Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL025i18.3                            9 END     4           6       44                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL025i18.3                            9 PI      86        858     1584                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:3199584-IMAGp.5                 9 PI      82        467      736                LOC394987 protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012768755 Xl3.1-XL477f10ex.5 - 62 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                  7    10    10    16    15    27    16    30    17    33    18    36    18    36    19    37    20    38    20    38    22    40    23    40    23    40    23    40    23    40    23    41    23    41    24    41    24    41    24    41    24    41    41    41    41    41    41    41    41    41    25    41    41    41    41    41    41    41    39    41    41    41    40    41    24    41    41    41    41    41    41    41    39    41    41    41    41    41    39    41    39    42    38    43    39    43    39    43    41    43    41    42    39    41    37    40    37    40    36    40    36    39    34    38    33    38    32    36    25    33    24    32    20    31    19    31    15    30    13    28    16    29    14    28    10    26     9    25     7    22     8    20     6    21     6    18     6    17     6    15     8    18     7    17     9    15     8    15     7    14     7    14     9    14    11    16    11    15    11    15    12    16    12    17    13    17    13    17    14    18    14    16    14    15    14    15    15    16    15    16    15    16    15    17    16    17    16    17    16    17    14    17    16    17    15    17    16    17    17    18    17    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    16    18    17    18    17    18    17    18    17    18    17    18    17    18    17    17    17    17    17    17    15    17    17    17    16    17    16    17    14    16    14    16    13    16    12    16    12    16    12    16    10    14     6    12     2     6     2     5
                                                                   VAR                                         TTGTATGGATCGCTCTCCCCCACTGTAACTTCTCAGCTCGGATCTCTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                         TCTATTGCAGCC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                             GAGACGCTGCTC
                                                                   SNP                                                                                                                                                                                                                                                                                         --C----G----
                                                                   SNP                                                                                                                                                                                                                                                                                                     -------C---A
                                                                   SNP                                                                                                                                                                                                                                                                                                                             ----------GA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                 --------A--T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                         --T-A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                     ----CC------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                 C------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --G--------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------A
  5   1   2       bld Neu7      in                         XL046h17.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTGCACTTTGNGNAAGCACAAAACAAACAGNAAAGCCCAGNAACCCCCTTTACTACATCCCAACTGCTGGCTCTGGAGAGGAAATTCAGGCAGAAGCAGTATCTGTCCATAGCAGAGAGGGCAGAGTTCTCCAGCTCCCTGAACCTCACAGAGACCCAAGTGAAGATCTGGTTCCAGAACAGGAGAGCCAAAGCCAAAAGACTCCAAGAAGCAGAACTGGAAAAGTTTAAAATGGCTGCCAAACCCATGCTCCCACCTGCATTTGGAATCTCCTTCCCTCTTGGGACTCCAGTACCCACAGCCTCCTTGTATGGGACCTCCAACCCTTTCCAGAGGCCGTCTTTGCCAGTGTCTCCTATGGGACTTTACACAGCCCATGTTGGATACAGCATGTACCATCTGTCCTAAGACTTTGCTCAGGCTCCATTGGGACTGTGGGAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTG
  5   1   2       bld Neu7      in                         XL041p12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACCTCACAGAGACCCAAGTGAAGATCTGGTTCCAGAACAGGAGAGCCAAAGCCAAAAGACTCCAAGAAGCAGAACTGGAAAAGTTTAAAATGGCTGCCAAACCCATGCTCCCACCTGCATTTGGAATCTCCTTCCCTCTTGGGACTCCAGTACCCACAGCCTCCTTGTATGGGACCTCCAACCCTTTCCAGAGGCCGTCTTTGCCAGTGTCTCCTATGGGACTTTACACAGCCCATGTTGGATACAGCATGTACCATCTGTCCTAAGACTTTGCTCAGGCTCCATTGGGACTGTGGGAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGT
  5   1   2       bld Emb1                   IMAGE:6636253-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCTGCCAAACCCATGCTCCCACCTGCATTTGGAATCTCCTTCCCTCTTGGGACTCCAGTACCCACAGCCTCCTTGTATGGGACCTCCAACCCTTTCCAGAGGCCGTCTTTGCCAGTGTCTCCTATGGGACTTTACACAGCCCATGTTGGATACAGCATGTACCATCTGTCCTAAGACTTTGCTCAGGCTCCATTGGGACTGTGGGAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCT
  3   1   2       bld Em10 5g3  in                    IMAGE:7981082.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACACCCCTTGTAGGACTCCCACCCTTCCAGAGGCCTCTGTGCCAGGTCTCTATGGGACTTAACACAGCCCATGTGGATACAGCCAGTACCATCTGTCTAAGATTTTGCTCAGGCTCCAATGGGACTGTGGGAAAAGAAGACTTGAGTGAATTTTCTTTGCATCCCCTTATATTTTTTCACTATTTATGAGTCCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAACGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATATAGTA
  3   1   2       bld Em10      in                    IMAGE:7981660.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTTCAACCTTTCCAGAGCCGTTTTGCCAGTGTCTCCTATGGGACTTACACAGCCCATGTGATACAGCATGTACCATCTGTCTAAGACTTTGCTCAGGCTCCATGGGACTGTGGGAAAGAAGACTGAGTGAATTTCCTTGCATCCCCTTATATTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAACGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATTTAT
  3   1   2       bld Em10 5g3  in                    IMAGE:7982146.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTATTGGACTTTACACAGCCCCATGTTGGATACAGCATGTACCATCTGTCGTAAGACTTTGCTCAGGCTCCTTTGGGACTGTGGGAAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATTATA
  3   1   2       bld DMZ  5g3  in                         xl221i21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTATGGGACTTTACACAGCCCATGTNGGATACAGCATGTACCATCTGTCCTAAGACTTTGCTCAGGCTCCATTGGGACTGTGGGAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTGAAATTTATTATCATTATAT
  3   1   2       bld Tbd7 5g3  in                         XL075o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTTTACACAGCCCATGTTGGATACAGCATGTACCATCTGTCNTAAGACTTTGCTCAGGCTCCATTGGGACTGTGGGAAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCTTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGAACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATAT
  3   1   2       bld Neu7 5g3  in                         XL001o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGAAGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCTTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGAACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATNCCCTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATnCATTTATATTATAGTTATTTTGTTAA
  3   1   2       bld Ga12                                 XL172b09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACTTGAGTGAATTTTCCTTGCACCCCCTTATATTTTTTCACTATTTATGAGTTCATAGGGAATTGAATTGTAGAAATACTATGTCACTTCAATATGCATATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACAGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGNCAAGATTGATAAAGGGAGAAAAATATCTCTTACANANAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGT
  3   1   2       bld Neu7 5g3  in                         XL045c10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTTTCCTTGCACCCCCCTTATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCANATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATNTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAANAGNAAAATGTAATATAGTATTGAAGCTTTCACTTANCAGCNCTGTGCTGTTTGCATTTCGTTATNGCAATAATCCCNTTGGGAGGGAATTGTATGTAATATGTAATATANTGTATATTT
  3   1   2       bld Neu7      in                         XL046h17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATATTTTTTCACTATTTATGAGTTCCTAGGGAATTGAATTGTAGAAATACTATGTCACTTCAAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGATCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCAT
  3   1   2       bld Ga12      in                         XL170b23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTATTTANGAGTTCCTAGGGAATTGAATTGTAGAAATANTATGTCACTTCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTNTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAAGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATTATAGTTATATTTGTTAAATAAA
  3   1   2       bld Neu7 5g3  in                         XL035d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATGTCACTTCCAATATGCCTATTGTTGTCATCTTGTTAGCTGTGTCTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTAAATTTATTATCATTATATAAGTTATATTnTTAAATAATnATTTTAA
  3   1   2       bld Neu7      in                         XL041p12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAATTAGTAGTTCATGAGATTCAGGTGCCTTGTACACTACCATCTTCCCAAATTCTAATCCCAGTCCATAAAGTATCAGAACCCAGGGGATATCTGTAGCCTCAAAAGCATCCAATCCACTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCACAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATAT
  3   1   2       bld Neu7 5g3  in                         XL050c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ANCNTNTTNNCNAANTCNAATCCCAGNCCATAAAGTATCAGAACCCAGGGGATATNTGTAGCTTCNAAAGCATCCAATCCANTGCTTCAGGAGTTGTCCCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGNNNTNAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGNGGAGAGATCCTTTGACCCAGACTGGGTANNNGGGAAATAGCATAATTTTGGGTGGAACCAGCTGCTGTGTAACTGCCCCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGTATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATGTTATAT
  3   1   2       bld Gas8 5g3  in                    IMAGE:3517299.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCAGATGGAAAGGCTTCCCAGCAAAGGTGGTGAGCCCAGTGTAAATATACTATAATATGGTACAAACAGGACTGGGAACTTAATCGATTGGAGAAGAGATCCTTTGACCCAGACTGGGTAAGGGGGAAATAGCATAATTTTGGGTGGGACCAGCTGCTGTGTAACTGTACCTTTTGGGAGCTTGGCACAACCACAGAATGACAAGATTGATAAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATTATAGTTATATTTGTTAAATAAATTAATTTTAATGTAAAAAAAAAAAAAAAAA
  3   1   2       bld Tbd3                            IMAGE:3549479.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGGGAGAAAAATATCTCTTACATATAAGAGATAAATGTAATATAGTATTGAAGCTTTCACTTAACAGCACTGTCTGTTTGCATTTCGTTATTGCAATAATCCTTTGGGAGGGATTGTATGTAATATGTAATATATTGTATATTTGAAATTTATTATCATTTATATTATAGTTATATTTGTTAAATAAATTATTTTAATGTAAAAAAAAAAAA

In case of problems mail me! (