Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:3474831-IMAGp.5                24 PI      84        115      714                LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 90%

 1012768703 Xl3.1-XL504g17ex.5 - 41 ESTs
                                                                       .........-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL504g17ex.5                                                                                                                                                                                                                                                                                                                                                                                                      CGGAAGATTCGCAAGACAGGCGCTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTTGTATATGAATTTTATTTTATTGATATTGAACCCAATATTTGAATTTGGATTTGAGATAAATCAGATTTTCT
                                                  Xl3.1-CHK-1012687110                                                                                                                                                                                                                                                                                                                                                                                                            ATTCGCxAGxxxGGCGCTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTxxxxxAxxxxxTTTATTTTATTGAxxxxxAACCCAAxxxxTxxATTTxGATTTGAGATAAATCAGATTTTCTAAATGA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                           2     3     2     4     6    11     9    15    15    17    17    23    23    27    26    29    27    30    24    30    27    30    27    30    29    30    29    32    30    33    31    33    31    33    34    37    34    37    34    37    36    38    36    38    35    38    37    39    38    39    36    39    37    39    36    37    36    37    28    37    34    37    34    37    35    38    36    38    36    38    36    38    35    38    35    38    34    37    33    37    33    37    33    37    33    37    32    37    33    37    33    37    31    35    25    35    25    35    25    35    25    35    25    35    24    35    24    35    22    32    21    32    16    31    15    26    16    26     8    23     8    22     5    17     6    14     5    13     4    13     4    12     2    10     2     6     2     4     2     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAATAAAGGATGTGTTAACATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATATGAATTTCT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                  A-G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -T----------
                                               BLH ATG     135     456                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MIN     126      60                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH MPR      18      60                                                                                                                                                                                                                                                                                                                                                                                                      
                                               BLH OVR     135      57                                                                                                                                                                                                                                                                                                                                                                                                      
                                               EST CLI      21      24                                                                                                                                                                                                                                                                                                                                                                                                      
                                               ORF LNG     135       1                                                                                                                                                                                                                                                                                                                                                                                                      
  5   1   2       bld Neu7      in                         XL042f02.5p GGCTGGCTGAACGTAATGGATATTTCTAGNAGCGGTATAGATGTCGGAGAGTCGTTTTCTCATGTGAGATAGATATGCGTTCCTCTGTACTTCTGTCTTGTCTCTGACCATGTCCATTCCTTCCCATCAACCCAAGGCTATTTCCTGCCACACTGAGCTCACTTTCATAAAGTACAGAGTCTGGAGAGCCGAATCTTAATTTAGTTTCTTTAATCTACTCCCAGTTGACTATGAATGAAAAAGCTCAGATGATTTGTCAATAAAGTTACCTgaaaaaaagtagggcaaaaaaGTCTTGTCCTCGCGAGTTTAATTTTTACGTAATCACCACGCGACTCATTCATTCAGTCGTTTAGGGAGCGCGCTAATTGCGGCCTCTTTAAATTCTCGCGAGATTTATAAAGACAGGCGCTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAG
  5   1   2       chi DMZ       in                         xl225n08.5p                                                                                                                                                                                                                                                                                                                                                                                                      CGGAAGATTCGCGAGCTTTCTGGAGAGAAACTGTGTAACTGTGAAAGGAAGGTTGAATGAGCTGCTAGTGGTTTAGCGCTGGCTGAACGTAATGGATATTTCTAGAGCGGTATAGATGTCGGAGAGTCGTTTTCTCATCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGgtttttgttctttttttCTAAATAAAGGATATGTTTAACATTTAAA
  3   1   2       chi DMZ       in                         xl225n08.3p                                                                                                                                                                                                                                                                                                                                                                                                      CGGAAGATTCGCGAGCTTTCTGGAGAGAAACTGTGTAACTGTGAAAGGAAGGTTGAATGAGCTGCTAGTGGTTTAGCGCTGGCTGAACGTAATGGATATTTCTAGAGCGGTATAGATGTCGGAGAGTCGTTTTCTCATCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTT
  5   1   2       bld Gas8      in                    IMAGE:3517119.5p                                                                                                                                                                                                                                                                                                                                                                                                                  AAGACAGGCGCTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTAAGATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGATTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTNTACCTGTTATACAGGTTTTGTGTAAGAGTCACACAT
  3   1   2       bld Ga18      in                      xlk164o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                         GCGCTAGAACGGTGAACGAGTANNAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGNNCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAANNAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTT
  3   1   2       bld Ga18      in                      xlk108l20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                          CNCTANNACGNNGAACGAGTAGAAGGNNCTTGTTTGTAGTGATATTTTCNANCNGTAGCCGNTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCNCCACTGCAGCAGGANCGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATATGTTAACATTTATCAGATCTTGTTATTTAGCAAATCTAGAATCTCTTTATGTATATGAATTTCTTTATTTTATTGANNCCNNNNCTATAT
  5   1   2       bld Ga18      in                      xlk164o22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                           CNNTAGAACGTGAACGAGTAGAAGGNACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGNCCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACNNNNNNACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTNCGATAAACAGATTTATTTGGGCAAGANTGAGCCCCAAGNNTTTGTTCTTTTTTTCTNAATAAAGGAT
  5   1   2       bld Egg3                            IMAGE:6325277.5p                                                                                                                                                                                                                                                                                                                                                                                                                            TTCCCGGGGTGGACGAGTAGAAGGCACTTGTTTGTAGTAAGATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCCAGAACTGAGCCCAAGGGNTTTTGTTCttttttttCTAAATAAAGGGATGTGTTTAACATTTATCAGCCTCTTGTTATTTTAGCAAAATCTAAGAATCTCCAATGGAATTATGGAAATTTCCTTTAATTTTAATTTGGAAACCCCCAAAACCCCTAATATTTTTGGAATTTTTGGAAAATTAAAATCCCAGGAATTTTTTCCTTGGCCAGGGGAAAAGTTAAAAAGGGGGCCAACCCCAAGTTTCTTGTG
  5   1   2       bld Ga18      in                      xlk108l20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                            CNAGAACGGTGAACGAGTAGAAGGNACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACNNNNNNACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGANTGAGCCCCAAGGNTTTTGTTCTTTTTTTCTAAATAAAGGANNNGTTAACATTTATCAGATCTTGTTATTTAGCAAATCTAGNATCTCTTTATGTNTATGANTTCT
  5   1   2       bld DMZ       in                         xl253a09.5p                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGgtttttgttctttttttctaaataaaggatgtgttaacatttaaaaaaaaaa
  3   1   2      seed DMZ       in                         xl253a09.3p                                                                                                                                                                                                                                                                                                                                                                                                                            CTAGAACGGTGAACGAGTAGAAGGCACTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGG
  5   1   2       bld Ga15                               XL504g17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                AACGGTGAACGAGTAGAAGGCGCTTGTTTGTAGAGATATTGTCTAGCGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAATACTGAGCCCCAAGGTTTTTGTTCtttttttttttCTAAATAAAGGATGTGTTAACATTTATCNCCTCTTGTTAT
  3   1   2       bld Ga15                               XL449f13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGTGAACGAGTAGAAGGCACTTGTTTGTAGTAAGATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTATATGAATTTCTTTATTTTATGAACCCAAACCCTATATTG
  5   1   2       bld Egg3      in                    IMAGE:3378413.5p                                                                                                                                                                                                                                                                                                                                                                                                                                    CGGGACGAGTAGAAGGCACTTGTTTGTAGTAAGATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACAT
  5   1   2       bld Ga15                               XL404c20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                       AACGAGTAGAAGGCGCTTGTTTGTAGAGATATTGTCTAGCGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAATACTGAGCCCCAAGGtttttgttctttttttttttctaaataaaggatgtgttancatttaaaaaaaaaa
  5   1   2       bld Lmb2                            IMAGE:8636647.5p                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAGGCGCTTGTTTGTAGAGATATTGTCTAGCGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAATACTGAGCCCAAGGtttttgttctttttttttCTAATAAAGGAGTGTTACCTTTAAATAATTATATCCTAATAAAATAATAAGGCGGCCCAGCCTGATTCTTAAACCCGCTGACCTCCGCCTTAGGAGCTATTCTAGACCGAATGTAAAACTGAGATTTGCAACCCACTATGCTGAAATGCTATTT
  5   1   2       bld Ga12      in                         XL174n02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGAT
  5   1   2       bld Ga12      in                         XL198h15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAAAATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGgtttttgttctttttttctaaataaaggatgtgttaacatttaaaaaaaaaa
  5   1   2       bld Ga12      in                         XL185m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACGAGGGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGgtttttgttctttttttCTAAATAAAGGATATGTTAACATTTATCAGATCTTGTTATTTAGCAAATCTAGAATCTCTTTATGTATATGAATTTCTTTATTTTATTGAACCCAAACCCTATAT
  3   1   2       bld Ga12      in                         XL198h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTTGTAGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAAAATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTT
  5   1   2       bld Egg3      in                    IMAGE:3378133.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTGTAGTAAGATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCA
  5   1   2       bld Ga12      in                         XL162g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTC
  3   1   2       bld Ga12      in                         XL185m24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGATATTTTCTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATATGTTAACATTTATCAGATCTTGTTATTTAGCAAATCTAGAATCTCTTTATGTATATGAATTTCTTTATTTTATTGAACCCAAAC
  5   1   2       bld Emb1                            IMAGE:6635812.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCACGCGTCCGCCCACGCGTCCGGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCtttttttttttCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAATTCTAGAATATCTTTATGGATATGAAATTCTTTATTTTATTGAACCCAAACCCTATATTTTGATTTGAGATAAATCAGATTTTCTAAATGAAGATTTaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGCCGCCTCTATGAGTATCCCCTCGAGGGGGCCCAAAGCTTACGCCGTACCCAAGCTTTCCTTGGTACAAAAGTGGGTCCA
  5   1   2       bld Tbd7      in                         XL061f24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGAT
  3   1   2       bld Ga18      in                       xlk81l19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCNNCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAANCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATNGGNCAAGNCTGAGCCCCAAGGTTT
  3   1   2       bld Ga12      in                         XL162g10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTATATGAATTTCTTTATTTTATTGAACCCAAACCC
  5   1   2       bld Ga18      in                       xlk81l19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACGGTAGCCGGTCTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCNCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTNACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACNNNNNNACACTCAGCTTCTCCAGGATGCNNAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGNTGAANNAGGTTCACAAGCATTGATAGGTGTTGTCAACTNCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTNNNATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCNAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGANTGAGCCCCAANgtttttgttctttttttCTAAATNAAGNATATGTTAACATTTNA
  5   1   2       bld Ga15                               XL499i09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTTTAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCttttttttttttNCNAAAT
  5   1   2       bld Emb1                   IMAGE:6635812-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTCTATAGTTTCCAGCCAGAGTTTTGTTGGCGCGACTGCAGCAGGAACGATGCTATTCTACTCATTCTTCAAGTCTCTGGTAGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCtttttttttttCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGC
  3   1   2       bld Ga12      in                         XL174n02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGTTTCCAGCCAGAGTTTTGTTGGCGCCACTGCAGCAGGAACGATGCTATTCTACTCCTTCTTCAAGTCTCTGGTAGGCAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAG
  3   1   2       bld Egg3                            IMAGE:3379360.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCATTATTTAGATCTCTGAAGAGCAGGGATGTGATTGTAGTACTGGAAAATAGATTGGAGGATCTGGGGTACTCTACACTCAGTTGGATCAGGATTTGAGCATTAAGGTGATTGATATCAGTGTAACGCACCCAGAATAATATCCACCCATGTTGGCCGTGGAGNATTGTTTCATCCTTGGATCTGTTGTGCGCTATGAACAGCTCCCGGCAGACGAAGTAGGCACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAGCCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTTTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTATATGAATTTTTTTATTTTATTGAACCCCAACCCTATATTTGAATTTGAGATAAAT
  3   1   2       bld Egg5      in                    IMAGE:3431243.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCATTCTTCAAGTCTCTGGTAGGGGAGGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGNATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAATACTGAGCCCCAAGGTTTTTGTTCTTTTTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAATTCTAGAATATCTTTATGTATATGAATTTCTTTATTTTATTGAACCCAAACCCTATATTTGAATTTGAGATGAATCAGATTTTCTAAATGAAAA
  5   1   2       bld Egg5      in                    IMAGE:3431243.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGGAAGGATGTGGTGGTAGAACTGAAGAATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCTGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTGCCCTTCGAATTCCTGAAGCTTCATGTGCAATGACTTGTGATGCTATTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATNTATTTGGGCAATACTGAGC
  3   1   2       bld Gas8      in                    IMAGE:3517119.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATATGTTAACATTAAAAAAAAAAAAAAA
  5   1   2       bld Ga12                                 XL201l19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AATGATTTGAGTATCTGTGGTACTCTACACTCATTTGATCANTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAANAATATCCACACATGTTGNCCGTGAAGAATTGTTTCNTCCGTGGATCTGTTG
  3   1   2       bld Neu7      in                         XL042f02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCTGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATATGTTAACATTTATCAGATCTTGTTATTTAGCAAATCTAGAATCNCTTTATGTATATGAATTTNCTTTATTTTATTGAACCCAAACCCTA
  3   1   2       bld Tbd7      in                         XL061f24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTTGAGTATCTGTGGTACTCTACACTCAGTTGATCAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGNATGTGTTAACATTTATCAGCTCTCGTTATTTAGCANATCTAGAAT
  3   1   2       bld Egg3      in                    IMAGE:3378133.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTATTTGAACATTAAGCTGACTGATATCAGTGTAACGGACCCAGAANAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTNCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAAATAAAGGATGTGTTAACATTTATCAGCTCTTGTTATTTAGCAAATCTAGAATCTCTATGTATATGAATTTCTTTATTTTATTGAACCCAAACCCTATATTTGAATTTGA
  5   1   2       bld Ga15                               XL424a05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTAACGGACCCAGAAAAATATCCACACATGTTGTCCGTGAAGAATTGTTTCATCCGTGGATCTGTTGTGCGCTATGTACAGCTCCCGGCAGACGAAGTAGACACTCAGCTTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGGTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGgtttttgttctttttttctaaataaaggatgtgttaacattaaaaaaaaaa
  3   1   2       bld Egg3      in                    IMAGE:3378413.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCTCCAGGATGCTGCAAGGAAAGAAGCAGTTCAGCAAAAGCAGTGACCTACAAGAGCTGGAAGGTTGAATGCAGGTTCACAAGCATTGATAGGTGTTGTCAACTGCCTGTTTCTATAAGACCATGTAAAAGAGTGAGCAGCAACATTTTACCTGTTATACAGGTTTTGTGTAAGAGTCACACATTTTTCCCCTTCGAATTTCTGAAGCTTCATGTGCAATGACTTGTGATGCTGTTCACTTTTGAATCCAAGCAATGCAAAGAAGTGGTCTCCGATAAACAGATTTATTTGGGCAAGACTGAGCCCCAAGGTTTTTGTTCTTTTTTTCTAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)