Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl313c23.5                            8 END     1           1       12                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012768751 Xl3.1-IMAGE:4783357-IMAGp.5 - 63 ESTs
                                                                       ...-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                           Xl3.1-IMAGE:4783357-IMAGp.5                                                                GGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTAAAAAAAATGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAAT
                                                  Xl3.1-CHK-1012686228                                                                      TGGAGTTAAGGGACTGAGCGCTGGxxxxxxCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTAAAAAAAATGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTG
                                                      consensus depths                                                                     2     5     2     5     2     5     4     9     6    12     7    15    10    17    11    20    11    20    11    20    12    20    12    20    18    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    20    22    22    22    22    22    21    21    20    21    20    21    20    20    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    17    16    16    13    13    12    12    10    12    11    11    12    12    12    12    12    12    10    12     9    11     8    10     7    10     7    10     7    10     8    11     7    10     6    10     7    10     6     9     6     9     5     9     6     8     6     8     5     8     5     8     4     7     4     6     4     5     5     6     5     6     5     6     5     5     5     5     5     5     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     5     6     5     6     5     6     6     7     6     7     5     7     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     8     5     9     5     9     6    10     7    12     6    11     6    11     6    11     6    11     8    11     6    11     6    11     6    11     8    11     9    11     8    11     8    10     7    11     7    11     9    12    11    13    12    14    12    14    12    14    12    15    13    16    14    17    12    17    18    24    17    25    15    25    16    25    17    25    17    25    17    27    17    27    17    27    17    27    18    28    17    28    24    27    26    28    26    28    28    29    27    30    28    30    29    31    29    29    29    29    28    29    28    29    29    29    28    28    28    28    28    28    28    28    27    28    28    28    27    28    28    29    27    29    27    29    26    29    28    29    27    29    27    29    27    28    27    28    27    28    27    28    27    28    27    27    26    26    26    26    25    25    25    25    24    24    24    24    24    24    24    24    22    24    20    24    15    22    12    15    11    13
                                                                   VAR                                                                                                                            GTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCAGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAG
                                                                   SNP                                                                                                                                                                                                                                                                -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------A-
                                               BLH ATG     185     589                                                                
                                               BLH MIN     116     112                                                                
                                               BLH MPR     110     112                                                                
                                               BLH OVR     185     167                                                                
                                               EST CLI      30       8                                                                
                                               ORF LNG     185      34                                                                
                                                                                                                                                                                                                                                                            PREDICTED - Sp ---- 1e-006     XP_001193697.1 PREDICTED: similar to MGC139071 protein, partial [Strongylocentrotus purpuratus] ===================================================================================================================================================================================
                                                                                                                                                                                                                                                    PROTEIN === Dm ==== 8e-017     NP_723965.1 chiffon CG5813-PB [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Dr ==== 3e-041     XP_001339420.1 PREDICTED: solute carrier family 44, member 2, partial [Danio rerio] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Mm ---- 6e-072     NP_038754.1 activator of S phase kinase [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Bt ---- 7e-076     NP_001068944.2 activator of S phase kinase [Bos taurus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                             PREDICTED - Cf ---- 9e-078     XP_532451.2 PREDICTED: similar to activator of S phase kinase [Canis familiaris] --------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 4e-081     NP_006707.1 activator of S phase kinase [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                       PREDICTED - Gg ---- 5e-085     XP_418638.1 PREDICTED: similar to activator of S phase kinase [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xt ==== 0          NP_001037970.1 Novel protein similar to ASK/DBF4 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAR22406.1 Dbf4 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                           Xl3.1-IMAGE:4783357-IMAGp.5                                                                                    TGA---------TGA------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------TAA---------TAA---------------------------------ATG------------------------------------------------------------------------ATG------------------------TAGTAA
                                                                   ORF                                                                                                                                                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  3  -1   2       bld Tbd4                            IMAGE:4060502.3p AACTTTGGCAGATCTGAATTCCCCGGGGGAGAGAGGCGGGAAAACAGACGGAGTCTCAAACTGGGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCAGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTAA
  5   1   2       bld Neu7 5g3  in                         XL035m20.5p                GCTCAAACTGGGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGTCGAACGATATCATTGAACCGAATGAATTTTTACTCAGGCAGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCAGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTA
  3   1   2       bld Ga12      in                         XL164p04.3p                                                     GAACAGACGGAGTCTCAAACTGGGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTAGTCAAGAAGAA
  5   1   2       bld Ga12      in                         XL164p04.5p                                                      GAACAGACGGAGTCTCAAACTGGGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaaa
  5   1   2       bld Ga15 5g                            XL478n12ex.5p                                                               GGGGAAGTGGAGTTAAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTANCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATACGCGATTACGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAANAGCCTTGTAAGTCGGGGGAAATCTTTANTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATANTATATTATCTCATGCCCTAAACTGGGGAGTAAAAATACTTCATGTT
  5   1   2       bld Oo1  5g                         IMAGE:6641046.5p                                                                                              ACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCGTAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCTATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTANACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCCTGGTAGTGAANGGTTGAGAGCAAACCTCANACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATTAANAGTAGAAGACTGCAGCTGCCAGTACAGACCCGTNATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAATNATATCCTTGTAAAAGTTGGATAAAAAAAGCAGATCCCTGGGACAGAAAGCTTCCAGAAACCAAACAAAGGG
  5   1   2       bld Emb1 5g                         IMAGE:5161881.5p                                                                                              ACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCGTAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCTATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCCTGTAGTGAAGGTTGAGAGCAAACCTCAAACCCGACGCAAAGTANAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGT
  5   1   2       bld Tbd7 5g3  in                         XL096o24.5p                                                                                                GGCGGATTGATGTGTCCGGGNAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCAGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCAGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAA
  5   1   2       bld Emb1 5g3  in                    IMAGE:3402603.5p                                                                                                   GCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCT
  5   1   2       bld Tbd7 5g3  in                         XL051i22.5p                                                                                                       GGCGCAGCGGATTGATGTGTCCGGGNAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACT
  5   1   2       bld DMZ  5g3  in                         xl252g23.5p                                                                                                              GCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCGTAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCTATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAG
  5   1   2       bld DMZ  5g3  in                         xl272b03.5p                                                                                                              GCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCGTAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCTATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGANGCANAGCATTATATTGAA
  5   1   2       bld Ga12 5g3  in                         XL206c04.5p                                                                                                                  ATTGATGTGTCCGGGAGCCCCAGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAA
  5   1   2       bld Tbd7 5g3  in                         XL088h21.5p                                                                                                                      GCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCAGTGCCTCCCCCAGAGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCAGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGG
  5   1   2       bld Neu7 5g3  in                         XL045d18.5p                                                                                                                        GTCGAACGATATCATTGAACCGAATGAATTTTTACTCAGGCAGTGCCTCCCCCAGNGGACAAAGCAAATGAAACCAACAGGGGATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCAGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAA
  5   1   2       bld Em10 5g                         IMAGE:8321529.5p                                                                                                                                      CGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGTGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAGTAAAACCTCAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTG
  5   1   2       bld Oo1  5g                         IMAGE:6642643.5p                                                                                                                                       GGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCGTAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCTATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACCTCAAACCCGACGCCAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAAGACTGCAGCTGCCAATACAGACCCGTTATACCTTGGATTTGCCACCACATTTCGATCATTTCCCAAATCCTGGTGGTCAAATTATTCCTGTAAAAGGTGGGAATAAAAAAAGCCGATCCCTGGGCCCAAAAGACTTTCCCgaaaaccaaaaaccaacggggtaaaataaaaaacCGGGGGCCTTGGGAACCAAGAATGG
  5   1   2       chi Ga15      in                       XL517f13ex.5p                                                                                                                                             AAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaaa
  3   1   2       chi Ga15      in                       XL517f13ex.3p                                                                                                                                             AAGGGACTGAGCGCTGGCGCAGCGGATTGATGTGTCCGGGAGCCCCGGTGGGGCCTTGCTGGGAGGACTCGCCGAATGTTCGGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCG
  5   1   2       bld Ga12 5g3  in                         XL180a23.5p                                                                                                                                               CTTGCTGGGAGGACTCGCCGAATGTTCGGCGGTGCCTCCCCCAGAGGACAAAGCAAATGAATCCAAGTTGCACAGAAACCGAGGAACACATGGTCGAGGTGTGAAAATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCANACGTATGCNAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTA
  5   1   2       bld Ga18 5g3  in                      xlk101h17ex.5p                                                                                                                                                                                                                                                         ATGAAATCTACCATAGCAGCAGTGAAGAATCCGACTGGAAAAGTTCAGGCAGACGTATGCAAACCTTTCACTGGGAAGTTGTTCTATCTTGACCTTACATCCAAACTAATATCTGAAAAATTGGAAAAAGATATAAAAGAACTTGGAGGCGCTATCGAAGGATTTCTTAGCAAGGAGATAAGCTATCTTATAACCAGTAAAAAGGAGGCAAAATGTGTGAAGACTTTAAAGTATGTTTGTTCAATACCAAGTCCTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAANNATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGANTGCAGCTGCCAGTNCAGANCGTTATACCTTGTATTNCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAAGCAGATCCTGGACAGAAGCTTNCAGAAANAAAACAAAGT
  5   1   2       bld Ov1       in                    IMAGE:5049425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GATATCGTCGACCCACGCGTCCGTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACATACCGTTATACCTTGTATTGCCACAT
  5   1   2       bld Ov1       in                    IMAGE:5049424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGTGAAGCTGCTCCAAACACTGGAGAGAGTTCAACCAGCCCGGGCAATAGGCGATTATGTCAAGAAGGAAATTCAAGTaaaaaaaaTGAAAAGAGCCTTGTAAGTCGGGGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATTCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAA
  5   1   2       bld Oo1                             IMAGE:6639533.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAAATCTTTAGTGAAAAGGGCAATCAAAGAGCAGGAAATTCTACCAAAAAATAGTATATTATCTAATGCCCTAAACTGGGGAGTAAAAATACTTCATGTTGAAGAAGCAAAGCATTATATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAGCAAACTTCAAACCCGACGCAAAGTAAAACCTCAAAAACTAAAAAGCCCATATATAAAAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTANAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAATCTNAAACTGAAGGCCAGNAAAGAAATGAAGCAAATTTGTTTGTTTTCAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATGCANGAGAATACTTTTAAAGATCAGCATGCGAGTCCTTGGTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGGTTTTCTTGCCCTCCTCTGCGGGATCTGCCCGNNTTATGTACAAAAATATAAAATGGACTCCNAACTTTGAACACTTGGTGCAACGNCCTCTGGCATCTTTCCATTTTGAAGGACAGGTCTCCCAGTTTCCTTTTGGG
  5   1   2       bld DMZ                                  xl241g10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAgcaaacttcaaacccgacgcaaagtaaaacctcaaaaactaaaaagcccatatataaaaGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCA
  5   1   2       bld DMZ                                  xl341f03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGAAAAGAAGAAAACTGCATTGCAACAAGTCAGAAAGTCCCAACCTGTAGTGAAGGTTGAGAgcaaacttcaaacccgacgcaaagtaaaacctcaaaaactaaaaagcccatatataaaaGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGTCAAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACAGAAGCTTCCAGAAACAAAACAAAGTGTAAATAAGACTGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCA
  5   1   2       bld DMZ                                  xl341h03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGCCCATATATAANAGTAGAAGACTGCAGCTGCCAGTACAGACCGTTATACCTTGTATTGCCACAATTTCGATCATTCCAGAATCCTGTGNCNAATTATTCTGTAGAGGTGGATAAAAAAGCAGATCCTGGACNGAAGCTTCCA
  5   1   2       chi Kid                             IMAGE:4030807.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGTCATGGACAAGATGGTGCAAACAATCCAAATATAAAGTTAAAGGAACAAAAGAAGCATGGCTACTGTGAGTGCTGTCTTAAAAAATATGATGACCTGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGAATCATTTCAATGAATACCTTGTATGATGCTGCTGCGCCCCTTAATGATCCGGATATCAAGAGTCAGTCGACGCGCTCACAGNTTGGGTN
  5   1   2       bld Tbd7      in                         XL054g07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGGAATCTCATATTTTAAGTCCGCAGCACAAGAACTTTTCAGAAAGCGCATACTATCAAGTGGTTGACGATCTTATTTCTACCTTTGATTTTGACTTTGTGGATTGGTCAAAGTACAAAAATGGAAGAAAAGGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGCTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCAATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTTCGTTGCTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTAAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAA
  5   1   2       bld Tad1                            IMAGE:6879656.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGTTACCTGTTACAACATATTCattatatttttttatatatatttattatttatttatttttatGCAGTGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGTAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCANCAATANAGGACATAGGAGCAACGGACAAAATATACCCCCACTGTACAATTCGCATGGAGTACCTGCCCTGAATTATTCCTCCTTTCAGGGAAATCTTGGCAC
  5   1   2       bld Ga18      in                      xlk154c01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAGGNGTGGGAATATTGATGTTGGCTGAAAAATCTAAAACTGAAGGCCAGGAAAGAAATGAAGCAAATTTGTTTGTTTCAAAAACACACAATTTTTCAGAACGAGTGACCGCTACCACCCCATTGCAGGAGAATACTTTAAAGGATCAGCATGCGAGTCCTTGTTCTCTTCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACNNNCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACGAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGNAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGNNNNAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTNCACAGGAAAGTGAAGNNTTCAGCTCATAGAAACAAAAATAAGGNTGAGCTTTTCTGCAGACTCNCCCATNAAG
  3   1   2       bld Ga18      in                      xlk154c01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAAAATCNNAANTGNNNNNGNAANNAANGAAGNAANTTNNTNNTTCAAAAACANNNANTTTTCANNNNGANNGACNNNTNCCNCCCATTGCAGAGAATNCTTTAAAGGATCAGCATGCGAGNCCTTNTCTCTNCNTNNACTCCAGTTTNNAATNCCGATCAAATGTTTTCCTTGCCCTCNNTGNGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCANCTTTGGACAACTTGTNNAACNNCTCTGCCATCTTTCCATTTGAAGGACANTCTCACAGGTTCATTTGGTGGNAGAGAAATGTCCGTTACTAAACGAAATGAAACTATGGANCCTGCTACTGAAGGNCCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCNNACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATNCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAANCTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTAnnnnnnnnnATGCTTAAAATTAAGNNA
  3   1   2       bld Ga18 5g3  in                      xlk101h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AANGATCANNATGCGANNCCTTGTTCTNNTCNATGNACNCAGTTTNNAATNCCGATCAAATGTTTTCCNTTNNCTCNNNGCGGGATCTGCCGTTTATGTAACAAAAAATANAAAATGGNCTNCACTTTGGACAACTTGTGCAACNNCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCATTACTAANCTAAATGAAACTATGGANCCTGCTACTGAAGGNCCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATNTCTCGCAATGTATTCCACAGAAGGTAGACCCTATCTCACAGCATGTAAATCAATTTCCAAATGGAAATNCCCATTGTAGTGAAATGACTGCATNCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGTGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATACNNNNNNATGCTTAAAATTAAGNNA
  5   1   2       bld Gas6                            IMAGE:3473757.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCATGCACTCCAGTTTGCAATGCCGATCAAATGTTTCCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAAATGCCCATGGTGGGAAATGACTGCATGCCAGGCAGCTCTCATTTATGACAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAG
  3   1   2       bld Ga18                              rxlk78l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CNCCAGTTTNNAATGCNGANCAAATNNTTTCCNTGCCCTNNCNNNGGGATCTGCCCGTTTATGTAACAAAAAATATAAANTGGACTCCAACTTTGGANANCTTGNGNAACNCTCTNNCNNCTTTCCATTTGAAGGACAGTCTCANAGGTTCATTTGGTGNAAGAGAAATGTCCATTACTAAACTAAATGAANCTATGGANCCTGCTACTGAAGGNCCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATNCCACAGNAGGTAGACCCTATCTCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATNCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAANCTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGTGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTAnnnnnnnnAATGCTTAAAATTAAGANA
  5   1   2       bld Ga15      in                       XL447k12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCTTGCAATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCAATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTTCGTTGCTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTAAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACAT
  5   1   2       bld Gas6                   IMAGE:3473757-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATGCCGATCAAATGTTTTCCTTGCCCTCTCCTGCGGGATCTGCCCGTTTATGTAACAAAAAATATAAAATGGACTCCAACTTTGGACAACTTGTGGCAACGCCTCTGCCATCTTTCCATTTGAAGGACAGTCTCACAGGTTCATTTGGTGGAAGAGAAATGTCCGTTACTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGG
  3   1   2       bld Ga15      in                       XL447k12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGGAAGAGAAATGTTTCGTTGCTAAACTAAATGAAACTATGGAACCTGCTACTGAAGGACCAAAGATTAAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCT
  5   1   2       bld Egg1      in                    IMAGE:4783357.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCACGAGGAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATANAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGCACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGT
  5   1   2      seed Egg2                   IMAGE:4783357-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGAACTATGGAACCTGCTACTGAAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGcttttaatgtttgttttaattacaattttatttatccgtttttaTCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATaaaaaaaaaaaaaaaaaaGATTCGCGGCC
  3   1   2       bld Ga12 5g3  in                         XL206c04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGACCAAAGATTGAGTGGGATGTTTGCAATATTCCTAGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACT
  3   1   2       bld Ga15                               XL486l05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCAATATTCCTAGGCAATATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTAAAATTAAGA
  3   1   2       bld DMZ  5g3  in                         xl252g23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATCTCGCAATGTATTCCACAGAAGGTAGACCCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTAAAATTAAGATAC
  3   1   2       bld Ga12 5g3  in                         XL180a23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACAGAAGGTAGACCNTATCGCACAGCATGTAAATCAATTTCCNAATGGAAATACCCATNGTAGTGAAATGNCTGCATGCCAGGCAGCTNTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCTTAAGACTGTAAATGACCTTCNCAATAAAGGACATAGAGCAACGGACAAAATATACCCCNCTGTACAATCGCATGAGTACCTGCCTGATTATTNTCCTTCAGGAAATNTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCNTGNTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTANGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACNCCACCACTTCTGGCTCTTCGTTTCTNGGCTTTTAATGTTTGTTnTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCANTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCT
  3   1   2       bld Tbd7      in                         XL054g07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAG
  3   1   2       bld Neu7 5g3  in                         XL035m20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATA
  3   1   2       bld Neu7 5g3  in                         XL045d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTAAAATAAGAT
  3   1   2       bld Neu7      out                        XL036b19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACT
  3   1   2       bld Tbd7 5g3  in                         XL051i22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACT
  3   1   2       bld Tbd7                                 XL086c19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCGCACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATAC
  3   1   2       bld Tbd7 5g3  in                         XL088h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACAGCATGTAAATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTATTTTAGTAAGTAAAATATAC
  3   1   2       bld DMZ  5g3  in                         xl272b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCAATTTCCAAATGGAAATACCCATTGTAGTGAAATGACTGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCNTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTNATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTAAAANTAAGAA
  5   1   2       bld Egg1                            IMAGE:3300739.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCACGAGGGGAAATACCCATTGTAGTGAAATGACGGCATGCCAGGCAGCTCTCATTTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTT
  5   1   2       bld Egg1                               PBX0037B01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCTCATTTATGAAAATGTATATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATATAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTAttttttttCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAACGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCACGAAGATGATTCAAAGTTTCCCAGAGAAACCCTGCTAGCATTGTTTGAGTCCAGAGAGGATAAAACATAGTTAATATGGGTTTGCTGGCATCCCTGCATATGAATCGCGCAGTATGGATGATGGTGATACTCCGGATCAAACCCA
  5   1   2       bld Egg1                               PBX0038C01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGAAAATGTAGATTCAGCAGCGGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGcttttaatgtttgttttaattacaattttatttatccgtttttatcattttaatGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATaaaaaaaaaaaaaaaaaaaGATTC
  5   1   2       bld Egg1                               PBX0111A05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGATGCTAATATTAAACTTCCTAAGACTGTAAATGACCTTCACAATAAAGAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATC
  3   1   2       bld Tbd7 5g3  in                         XL096o24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTAAGACTGTAAATGACCTTCNCAATAAAGGACATAGAGCAACGGACAAAATATACCCCACTGTACAAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGTCTTAAAATTAAGNATANACTTATTTAGTGAAGTAA
  3   1   2       bld Ov1       in                    IMAGE:5049424.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATAGAGCAACGGACAAAATATACCCCACTGTACAATCGCATGAGTACCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATAAAAAAAAAAAAAAAG
  3   1   2       bld Ov1                             IMAGE:5074812.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTACAATCGCATGAGTACCTGCGTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGATTTTGTCTCTATTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAGATATAATGCTTATAAAAAAAAAAAAAAAG
  5   1   2       bld Egg1                               PBX0107E03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCACGAGGCCTGCCTGATTATTCTCCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAATAAAAATTAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCttttaatgtttgttttaattacaattttatttatccgtttttatcattttaATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATAATAT
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402603.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCTTCAGGAAATCTGCACAGGAAAGTGAAGACTTCAGCTCATAGAAACAAAAATAAGGATGAGCTTTTCTGCAGACTCTCCCATAAAGTGTCTGTTCCACAGCAAGAAGATGATTCAAAGTTTCCCAGTGAAACCCTGCTAGCATTGTTTGAGTCCAGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATA
  3   1   2       bld Egg1      in                    IMAGE:4783357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTGAGTCCAGGGAGGATAAAACAGAGTTTTTTGGCCCCCCTGCCCAGCCGGGGGGAAGAATAATGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATGAAGAAACTCTTATTTTAGTAAGTAAAATATACTGCTTATAAAAAAAAAAAAAAAAAAAGATTCGCGGCCGCAAGCTTATTCCCTTTAG
  3   1   2       bld Ov1       in                    IMAGE:5049425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGTGAGGATAAAACAGAGTTTTTTGGGTTTGCTGGCAGCCCTGCGTATGAATCGTGCAGTATGGATGATGGTGATACTCCGGATCAAACCCACAAAAAGATGCTTTTGTCTCTCTTCCCACACACCACCACTTCTGGCTCTTCGTTTCTTGGCTTTTAATGTTTGTTTTAATTACAATTTTATTTATCCGTTTTTATCATTTTAATGCTCAGAAAAGACTTTCCTTTTAATCCATTAAATAAACACCCCTATGTGAGATTTCGTTGTATAGCCACAGCAATGCTTAAAATTAAGATACTCTTATTTTAGTAAGTAAAATATACTGCTTATAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)