Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL450l07ex.5                          9 END     5          12       55                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6956293.3.5                    66 PI      85        610     1164                OTX5b protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012768705 Xl3.1-xlk77g21ex.3 - 39 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                 3     6     3     6     3     6     3     6     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     8     3     8     3     8     3    10     3    10     3    10     3    11     3    11     3    11     3    11     3    11     5    11     9    11    10    10    12    12    13    13    13    16    13    16    13    17    14    18    15    19    16    22    19    24    20    24    17    24    21    25    26    28    27    28    27    28    27    28    27    28    27    28    27    29    28    29    26    29    27    29    27    29    26    29    30    30    30    30    30    30    30    30    30    30    30    30    30    30    30    31    29    30    29    32    26    30    27    30    26    30    25    29    26    29    25    28    25    28    25    27    25    27    25    27    25    27    27    28    28    29    28    29    28    29    28    29    27    28    26    28    26    28    25    27    26    27    26    27    26    27    26    27    25    27    26    27    21    26    24    26    23    26    21    25    20    23    21    22    20    22    19    21    18    19     5     6     4     4     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ---------T--
                                                    Xl3.1-xlk77g21ex.3                                                                                                                                                                                TGA------------------------------------------------------------------------------------ATGTAA---------------------------------ATG------------TAAATG---TAG------------------------------------------------------TAA---------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------TAA---------TAA---------------------------------ATG---------TGA---------------------------------------------------------TAA---------------------------------------------------------TGA---------------TGA---------------TGA---------------------------------------------------------------------------------------------------TAA------------------------------------TAG------------------------------------TAA------------TAA---ATG---------------------------------ATG---------------------ATG------------ATG---------------------------------------------------TGA------TAG---------------------------------------------------TAG---TGA---------TAA---ATG---TGA---------TAAATG------------------------TGA
  5   1   2       bld Ga15      in                       XL472c02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTGCTGAACATTTTGCTTATTATGTCCCAGCCACCAAAGAATAATCAGTAATCTCTGGAGTAAAATAGTTCTCCAAATAAATACCAAAGTTTCAGAATGAGAAAAGAATGAACACAGCCACCCCTTGTTGTTCCAGTTGAAACTTCTTTAGCCAAGCAATACATATTTTAAACTCTGAGTATATCTGATCACACACAGGAGCTTCAACAGGTGTATATATCAGCCGCCTGATGCAAAACCTGTATTTGAAAAAATGATAAAGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACT
  5   1   2       bld Neu1      in                        Neu1-13F8.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATAAATACCAAAGTTTCAGAATGAGAAAAGAATGAACACAGCCACCCCTTGTTGTTCCAGTTGAAACTTCTTTAGCCAAGCAATACATATTTTAAACTCTGAGTATATCTGATCACACACAGGAGCTTCAACAGGTGTATATATCAGCCGCCTGATGCAAAACCTGTATTTGAAAAAATGATAAAGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGATGAAGACTTAAC
  3   1   2       bld Ga15      in                       XL466l18ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAAGTTTCAGAATGGAGAAAAGAATGAACACAGCCATCCCTNGTTGTTCCAGTTGAAACTTCTTTAGCCAAGCAATACATATNTTAAACTCTGAGTATATCTGATCACACACAGGAGCTTCAACAGGTGTATATATCAGCCGCCTGATGCAAAACCTGTATTTGAAAAAATGATAAAGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGAAGACTTAACAGGCTCCTCATGTACCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAAGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACGAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAANGTTATGACAAAAAATAT
  3   1   2       bld Ga15 5g3  out                      XL436h09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCACCCCTGGTTGTTCCAGTTGAAACTTCTGTAGCCAAGCAATACATATTTTAAACTCTGAGTATATCTGATCACACACAGGAGCTTCAACAGGTGTATATATCAGCCGCCTGATGCAAAACCTGTATTTGAAAAAATGATAAAGAATGAAAAGTATTCNGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGAAGACTTAACAGGCTCCTCATGTACCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTANGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGNGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACTAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAATGTTATGACAAAAAATATAA
  3   1   2       bld Neu7      in                         XL035n23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGCAATACATATTTTAAACTCTGAGTATATCTGATCACACACAGGAGCTTCAACAGGTGTATATATCAGCCGCCTGATGCAAAACCTGTATTTGAAAAAATGATAAAGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGAAGACTTAACAGGCTCCTCATGTACCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACTAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAATGTTATGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTG
  5   1   2       bld Ga15                               XL491i13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATTTGAAAAAATGATAAAGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGAACTTCNGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGAAGACTTAACAGGCTCCTCATGTACCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTANTATAGTTCTACGTANGGGGTTTGTGTCTGTT
  3   1   2       bld Ga18      in                      xlk148e19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAATGAAAAGTATTCTGCTCTGTCCAGTTAAGGACACAATGTCTGANCTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGATGAAGACTTAACAGGCTCCTCATGTNCCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTANCCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTNCCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGNCGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGNCTAGTATAGTTCTACGTAGGGGTTNGTGTCTGTTCCANCGAATTAGNACAANCGTTCTCTTAGTTCTGATATNNNANTTAATTANNNNNATGACAAAAAATATAAA
  5   1   2       bld Ga18      in                      xlk148e19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ANNGAAAAGNATTCTNNTCTGTCCAGTTAAGGACACAATGTCTGAACTTCAGGAAAGACTCTCAACCAGTGCAATTCCAGATACTGGAATCCAACTTGATGAAGACTTAACAGGCTCCTCATGTACCAGCGCTAACACAATCACTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACGAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAATGTTATGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTGAANNACaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL474l01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACGAATTAGTACAAACGTTCTCTTAGTTCTGatatattaattaattaatgttatgacaaaaaatataaatgtgcaaaatattaaaattattgtgttgaaccacaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL474l01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTAGTACATTGCAAGAAATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACGAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAATGTTATGACAAAAAATATAAAT
  3   1   2       bld Neu1      in                        Neu1-13F8.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGCACATTTATTTGAACAGGCATAAACTCAAGACAACTAACCAATGATATTTTTGAATGGAGTTAATTTATTTTATAAAATGTTTCTACCTACCCGCCACTGTATGATTTGTCGTACTATGGAATCCTATAGACGAGAAGTGTTTTTCTGTGTTGTGCTTTCATCTTTGTGTTGACTAGTATAGTTCTACGTAGGGGTTTGTGTCTGTTCCAACGAATTAGTACAAACGTTCTCTTAGTTCTGATATATTAATTAATTAATGTTATGACAAAAAATATAAATGTGCAAAATATTAAAATTATTGTGTTGAACCAC

In case of problems mail me! (