Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:8821385.5.5                    64 PI      74        226      804                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012768839 Xl3.1-XL520a11ex.5 - 79 ESTs
                                                                       0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL520a11ex.5 AGAATGGAACACGTATCTAATACAACAGAGTTAACATCCGGCTTAGTCAAGAGCGTCGCTACCAGCACTAAAGCTGATCCCTAGCCGATAGAGAGTCTTTTCCGGAAACAATAGAGATGACAAGTCCTGGCAAGAACGCCTCTCGAGCTCTAGTTACTAGTAAGGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACT
                                                  Xl3.1-CHK-1012685860       GAACACGTATCTAATACAACAGAGTTAACATCCGGCTTAGTCAAGAGCGTCGCTACCAGCACTAAAGCTGATCCCTAGCCGATAGAGAGTCTTTTCCGGAAACAATAGAGATGACAAGTCCTGGCAAGAACGCxxxxxGAGCTCTAGTTAxxxxxAxxGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACTGTCTGG
                                                      consensus depths      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     4     3     6     3     9     5    13     6    17    17    21    18    21    20    25    25    29    30    31    33    34    33    34    35    36    35    36    34    38    35    38    35    38    36    38    37    39    39    39    39    39    39    39    31    39    39    39    39    39    39    39    39    39    39    39    39    39    38    39    39    39    38    39    39    39    39    39    38    39    39    39    39    39    38    39    39    39    39    39    36    37    35    36    28    35    34    35    34    35    34    35    34    35    27    33    32    33    32    33    30    33    30    33    30    34    25    32    26    31    24    31    25    30    22    28    18    26    19    27    18    27    15    25    17    25    16    27    16    28    15    29    19    31    20    32    19    31    19    31    12    30    12    28    12    29    12    28    11    25    11    24    10    22    12    23    11    22    11    22    11    22    11    21    10    21    13    26    13    27    12    28    15    27    14    28    16    27    16    29    18    28    15    29    20    32    19    31    19    29    19    28    19    30    19    30    20    30    19    30    25    33    23    35    25    35    23    34    25    34    23    34    24    33    24    32    23    32    24    32    25    33    25    33    24    33    22    33    23    33    24    32    23    32    24    32    21    31    21    29    19    28    16    22    15    21    10    15    10    12    10    12     9    12     9    11     9    11     9    11     9    11     9    11     9    11     9    11     7    10     7    10     6     9     6     9     5     9     5     9     5     9     5     9     5     8     4     8     3     6
                                                                   VAR                                                                                                                                                 TGGGAGCTCTAG
                                                                   VAR                                                                                                                                                             GAGTAATAGGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTCTGCCTGTTACATATCAGACTTTCCTTCATTCCTATCTCCCCATCACCTAATTATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAATGTTCATGGCCTTTCTTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTCAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGATTGTTGGTTTATTTTATTTTTTTAAGGAGCAGTAAACTGTTTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTATTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTATGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATTCTTTTGCCTATATAGATTTAAATGAAG
                                                                   SNP                                                                                                                                                             AG----------
                                                                   SNP                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                             --------G---
                                                                   SNP                                                                                                                                                                                                                                     ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                     ----A-----A-
                                                                   SNP                                                                                                                                                                                                                                                                                                             -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                         -------C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                     -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                 -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------G--G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----G-----T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----C------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---A---G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------AT---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 T---T-------
                                               BLH ATG     227    1228 
                                               BLH MIN     227     143 
                                               BLH MPR     227     143 
                                               BLH OVR     227     744 
                                               CDS MIN     227       8 
                                               EST CLI     127       8 
                                               ORF LNG     227      24 
  5   1   2       bld DMZ  5g3  in                         xl305c20.5p AGAATGGAACACGTATCTAATACAACAGAGTTAACATCCGGCTTAGTCAAGAGCGTCGCTACCAGCACTAAAGCTGATCCCTAGCCGATAGAGAGTCTTTTCCGGAAACAATAGAGATGACAAGTCCTGGCAAGAACGCCTCTCTGGGAGCTCTAGTTAGAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATG
  5   1   2       bld DMZ  5g3  in                         xl307e20.5p AGAATGGAACACGTATCTAATACAACAGAGTTAACATCCGGCTTAGTCAAGAGCGTCGCTACCAGCACTAAAGCTGATCCCTAGCCGATAGAGAGTCTTTTCCGGAAACAATAGAGATGACAAGTCCTGGCAAGAACGCCTCTCTGGGAGCTCTAGTTAGAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGT
  5   1   2       bld Emb1 5x3                        IMAGE:5155893.5p                                                                                                           AACAATAGAGATGACAAGTCCTGGCAAGAACGCCTCTCTGGGAGCTCTAGTTAGAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAANAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAATGAACCCCCTTGGAAGTGGATTAAGACAAAAGCCAAAATGAAAAGTGGAAGGAAACTTCCTGGATGGTTGCTTGAAAGCCAAACAATTAATTATCACACCTAAAAAGGAAATTCCCTAAAAACCCCAGCCTTTCCATTGGAACCGGCTTACCAACCTTTA
  5   1   2       chi Eye1                            IMAGE:6959216.5p                                                                                                            GCTGGACCGGTCCGGATTCCCGGGATGCAAGAACGTCTCTCTGGGAGCTCTAGTAAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACGTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGTTTTTTCTTTCTTTGGAAAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAAAACTTCTGGATGTTGNCTGAAGCAAACAGAATTATCANTACTAGAGGAAATTCCTAAAACCCANGCTTCATGGGCACGTTACATCTTTTTTTATTCACTCCCTTTCTGGTCTGTTAATATAC
  5   1   2       bld Emb4 5g                IMAGE:5570510-IMAGp.IMAGp                                                                                                                   TGACAAGTCCTGGCAAGAACGCCTCTCTGGGAGCTCTAGTTAGAGTAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGGGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGCGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCACGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGATACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAACACTCAATAAATGAGCCCCTTGGAAGCGGATTA
  5   1   2       bld DMZ  5g3  in                         xl249m03.5p                                                                                                                    GACAAGTCCTGGCAAGAACGCCTCTCTGGGAGCTCTAGTTAGAGTAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAA
  5   1   2       bld DMZ  5g3  in                         xl262f20.5p                                                                                                                                GCAAGAACGTCTCTCTGGGAGCTCTAGTTAGAGTAAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCC
  5   1   2       bld Ga15 5g3  in                       XL405j24ex.5p                                                                                                                                 TCGTGGCAAGAACGTCTCTCTGGGAGCTCTAGTAAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCCTGTTTGATGTGAATAATGA
  5   1   2       bld Egg3 5x3                        IMAGE:6870273.5p                                                                                                                                    AACACAGAANGGNNNGAGAGTGGACGAATTCCCCCGGGGTTGAAAGAAAGCCCTCTCCCCGTATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAAGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACGGAATTATCATACTAAAAGGATTCCCTAAACCCAGCTTCATGCACGTTACATCTTTTTTATCACTCCCTTTCTGTCCGGTATATATCCCGACTTTCCCTTCCTTTCCTGGCCCCCCCATTCCATTACAAGGGAAATCTGGAATAATAATGGGTCCATGGGGCCTTTTCTTTTAAGGAATGATTTGGCCCTTTTTATAAGAGTTGGCCAATTTGGCCttttccttttttttAAATCCCCAATCCTGGGGGGATATTTAAAAGGGGGGAAAGAAAACCACGCCCCCCAAAATGGAAAAATTACCCCCCTTGGGGGCN
  5   1   2       bld Ov1  5x3                        IMAGE:6316510.5p                                                                                                                                      CGCCTCTCTGGGAGCTCTAGTTAGAGTAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGCGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCACGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGATACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAACAATTAATAAATGAGCCCCCTTGGAAGTGGATTAAGAACAAGCCAAAATGAAGGTGGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACTCCCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCTTTTCTAATCTCCCCATCACCTA
  5   1   2       bld Egg2 5g3  in                    IMAGE:5161997.5p                                                                                                                                        CCTCTCTGGGAGCTCTAGTTAGAGTAATAGGCAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGATCTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTCGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGCTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGATGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCCTCCCTCTTGGCTAGAAGATGCTCGGCAACATTCCAGGTCAAATATGGCCATAATACTGATTGGAAATAAAAGTGATCTTG
  5   1   2       bld Te2  5g                         IMAGE:7209215.5p                                                                                                                                        CAGAACGTCTCTCTGGGAGCTCTAGTAAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTNAAGACAAGCNAA
  5   1   2       bld Ga12 5g3  in                         XL176l17.5p                                                                                                                                            GCTGGGAGCTCTAGTTAGAGTAAGGGCAGNTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTNTGCATACCTCTTCAAGTNTATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAACTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGA
  5   1   2       bld Tbd2 5g                         IMAGE:3201281.5p                                                                                                                                                        TAGTTAGAGTAAGGGCAGTTGAAAGAAATCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGACTAGAAGATGCTCGGCAACATTCCAGTTCAGATATGGTCATAATACTGATTGGAATAAAAGCGATCTTGAGTCTCGTAGAGATGTATATAGAGAAGAGGGAGAAGCCTATGCTTCGGAACATGGTCTCATATGTATAGAAACCTCTAGTAAAACT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074320.5p                                                                                                                                                        TCGACCCACGCGTCCGAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTT
  5   1   2       bld Te2  5g3  in                    IMAGE:7207414.5p                                                                                                                                                           TTAGAGTAAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGAATCAATAAGTGTCCCCTTGGAAGTGGATTAGACAAACCAAATGAAGTGGAGAACTTCTGATGTGCTGAGCAACAGATTATCTATANAGATTCTAACCAGCTCAGCAGTACTCTTTACATCTTCTGTCGTAAATCGACTTCTCTTCGCTCATCATAAGAATCGATTAGTCG
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074321.5p                                                                                                                                                             CCACGCGTCCGAGTTGCAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTT
  5   1   2       bld Egg4 5g                         IMAGE:3743330.5p                                                                                                                                                                  AAGGGCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGC
  5   1   2       bld Oo1  5x3               IMAGE:3403620-IMAGp.IMAGp                                                                                                                                                                  CCAGGCTTGGGTACCGGGTCCCGGAAATTCCCGGGATCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACGTCATCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTCGCTGAAGCAAACAGAATTATCATACTAGAGGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTTATCACTCCTTTTCTGTCTGGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCCATCACATACAAGGGAAATCTGATAT
  5   1   2      seed Ga15 5g3  in                       XL520a11ex.5p                                                                                                                                                                      GCAGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATTAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAG
  5   1   2       chi Tad2      in                    IMAGE:6874880.5p                                                                                                                                                                        AGTTGAAAGAAAGCCACCTCCCCGTAATCACCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGttttttttAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAAGCCTTCCTTGACACTGCCCAAGAAATTCTACAAAAGAATCCACCAGGGGCCTGTTTCGACGTGAAATAATGCACGCCTTAACGGGCATCACAAGGCTGGTACCCCCACGCAAATCCAATTAGAGGTGGATCCCCCCTTTGGGAAGCCGCGGTTTAAATGAACCAAACCCCCAACAATTGCAAAGGTGGGCACCGCACACCTTCTNGGGAAATGCGCCGGCCCTGGAAAGCCAAACCCCGGAAATGTAATCCAGTTACCTTGAGACCGCGGAATTTCTCTTTTAAAACACCGTGGTATCTTTTCCCCCTGCN
  5   1   2       bld Ga12 5g3  in                         XL142l02.5p                                                                                                                                                                                         GCTCCCCGTAATNCCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATA
  5   1   2       bld Brn3 5x3                        IMAGE:8537727.5p                                                                                                                                                                                            CCCGTAATCACCTGCCTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCCCTTGGAAGTGGATTAGACAAAGCCAAATGAAGGTGAGGAACTCTGGATGTGCTGAAGCAACATATATCACCTAGAGAATCCTAACCAGCTCATGACCTACTCTTTATCCACTCTTCGCTGTACTACAACTTCTCATCTACTCCATCCTATATAGGTATCGATATGTCTGGCTCTTGTGT
  5   1   2       bld Ga12 5g                              XL143e07.5p                                                                                                                                                                                             CCCGTAATNCCTGCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATAATACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAG
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3201288.5p                                                                                                                                                                                              CGTGATGACCTGGCTTGGGGGCTCTGACTATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGAT
  5   1   2       bld DMZ  5g3  in                         xl325j21.5p                                                                                                                                                                                                         GCCTTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCNA
  5   1   2       bld Ga15 5g3  in                       XL458m10ex.5p                                                                                                                                                                                                           CTTGGTGGCTGTGACGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTANAGGGAATTCCTAAACCCAGCTTCATGCACG
  5   1   2       bld Emb1 5x3                        IMAGE:6864800.5p                                                                                                                                                                                                            TTGGTGGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCCACTCCTTTCTGTCTGTTAATATATCCCGACTTTCCCTTCCTTTCCTGGCCTCCCCCATTCACATAACAAGGGGAAATCCGGTATAATTAAATGGTTCAAGGGCGCCTTTTCCTTTTATGGGAAGGGTTTTGCCCCCTTTTTTAAAGA
  5   1   2       bld Lu1  5g                         IMAGE:4057176.5p                                                                                                                                                                                                             CACGCGTCCGGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTANAACGTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGNNCAAGAATTTACAAAAGATCCAGCAGGGCTGGTTGATGTGAATAATGAAGCTACGGNATCAAAGTTGACCCCC
  5   1   2       bld Tbd2 5g3  in                    IMAGE:3200066.5p                                                                                                                                                                                                                 GGCTCTGACGATTGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCA
  5   1   2       bld Ga15 5g3  in                       XL506n11ex.5p                                                                                                                                                                                                                         CGATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGCGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCACGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGATACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAACAATCAATAAATGAGCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTANAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACTCCTCTTTCTGCCTGTTACATATCANACTTTCCTTCTTTCCTATCTCCCCCATCACCTAATTATAAGGGAATCTGTATATA
  5   1   2       bld Eye1 5x3                        IMAGE:6959021.5p                                                                                                                                                                                                                           ATTGCCATCATGTCGTATGCCTACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGAAAGTCATGTCTGCTTCTTCAGTTTACTGATAAGAGGTTCCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAACATTGATGGGAAACCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGCGCTGCTGGGGCCCTGCTAGTGTATGATATAACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCACGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGTGATCTTGAGTCTCGTAGAGATGTTTCTAGGGAGGAGGGGGAAGCTTTTGCTCGGGAACATGGTCTCATTTTTATGGAGACCTCTGCCAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGATACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAACAATCAATAAATGAGCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACTCCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCTTTCCTATCTCCCCATCACCTAATTATAAGGGGAATCTGTATATAATGTTCATGGGCCTTTCTTTGTTTTgtttgtctgtcttttaagttttacaatagttcttttgcccttttcttttttttAATTCCCATTCTTTTAAATGGTAATGCCATTAAGGAAATTTACACAT
  5   1   2       bld Oo1  5g3  in                    IMAGE:3403620.5p                                                                                                                                                                                                                             TGCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACGTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAATAAAATTACCAATAGATCCATCATGTGCTGTTTGATGCGAATAATGACGCTAACGGGGATCAAGTCGGACCCCAG
  5   1   2       bld Egg1 5g                            PBX0014D08.5p                                                                                                                                                                                                                              GCCATCATGTCGTATGCATACCTCTTCAAGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTC
  5   1   2       bld Egg5      in                    IMAGE:3431144.5p                                                                                                                                                                                                                                                          AGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAA
  5   1   2       bld Oo1                             IMAGE:6857805.5p                                                                                                                                                                                                                                                          AGTATATTATTATTGGTGACACAGGTGTGGGGAAATCTTGTCTGCTTCTTCAGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAGGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACGTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCACGGGCTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCCAAATGAAAGTGGAGGAAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCCTACTAGAGGGATTCCCTATACCCAGGCTTCATGGCACGGTCCTTCTTTTTTATCACTCCTTTTCTGGCCGTTCATATATCCCGACCTTTCCTTTCTTTTCCGGGCCTTCCCCATCTACATCCCAAGGGGAACCCCGGATCACAAAGGGTCCCCGGGCCCCTTCCTTTTAAGGAACGGCCTTGCCCCCTTTTTTCCATTTCGCCAACTTTGCCGCTTCGCCTTCCTTTTTGATCCCCGACCCCCGGGGTCCTTCTCCCGAGTGGTAAAACAAAAA
  5   1   2       bld Ga12      in                         XL166g08.5p                                                                                                                                                                                                                                                                                 GGGTGTGGGGAAATCTTGTCTGCTTCTTCGTTTACAGATAAGAGGTTTCAGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATCGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATTAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTG
  5   1   2       bld Ga15      in                       XL505i13ex.5p                                                                                                                                                                                                                                                                                     GGGGAANTCTNGTCTGCTTCTTCNTTTTACAGATAANAGGTTTCAGCCAGCTTCATGACTTAACNATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCC
  5   1   2       bld Tail                            IMAGE:8545901.5p                                                                                                                                                                                                                                                                                                                              GTTTCGCCAGTTCATGACTTAACAATTGGAGTTGAGTTTGGTGCACGCATGATAAATATTGATGGGAAGCCTATCAAACTACAGATATGGGACACGGCTGGACAAGAGTCATTTCGTTCAATTACAAGATCTTATTACCGAGGTGCTGCTGGGGCCCTGCTAGTGTATGATATTACAAGACGGGAAACCTTTAGCCACCTCACATCCTGGCTAGAAGATGCTCGGCAACATTCCAGTTCAAATATGGTCATAATACTGATTGGAAATAAAAGCGATCTTGAGTCTCGTAGAGATGTTTCTAGAGAAGAGGGAGAAGCCTTTGCTCGGGAACATGGTCTCATATTTATGGAGACCTCTGCTAAAACTTCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTCATGGCCTTTCTTATGTATGTTTGCCTTTTAAGTTGTCATTTGCCTTCTTTTTTATCCATCTGTGTATTAAGTGTAGAAACGCCAATGAATACCTGTGCCTGTTGACTACTATATGACCC
  3   1   2       bld Tad2      in                    IMAGE:6874880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACTTCTGGTAAAAACTTCAGCTAATGGGGAAGGAGCCTTTCATTGACCCTGCCAAAGAAATTTACAAAAAGATCCCAGCAGGGGCTGTTTGATGTGAATAAAGAGGCTAACGGGATCAAAGGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGAAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTAAATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATGTAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACACCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCATTCCTATCTCCCCATCACCTAATTATAAGGGTATCTGTATATAATGTTCATGGCCTTTCTTTGTTTGTTTGTTTGTCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTCAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTTTAAAAGAAAAAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074320.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAACTGCAGCTAATGTGGAAGAGGCCTTCATTGACACTGCCAAAGAAATTTACAAAAAGATCCAGCAGGGACTGTTTGATGTGAATAATGAGGCTAATGGGATCAAAGTTGGACCCCAGCAATCAATAAATGAGCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCCCACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACACCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCATTCCTATCTCCCCATCACCTAATTATAAGGGTATCTGTATATAATGTTCATGGCCTTTCTTTGTTTGTTTGTTTGTCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTCAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTTTAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAGAGCGGCCGCTCTAGA
  5   1   2       bld Ga15      in                       XL410p06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAAAGATCCAGCAGGGGCTGTTTGATGTGAATAATGAGGCTAACGGGATCAAAGTTGGACCCCAGCAATCAATAAGTGATCCCCTTGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGgcctttctttatgtatgtttgcctttttaagtttgtcatttgcctttctttttttATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCAtttttttttttAAGGANAAGTAAACNGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCNCTTATTTTAAAAATGTTATAAATTCTGCATGTANCAANGTTCCTTTTTCCTAATANGGATACAATTANTTTGTATCCTTGGAAGTGACAGGGGACCNCNGCAATGCCCTAAAAATGTA
  3   1   2       add Te2  5g3  in                    IMAGE:7207414.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTGGAATATGGGGTAAAGGGGTCAAAGTTGGCCCCCGCAATCAATAGGGATCCCCTTGAAAGGGATTAAGACAAGCCCAAATGAAGGTGAGGGACTTTTGGATGTGTTGAAGCAACCAGAATTATCATACTAGAGGATTCCCTAAANCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTCAGGAGAAGTCAACAGTTTATTTTATTGTGACTGGACCAAAGGGGCATATCGCTGTCCCAGCAATGAAAATTGTTACATTTTATCTCATTTCAAAAATGTTCAAAATTCTGCATGCCGCAACCTTCCTTTTTCATAATATGGATACAATTAGTTTGTATCCTAGGAGTGACAGGGGCCCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCAGTATACGACATATATGCCCCTGTGTCCAGTAACAGTAAAATTAATCA
  3   1   2       bld DMZ  5g3  in                         xl305c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCCTGGGAAGTGGATTAAGACAAAGCCAAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAATATTATCACACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACACCTCTTTCTTCCTGTTACATATCAGACTTTCCTTCATTCCTATCTCCCCATCACCTAATTATAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTGTTTGTTTGTTTGTCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTCAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTTTATTTTATTTTTTTAAGGAGCAGTAAACTGTTTATTTTTTTGTTACTGGACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTATTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTATGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATTCTTTTGCCTATATAGATTTAAATGAAGG
  3   1   2       bld Ga15 5g3  in                       XL520a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAAGTGGNTTAAGACAAAGCCAAAATGGAGGGGGNGGAACTTCTGGATGTTGNTGAAGCNAACAGAATTATCATACTNGNGGAATTCCTAAACCCAGCTTCATGCNCGTTACATCTTTTTATCACTCCTTTCNGTCTGTTATATATCCGNCTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCANGGCCTTTCTTTATGTAnGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGGGTATTTAAAGNGTAAGAAACAGCNCAAATGAAATACCCTTGNGCNCTGATATGACGTACATTAATATGGNCNCTACATTTTAAACATGAGTTTGAAGAGCAAACCCNCATCTCGATGNGGGTCATTATCATTTGTTNCAGTTAGGAGTTGAGTAGATGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGACCAAAT
  5   1   2       bld Egg1                               PBX0107E10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGGATAAGACAAACCAAATGAAGGTGGAGGAACTTCTGGATGTTGCTGAAGCAAACAGAATTATTATACTATAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGgcctttctttatgtatgtttgcctttttaagtttgtcatttgcctttctttttttATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGAGGTTGTTGGTTTAATTAATGttttcatttttttAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGGCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAAT
  5   1   2       bld Ga18      in                      xlk142m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTCTGGATGTTGCTGANGNNACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGgcctttctttatgtatgtttgcctttttaagtttgtcatttgcctttctttttttATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCAtttttttttttAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGNTTGTATCCTTGGAGTGACAGGGGANCACAGCAATGNCTAGAAATGTAGTGCATTNNCATATCATTTCCCATTCAGCTGTATAAGTNATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGNATCTCCNAGCAAGNATTNNATCTGTCCAATAAATACCGGNGCTACCTTGTATNATTTNNT
  3   1   2       bld Ga12      in                         XL166g08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGATNTTGNTGAAGCAAACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTNTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCNCAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATNTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAAT
  5   1   2       bld Egg1      in                    IMAGE:4783221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACGAGGACAGAATTATCATACTAGAGGAATTCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTtctttatgtatgtttgcctttttaagtttgtcatttgcctttctttttttATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTATACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGAGG
  5   1   2       bld Egg1                               PBX0050A12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAACAATATTATCACACTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACTCCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCTTTCCTATCTCCCCATCACCTAATTATAAGGGAATCTGTATATAAtgttcatggcctttctttgtttgtttgtctgtcttttaagttttacatagttcttttgcctttctttttttATTCCAATCTTTAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGTAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGgtttattttatttttttaaggagcagtaaactgtttatttttttGTTACTGTACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTGGTTGGCATAAACTCT
  3   1   2       bld DMZ  5g3  in                         xl307e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCTAGAGGAATTCCTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACACCTCTTTCTTCCTGTTACATATCAGACTTTCCTTCATTCCTATCTCCCCATCACCTAATTATAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTGTTTGTTTGTTTGTCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTCAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTTTATTTTATTTTTTTAAGGAGCAGTAAACTGTTTATTTTTTTGTTACTGGACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTATTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTATGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATTCTTTTGCCTATATAGATTTAAATGAAGGAT
  3   1   2       add Egg2 5g3  in                    IMAGE:5161997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAATTCTTAAACCCAGCTTCATGCACGCTACATCTTTTTATCACACCTCTTTCTGCCTGTTACATATCAGACTTTCCTTCTTTCCTATCTCCCCATCACCTAATTATAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTGTTTGTTTGTTTGTTTGTCTGTCTTTTAAGTTTTACATAGTTCTTTTGCCTTTCTTTTTTATTCCAATCTTTAAATGTAATGCATAAGAAATTACACAAATGGAATATCCTTGTGCAATGATAAGAAGTACATTAATATGGACACTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTTTATTTTATTTTTTTTTTTTTTATATATTCTTTATTTTTCGTTTTTTTAAAAAACAAAATCCACATAATAAAC
  3   1   2       bld DMZ  5g3  in                         xl262f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCTAAACCCAGCTTCATGCACGTTACATCTTTTTATCACTCCTTTCTGTCTGTTATATATCCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTTCATGGCCTTTCTTTATGTATGTTTGCCTTTTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGGGTATTTAAAGNGTAAGAAACAGCNCAAATGAAATACCCTTGNGCACTGATATGACGTACATTAATATGGACNCTACATTTTAAACATGAGTTTGAAGAGCAAACCCNCATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTGGCCTAAACTATATNGATCAAAT
  5   1   2       bld Lu1                             IMAGE:4633624.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGACTTTCCTTCTTTCCTGTCTCCCCATCACATACAAGGGAATCTGTATATAATGTCATGGCCtttctttatgtatgtttgcctttttaagtttgtcatttgcctttctttttttATTCCAATGGTTTGATGGAAAGCGTAAGAAACAGCCCAAATGAAATACCCTTGTGCACTGATATGACGCCCCTTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTAC
  3   1   2       bld Egg5      in                    IMAGE:3431144.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCCTTTCTTTATGTATGTTTGCCTTCTTAAGTTTGTCATTTGCCTTTCTTTTTTTATTCCAATCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAAA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3200066.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTGTGTATTTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATAAAATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAA
  3   1   2       bld Ooc2                            IMAGE:3745466.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAAAGTGTAAGAAACAGCNCAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Ga15      in                       XL518m08ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAAGTGTAAGAAACAGCACAAATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGttttcatttttttttttAAGGANAAGTAAACTGTTTATTTTACTGTTACNGGACAAAAGGGGCATATTGTTGNCCTTTAAATGAAAATTGTTACATTTTCNCTTATTTTAAAAATGTTATAAATTCTGCATGTANCAANGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGNGACAGGGGACCNCAGCAATGCCTANAAATGTAGNGCATTGCCATATCATTTCCCATTCAGCTGTATAAGNGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCNCCCANCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL518m08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAAAGNGTAAGAAACAGCNCAAATGAAATACCCTTGTGCNCTGATATGACGTACATTAATATGGACNCTACATTTTAAACATGAGTTTGAAGAGCAAACCCNCATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCT
  3   1   2       bld Ga15 5g3  in                       XL458m10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCCAATCTTCAAANGTAANGCATAAGAAATTACNCAAATGGGAATATCCTTGNGCAANGATAAGAAGTACATTAATATGGACANTACATTTCAAACGAGTTTGAAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTNTATTTTATTTTTTTAAGGAGCAGTAAACTGTTTATTTTTTTGTTACTGGACTTAATGGGCATAATGTNGTCCTTTTAATGAAAATNGTTACATTTTCTCTTATTTTATTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTATGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATCCTTTNGCCTATATAGATTTAAATGAAGGATCTCCCAGCAAGCAT
  3   1   2       bld Ga15      in                       XL505i13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAAGAAACNGCCCAAATGAAATNCCCTTGNGCACNGATATGNCGNACATTAATANGGNCNCTACATTTTAAACATGNGTTTGAAGNGCAAACCCNCATNTNGATGNGGGTCATTATCATTTGTTNCAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGT
  3   1   2       bld Egg5                            IMAGE:3431408.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATGAAATACCCTTGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCATAATAAAGTATCTCCCAGCAAAA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3201288.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTGCACTGATATGACGTACATTAATATGGACACTACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAAT
  3   1   2       bld Ga15 5g3  in                       XL506n11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TNGTGCAATGATAAGAAGTACATAATATGGACACTACATTTCAAACGAGTTTGTAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTTTATTTTATTTTTTTAAGGAGCAGTAAACTGTTTATTTTTTTGTTACTGGACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTGTTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTAGTTTTGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATCCTTTTGCCTATATAGATTTAAATGAAGGATCTCCCAGCAAGCATTGCATCTCACCAATAAATACTGATCACCTTCCAAGCTACCTTGTATTATTTATTGATTTGTTGTATTTAGCAACAAAAACATGTGGATTTTCTTCAGAGTAGGTAAACATTTGGTATTTAGGACCTATTTAATACCTCTCTGCTTGAGAAAATCATTTTAGGTCAAGTTTTTTTAAGTTAAAGAGAAAACACCAGAAAATAATCTTTTTTTATATACATCATAACATTATCATTGTATACTATTTATTACCATAAAAGTATTTGCCTGATGCTTTTACAATATCTTTCTTACCCCCATGTTGCTCTATGAGGAGGCTGCCATATTTGTGCAGCAGTAGTCAATTAATAAAGGATTATGAAGTACAGTATATG
  3   1   2       bld Egg4                            IMAGE:3743234.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATTTTAAACATGAGTTTGAAGAGCAAACCCACATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAAAAAAAAAAAAAAAAAA
  3   1   2       bld DMZ  5g3  in                         xl325j21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNCATTTTAAACNTGAGTTTGAAGAGCAAACCCNCATCTCGATGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATNTTAGGTCAAGTTTTTTACGNTAAAGTCNGGTGTATGTGAAACTTNGNTCATTACNTCCTCTGCAAAGAGAAGGAT
  3   1   2       bld DMZ  5g3  in                         xl249m03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGNAACCCAAATAAAAATGCGGGTGACTCTATATCATGTGTTACAGTTAGGTGTTGAGTAGAGATTGTTGGTTTATTTTATTTTTTTTAAGGAGCAGTAAACTGTTTATTTTTTTGTTACTGGACTTAATGGGCATAATGTTGTCCTTTTAATGAAAATTGTTACATTTTCTCTTATTTTATTTGTCATAAACTCTGTATGTAGTAACATTCCCTTTTCCTAATGCGGGTACAAATCGTTTGTATGCTTTGAGTGCCAGGAGAAATCAGCAATGCCTGGAAATGTAGTGCATTGCCAAATCATTTCCAATTCAGCTGTATAAGTAATCTTATTCTTTTGCCTATATAGATTTAAATGAAGGATCTCCCAGCAAGCATTGCATCTCACCAATAAATACTGATCACCTTCCAAGCTACCTTGTATTATTTATTGATTTGTTGTATTTAGCAACAAAAACATGTGGATTTTCTTCAGAGTAGGTAAACATTTGGTATTTAGCACCTATTTAATACCTCTCTGCTTGAGAAAATCATTTTAGGTCAAGTTTTTTTAAGTTAAAGAGAAAACACCAGAAAATAATCTTTTTTATATCCATCATAACATTATCATTGTATACTATTTATTACCATAAAAGTATTTGCCTGATGCTTTTACAATACCTTTCTTACCCCCATGTTGCTCTATGAGGAGGCTGCCATATTTGTGCAGCAGTAGTCAGTTAATAAAGGATTATGAAGTACCAGTATA
  3   1   2       bld Ga12 5g3  in                         XL142l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGCGGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAATTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACTGTCCGGTTTCCGCCTG
  3   1   2       bld Ga15      in                       XL410p06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGNTGGTTCAATTAANGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGATCAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAA
  3   1   2       bld Ga15 5g3  in                       XL405j24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGTCATTATCATTTGTTACAGTTAGGAGTTGAGTAGATGAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACCAGTATATTGGAAGTTG
  3   1   2       bld Ga12 5g3  in                         XL176l17.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAGTTGAATTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAANAATGTTATAAATTNTGCATGTAGCAATGTTCCTTTTTCNTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTNAACTATATAGATTCAAATANAGTATCTCCCAGCNAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACNAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACTTATTTNA
  3   1   2       bld Neu7                                 XL042k21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGTTGAGTTGTTGGTTCAATTAATGTTTTCATTTTTTTTTTAAGGAGAAGTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTAAATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAA
  3   1   2       bld Ga18      in                      xlk142m12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTAANNNNNNTATTTTACTGTTNCTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACTNNC
  3   1   2       bld Egg6                            IMAGE:4435283.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTAAACTGTTTATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACTGTCTGG
  5   1   2       bld Ga15      in                       XL441g24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CGCTCCGATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL441g24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTTTACTGTTACTGGACAAAAGGGGCATATTGTTGTCCTTTAAATGAAAATTGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTGGCC
  3   1   2       bld Egg1      in                    IMAGE:4783221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTACTGTTACTGGACAAAAGGGGCATATTGTGGTCCTTTAAATGAAAATGGTTACATTTTCTCTTATTTTAAAAATGTTATAAATTCTGCATGTAGCAATGTTCCTTTTTCCTAATATGGGTACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTGAACTATATAGATTTAAATAAAGTATCTCCCAGCAAAAAAAAAAA
  3   1   2       bld Oo1  5g3  in                    IMAGE:3403620.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAATATGGATACAATTAGTTTGTATCCTTGGAGTGACAGGGGACCACAGCAATGCCTAGAAATGTAGTGCATTGCCATATCATTTCCCATTCAGCTGTATAAGTGATCTTATCCTTTGGCCTAAACTATATAGATTCAAATAAAGTATCTCCCAGCAAGCATTGCATCTGTCCAATAAATACCGGAGCTACCTTGTATTATTTATTGATCTGCTGTATTGAGCAACAAAAACATGGATTTTCTTCAGAGTAAGTAGGTAAACATTTGGTTGTGTTTGGAACCTATTTAATACCTGTCTGCTTAAGAAAATAATTTTAGGTCAAGTTTTTTACGTTAAAGTTGGTTAGTGAAATTAGTTCATTACTTCCTCTGCAAAGAAAGGATTATAAATGACAGTATATTGGAAGTTGTGTATTAACTGTCTGGTTTCCGCCTGCCATGTTAATAAAGTTTTCCTGACTAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)