACCCAGGGGGAATTATTAGCTAAACGTTGCGTGGGGGAATTCCCGAC
  5   1   2       bld Ga18      in                      xlk108o18ex.5p                         GAAGGGTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGNTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGNTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGNNTGAAGNCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGANCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGNNTTNGTAAATGTGAAATTAANGTGGCTTTGTCAAAGGANCAGTATCAGCAGCAGNAGCAGTGGGGGACNAG
  5   1   2       bld Ga15 5g3  in                       XL406j23ex.5p                              GTTAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCNAAAGGAACAGTA
  5   1   2       bld Sp1       out                   IMAGE:4964437.5p                                TAGAAGGGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACCAGATAAGAGAGTATTTCGGACGTTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACCAGACTAACAAAAGA
  5   1   2       bld Ga12 5g3  in                         XL202o15.5p                                     GGAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGNGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAG
  5   1   2       bld Ooc2 5g3  in                    IMAGE:3746201.5p                                       GAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATNTGTTAGGAGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTCCGGACGTTTGGGAGAGGTG
  5   1   2      seed Sp1  5g                         IMAGE:4964962.5p                                       GAGAGGAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAA
  5   1   2       bld Tbd2      in                    IMAGE:3199410.5p                                            GAAGCGTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGGCTTCTGCTTCATCACATTTAGGGGGAAGACCCAGTTAAGAATATCATGGGAAAAGAATACCAACATGTTGGGCTTATAAATGTGAAATTAAGGTGGCTTTGTCAAACGAACAGATCAGCGCAGCAGCCGTGGGG
  5   1   2       bld Thy  5g                         IMAGE:8547880.5p                                                   AAttttttttAAGATACATCAAATTCGATTCGTCCCATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAAGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAACGTGGCTTTGTCAAAGACAGTATCAGCAGCAGCAGCAGTGGGGGACAGAGTGAGCTCATCATCTAGCCCCGTGAAGAGGAGTTTAAGCCAGAGCTGGAGCAGGATATAGTACTACTGGAATCCAAGCTAC
  5   1   2       bld Neu7      in                         XL006k18.5p                                                             CTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAA
  5   1   2       chi DMZ       in                         xl262l14.5p                                                                       GTCTATTAAAATCTCTTTCTCTCGGTGATTTCAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTG
  5   1   2       bld Ga15 5g3  in                       XL483l17ex.5p                                                                                CAGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGG
  5   1   2       bld Skin 5g                         IMAGE:8644078.5p                                                                                 CGTAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATAAGGTGGCTTTGTCAANGAACAGTATCAGCAGCAGCAGCAGTNGGGAACAGAGTGGAGCTCATCTCTANGCCCGTGGAGAGAGTTNAGCAGACTGAGCAGGATTAGTACTACTGATCAGCTCGCATATGATCACACAGGTATGAGTATGGACTGATCCTGTCACATAGCTTAACATGATGGTCGA
  5   1   2       bld FaB  5g                         IMAGE:8073524.5p                                                                                   TAGTATACGTTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACACAATGTTGGCCTTAGTAATGTGNAATAAGGTGGCTTTGTCAAGGAACATTCAGCAGCAGCACAGTGGGGACAGAGGTGGAGCTCATCTCTGGCCCGTGGAGAGAGTTTAGCCAAGCTGAGCAGGATTAGTACTCTGGATCAG
  5   1   2       bld Bone 5g                         IMAGE:8743843.5p                                                                                            TTCTCTCTGTCTGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGTGGAGGCTCATCATCTAGCCCCGTGGAAGAGAGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAGCTACAGCAGTTATGGATACACACATGGTATGAGTTATGGGACTATGACTACTCTGGTTACACTATATGCCTATGAGACTATAGTATTCAGCGAGTGCTATGGCAAACAGGCGACGAGTTGTTCACTTCAAATAGT
  5   1   2       chi Eye1                            IMAGE:6959390.5p                                                                                                       TGCCTTATTGTTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTTCAAATTTTGGGAGAGTTGTAGACTGTACCCTGAAATTTGGACCCATCACCGGAAAGATCTCCGTGGCTTTTGGCTTTGTCCTTGTTTAAAAAAATCTGAAAGGGGTTTGACAAGGGGGattgggaaccaaaagggggcccccacccctgaaatggggaaaaatttttaaaccccccaaaaaaggggggtttaagggccctttaaaaaaaaaaaaaaaaaccccctgttcaaaaaaaaaattttttttgggggggggTTTTTTTTCCCCGAAGAAAACCCCCTTTTGGNGACCCCCGTTATAAAAGGGGGGtttttttttttcaaaaaaaattttttgggggggggggggtgtaaaaaccccccaaaaaaacccctcccccttttttttttataaacaaaaacttccttaaaaaaaaaaaaagagagggggggttttttttttcttttttCTTTN
  5   1   2       bld Neu7 5g3  in                         XL003m01.5p                                                                                                         GAGGTATTGTTATTAAAAACATAAGCCTGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGGAACAGTATCAGCAGCAGCAGCAGTGGGGGA
  5   1   2       bld Thy  5g                         IMAGE:8546711.5p                                                                                                                 TTATTAAAAACATAAGCCATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAGCTACAGCAGTTATGGATACACACAGGGGTATGGAGTTATGGGAACTATGACTACTCTGGTACACTATTATGGCTATGGAGACTTATAGTAATCAGCAGAGTGGTTATGGGAAAAGGCCAGACGAGGTGTCATCAATAGTACCAACTTATCCTAAGTATTCCAGTTCA
  5   1   2       bld Ga12 5g                              XL180a01.5p                                                                                                                                   ATGATTTCTGAAGACGACGAAGCCATGATGGAAGCTACTACTGCTGANACAGAGGANATTGGNCNAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAATAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACA
  5   1   2       bld FaB                             IMAGE:8073476.5p                                                                                                                                                         CCATGATGGAAGCTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTANGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTAATGGGAACTATGACTACTCTGGTTTACACA
  5   1   2       bld Ga18      in                      xlk163f13ex.5p                                                                                                                                                                 GAAGNTACTACTGCTGAGACAGAGGAGATTGGGCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGNNTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGNAGCAGTGGGGGANAAGAGGTGGAGNNTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGNNNGGGAACTATGACTACTCTGGTNNAACTATNTGG
  3  -1   2       bld Bla2      in                    IMAGE:7295960.3p                                                                                                                                                                                                 GCAAAACGAAGGGGTGAAGATTGATGCCAGTAAGACCGAAGAAGATGAGGGGAAGATGTTTATTGGAGGCCTTAGCTGGGATACTACAAAGAAAGACCTGAAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGAAAGAGGTGAGGCTCATCATCTGGCCCGTGGAAAGGAGGTTAACCAAGTGGAGCAGGATATATACTCTGGATCAGCTACACATATGATCACACAGGGTTGAGTATGGACATATACCGTCACTTATGTTGAACTTACACATGTTGGACGCGCAGGCTCAATCACAATTCTCATAACGACCTCGTATAGCCACTTCTCCTGAAAATTC
  3   1   2       chi Ga18      in                      xlk108o18ex.3p                                                                                                                                                                                                 GGNAAANNGAAGGNNGAAGATTNATNCCNGNANGNCCGAAGNAGATGNGGGNANNATGTTTATTGNNNNCCTTAGCTGGNATACTACAAAGNAAGACCTGNAGGATTATTTTTCAAAATTTGGAGAGGTTGTAGACTNNNNCTTGAAATTGGACCCCATCACCGNNAGATCTCGTGNCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGNACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTANAAANTCTGCTGTTAAATAAAG
  5   1   2       bld Eye1                            IMAGE:6959588.5p                                                                                                                                                                                                                                                                                                                                    TAGACTGTACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTGGCTTTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTTATTTTGTTTCTGCAAAGCCCTTTTAAAAGGGGAATGTAGTAAAATTATTTTATAGAATTT
  3   1   2       bld Ga18      in                      xlk144p14ex.3p                                                                                                                                                                                                                                                                                                                                            TACCTTGAAATTGGACCCCATCNCCGGAAGATCTCGTGGCTTTGGNNNGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGNCTAAANNC
  5   1   2       bld Ga18      in                      xlk144p14ex.5p                                                                                                                                                                                                                                                                                                                                            TACCTTGAAATTGGACCCCATCACCGGAAGATCTCGTGGCTTTNNNNTGTCTTGTTTAAAGAATCTGAAGGTGTTGACAAGGTGATGGAACAGAAGGAGCACAAGCTGAATGGTAAAGTTATAGACCCAAAAAGGGCTAAGGCAATGAAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGNTATGGGAACTATGACTACTCTGGNTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGNGACAGGAGCATTAAAATGTTAATAGGNCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGNCTAAAGNCTGATTTTCAGGNTAGaaaaaaagataaaaaaaaaa
  3   1   2       bld Tail 5g3  in                    IMAGE:8541968.3p                                                                                                                                                                                                                                                                                                                                             TTTTTGAGCTTAGCGGATTCAAGAAGCTGAGATTTTCATGAGTGACTACTGAATTGACCTACGGAGATTCCTGCTGCTTGTCTGTTAGGATCGAGGTTGACAAGGGATGACGAAGAGCACAGCTGATGTAAGTTATAGACCCAAAAGGGCTAGCATGAGACAAAGAGCATCAGAGATATTTGTAGAGTTTATCTCCAGACACACTGAAGACAGATAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCGTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTCCCCCTTAATAAATATCC
  3   1   2       bld Tbd2      in                    IMAGE:3199410.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGAATGGTAAAGTTATAGACCCAAAAAGGCTAAGGCAATGAGACAAAAGAGCCTGTCAAGAAGATATTTGTAGGAGGTTTATCTCCAGACACACCTGAAGACAAGATAAGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGACTAAAGCCTGATTTTCAGGATAACCAACAAAAAAAAAAAAAAAACAAAAAA
  3   1   2       chi Ga18      in                      xlk163f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANAAANANCCTNTCAAGAAGATNTTNTANNAGNTTTATCTCCAGANACNCCTGANGNNAAGNNNNAGAGTATTNCGGAACGTTTGGAGAGNTTGAAGCCATAGANCTGCCTATGGATAANAAGNCTANCAAAAGNCGTGNCTTCTGCTTCATCACATTTAAGGAGGNAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTNNNAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTANNNNNTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATNCCTGTGTCATAATGTAAC
  3   1   2       bld Ga15 5g3  in                       XL483l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGACAAGATAAGGAGAGTATTTCGGAACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTCCCCCT
  5   1   2       bld Egg1                               PBX0071A04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCACGAGGCGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATTAACAAGTGAACAAGCAGTATTTTCTTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCT
  5   1   2       bld Ga15      in                       XL401h23ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACGTTTGGAGAGGTTGAAGCCATAGAGCTGCCTATGGATAACAAGACTAACAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCNTATTACATTATA
  3   1   2       bld Ga12 5g3  in                         XL199o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAAGACGTGGCTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATGCCACAATGTTGGCCGTAGTAAATGTGAAATTAAGGTGGCTTNGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTNCAGCAGTTATGGATACATCAACCAGGGGTATGAAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGNGGTTATGGGAAAACAGCCAGNCGAGGTGGTCATCAAAATAGTTACAAACCATNCTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGNTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTNTAGAATTCATNTAGCAGTNGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGNGTTTATGAACTTNGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTNTAATAAATA
  5  -1   2       bld Bla2      in                    IMAGE:7295960.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAAGACGTGCTTCTGCTCATCACATTANGGAGGAAGACCCAGTAAAGATATCATGAAAAGAAATACCACAATGTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTATaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCCG
  5   1   2       bld DMZ       in                         xl247l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTATAAAA
  3   1   2       bld DMZ       in                         xl247l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTCTGCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCCTGTGTCATAATGTAAGCCTTTTNCCC
  3   1   2       bld Ga12 5g3  in                         XL202o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGNCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGAAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATA
  3   1   2       chi DMZ       in                         xl262l14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCATCACATTAAGGAGGAAGACCCAGTAANGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGCGGGGAATTCATTGCAGGCCCTGTGTCGCGCTGAACTTCACGATTCTCACAGGCCCGCTCAATGCGGACAGGGTACGAGATGCTCACGCTCTCGAATGCTGCCGTTTGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTT
  3   1   2       bld Neu7 5g3  in                         XL003m01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAAAGAATATCATGGAAAAGAAATACCNCCAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTNCCTTTA
  5   1   2       bld Egg1                               PBX0118E10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCT
  3   1   2       chi Neu7      in                         XL006k18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCATCACATTTAAGGAGGAAGACCCAGTAAAGAATATCATGGAAAAGAAATACCACAATGTTGGCCTTAGTAAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTA
  3   1   2       bld Ga15      in                       XL401h23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTNTCNGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAATCTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCNGTGTCATAA
  5   1   2       bld Egg5                            IMAGE:3430696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGTGAAATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAATTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTTATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCATTTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCA
  5   1   2       bld Egg1                               PBX0100H11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTAAGGTGGCTTTGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGTGGAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAA
  3   1   2       bld Ga15 5g3  in                       XL406j23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGANCAGTATCAGCAGCAGCAGCAGTGGGGGACAAGAGGNGGAGGCTCATCATNTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAANTACTGGAATCCAAGNTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGNCTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTCCCCCTT
  5   1   2       bld DMZ       in                         xl248l12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGGGACAAGAGGTGGAGGCTCATCATCTANGCCCCGTGGAAGAGGAGGTTTANNCCAGANCTGGAGCCAGGGATATANCANCTACTGGAATCCGAGCTACAGCANTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGNAAAACAGCCAGACGAGGTGGTCNTCNAAATAGTTACNANCCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAACNAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCANATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTANAAGGGATGTAGTAAAATT
  5   1   2       bld Ga15      in                       XL463o02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCGGGAAGGCTCATCATCTAGGCCCCGCTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCNGGGATATAGTAACTACTGGAATCCNAGCTACAGCAGTTATGGATACNACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGACTAAAGCCTGATTTTCAGGATAACCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL463o02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAGGCTCATCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTAAATAAAG
  5   1   2       bld Emb4                            IMAGE:4724917.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCATCTAGGCCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGACTAAAGCCTGATTTTCAGGATAACCAACAAATGGTGTTGTTGACATTACCAGATAACAGTGGTTTGTTTTATGGTTTGTGTGATTGCATTTAAAATGGACAGTTGTGGTGTGACTGAGTTTGAATGGGTGATTTGTTATGTTCATAGATCTGACACCACCAAATTCAACCAAGGGAACTGCTTTACCCACACTTCCTTACATTTCATCACACATCTCACTGATGTTTGCTCGCAATTGCAACAGAGCCTGATCTACAAATCTTCTCTCAACCCCAATGGTTGCTATATCCCCCTACTACCAAATTCAAAGTTTAGACAATGCTTTGTATCACAGTATATGATTTCAATAGTTTAAGTACTTTATTTTTGACTTGGGCTCTTTGTTGACAGAATGATTTAAAAAGTGACCTGTTGTTGATCTGCTATTCAAAAGGCATATATAAAATATGTAGCCCTTTTGGGGGGGTTTAAAAATGTTTAATTAAAGAAAACCTATCCGNNatttatttatttaatttatttttccgttattggccaaattggtgtttttctaaaaaatatccttttGCTAAGACATATTTTAACCCCTTTTAAGTGCCACATATCCTATAATTCCGGGGATCTGGGGGGATAAAAAGGGATTTGCCGTGGC
  3   1   2       bld Ooc2 5g3  in                    IMAGE:3746201.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCGTGGAAGAGGAGGTTTAAGCCAGAGCTGGAGCCAGGGATATAGTAACTACTGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGAGTCATAATGTAAGCCTTTTTCCCCCTTTAGTAAATATTCCTTTACATTTTTTATAA
  3   1   2       chi Sp1       out                   IMAGE:4964436.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTCTGTTGGCATGTGAATTCTGTAGCTTTGCCTTGCACCAAAGGAATATTTTCTGTTCCTCTAGCTAAATATTGTTTTAGAAATCTAAGCCATGTTGGTTTTCTTTAAAACATTTTTGGTGCACATGAGGATTTCATTGCTCTTGGACATTTATAGTGATGTAGTTGACTGGAAGTATATAATGATTTGTTTGTGGGTAATAAAATCTTTTTTTTTTATTTTTTTTTTTTAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTATAAAAAAA
  5   1   2       bld Ooc1                              xlnoc002f15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAATCCAAGCTACAGCAGTTATGGATACAACAACCAGGGGTATGGAGGTTATGGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGAAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTATTTTCTTGGTTGAAGAATGATTTGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCAAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACGTTATAGCTTTGCTTGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTT
  5   1   0       chi Brn1                            IMAGE:6955227.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTCGAAATAAGACCAGGGGTATGGAGGTTACCGGAACTATGACTACTCTGGTTACAACTATTATGGCTATGGAGACTATAGTAATCAGCAGAGTGGTTATGGGAAAACAGCCAGACGAGGTGGTCATCAAAATAGTTACAAACCATACTAAATTATTCAATTCACAACGTGTAATAAACAGATATGTTGCtttttgttggttttttttgttgtattttatctttacatgtaaactataaatatatatatatatatatatTAACTATTAAGATATTGTAACACATATTGGTTTTAAAATTTTACAGCACCCAGAAGTGCTTTCTATAACATAATATAGAGACTTTGAAGATACGAACACGTGCACTTAAGCGCTTTTTACTTTTACCATTTTGCCCTATTAATTACAAGTCAGTAAAGTTAACAGGTAACGTACTGCTAATGGGTACAAAATAAGGAATTGCCTACTAACTCTGACATTATACCTTGTTTGTACCCGCCAGCGGGGAATTCATTGCAGGCCCTGTGTCGCGCTGAACTTCACGATTCTCACAGGCCCGCTCAATGCGGACAGGGTACGAGATGCTCACGCTCTCGAATGCTGCCGTTTGGTATGGTCTCTTCCAACATCCTGTATCAGCGTTACTGTATCAGCGTTATAATATAAACTGGATACTCAAAGATGTACTTATTCATTTGCGTTATAAACATTTAAAAAACAAGACCGAAGAAAAATCACCTTATAAATTTTTAACTTCTTTTTACAGGGGCCCCATTAAATCCATTTATATAACGTTTTTAAACCTTTTACCTGGAATAACATTTTTTAAACCTAATTTTAATTTCACTCCTTAAAAGGGAAATAACAGGCCTCTGGATTCACCCCTTGGGGAATATTTCTCCCATTAAGAatttttttcccgaaaaatttttttCTCTATCCCCACAAACCATATATT
  5   1   2       bld Ga14                               Ga14-p17e7.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTANGGNGACTATAGTAGTGAGTATCCGTAAATTGACAAGGCTTGCGACAGGAGCATTAAAATGTTAATAGGTCATTGTTTTTGATGTACAAAATCTGCTGTTAAATAAAGGACTAAAGCCTGATTTTCAGGATAACCAACaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl248l12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTATTCAATTCACAACGTGTAATAAACAGGTGAACAAGCAGTNTTTTCTTGGTTGAAGAATGATATGAGGTGGCTCATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATCNTATTTTGTTTCTGCAANGCCCTTTAGAAGGGATGTAGTAAAAGTTATTTTANAGAATTCAT
  3   1   2       bld Ga18      in                       xlk68c15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTCTGCATTCATAGCAGTGCAAATTTATGTTTGCTCCCATTTTATTTTGTTTNNNNAAGCCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGNAGNCNTATTACATTATNCTTNNCTNNTTTAAAAATTGTGTTCAAATTNATTCNCCAGCATGGAAGAAGAANTCTTGTGTTTATGAACTTTGTATNCNTGNGTCATAATGNAA
  5   1   2       bld Ga18      in                       xlk68c15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTCTGCATTCATAGCANNNNNATTTATGTTTGCTCCCATTTTATTTTGTTTCTGCNNNNCCTTTAGAAGGGATGTAGTAAAATTATTTTATAGAATTCATCTAGCAGTCGTATTACATTATAGCTTNNNNGTTTAAAAATTGTGTTCAAATTTATTCGCCAGCATGGAAGAAGAAATCTTGTGTTTATGAACTTTGTATGCCTGTGTCATAATGTAAGCCTTTTTCCCCCTTTAATAAATATTCCTTTACATTTTTTATNaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)