Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6639059.5.5                    21 PI      94       1016     1150                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:7298494.5                      16 PI      91       1017     1150                (no blast hit)
     3   0.0    0Xl3.1-XL209d12.3                           16 PI      90       1016     1145                (no blast hit)
     4   0.0    0Xl3.1-xlk106k09ex.3                        11 PI      91       1017     1150                (no blast hit)
     5   0.0    0Xl3.1-xl303f05.3                            6 PI      91       1015     1148                (no blast hit)
     6   0.0    0Xl3.1-XL436e18ex.3                          5 PI      92       1017     1158                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6950366.5                       4 PI      89       1016     1150                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:6950311.3                       3 PI      92       1018     1150                (no blast hit)
     9   0.0    0Xl3.1-XL424i09ex.5                          3 PI      92       1020     1144                (no blast hit)
    10   0.0    0Xl3.1-XL053i07.5                            3 PI      91       1017     1150                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:4740541.3                       2 PI      92       1019     1150                (no blast hit)
    12   0.0    0Xl3.1-IMAGE:6954069.5                       2 PI      91       1018     1150                (no blast hit)
    13   0.0    0Xl3.1-XL457m24ex.5                          2 PI      88       1014     1158                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012768916 Xl3.1-IMAGE:7202438.5 - 43 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                2     2     4     4     4     4     9    11    10    13    14    15    15    16    15    18    17    19    17    20    18    20    18    20    19    21    19    21    21    21    21    21    21    21    21    21    22    22    22    22    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    24    25    25    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    23    25    22    25    23    26    23    26    22    25    21    24    21    24    20    25    20    25    20    26    19    24    19    24    18    23    18    23    17    23    15    21    16    23    15    22    12    20    10    18     9    16     8    15     9    15     8    15     9    15     8    15     8    15     9    14    10    14     8    14     7    15     8    15     6    14     9    15     9    13    10    13     9    13     9    12     9    12     9    12     9    11    10    11    10    11    10    12     8    12    10    12    11    13    12    13    13    14    12    14    11    13    12    13    12    13    13    14    13    14    13    14    13    14    14    14    14    14    16    16    16    16    16    16    15    15    14    14    14    14    14    14    14    14    14    14    13    14    15    15    15    15    15    15    15    15    15    15    13    15    14    15    14    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14     9    14    10    14     7    14     7    14     7    14     7    14     7    14     6    14     6    14     6    14     6    14     6    12     3     9     2     6     2     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATT
                                                                   SNP                                               ----G-------
                                                                   SNP                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------A--
                                               BLH ATG     158     845           
                                               BLH MIN     158     122           
                                               BLH OVR     158     807           
                                               EST CLI      18       7           
                                               ORF LNG     158      43           
  5   1   2       bld Ga12      in                         XL166e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTCTACTACCGNATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAGAAATGCCGGCCTTCCTATGTGTTTGTCTTTTTTCCTTAATGATGGCATTGGGATCAACCATCATTTTTACCGGCCA
  3   1   2       bld Tbd7 5g3  in                         XL087o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACGTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGTGAAATGTCAACATCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCGCTTTCCAGGTAAANAACACTGTAGGTTAATAATTAAAA
  3  -1   2       bld Ga11                            IMAGE:3475142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGAGCTCAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCGGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTG
  3   1   2       bld Thy                             IMAGE:8550957.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGAGAGAGTAGATGTGCAGTCTTGATATCATTCGTTTCCTTCCTACATCTACAGCTGGAGGATTATTGATACATTGCCCACCCAGCATCAGTTCAAGAAAGTGGCCACCATGATTCAGGATTCATAGCGTATCTCCACACCAGCATTCTCATGTGTAGCTAGGTTGCCACCTTTCTGGAAAAAATACCAGCCTTCCTATATATTTTCTNTTTTCNTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCTTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTATTTATCACTTAAAGGGACCAGGAATAATCTGTT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTACCATCNTACAGCNNTGAGAAGGATTANTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACAATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAACTAGGATTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTAAAGGTGACAGGAAATAACTAATAA
  3   1   2       bld DMZ       in                         xl253g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCACATNGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCGGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTATTTATCATNNA
  3   1   2       bld Ga12 5g3  in                         XL195j24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAGTATCAAGGAAACAATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAACTAGGATTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCNTTAATAATAACATTGGGATCAACCATCATTTTTGCCGGCCAGGCCGGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTAAAGGTG
  3   1   2       bld Egg1 5g3  in                    IMAGE:3301393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCACCTTTTCTGGAAAAAAATACAGCCNTTCCTATATATTATCTTTCCCTTAATAATACCATGGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAACAGAGAGAGTTTGTTGCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATAAA
  3   1   2       bld Ga12      in                         XL166e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTTGTCTTTTTTCCTTAATGATGGCATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAGTACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGTCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGT
  3   1   2       bld Neu7      in                         XL003h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATATTTCCAGTGTGCAATGTTACTAAATATACAAGAGGAAGCAACACTTTGCCTCAGGCAACTGTTAGTAAACAAAACTTTTTAAA
  3   1   2       bld Neu7 5g3  in                         XL040o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTNATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGG
  3   1   2       bld Egg1                            IMAGE:3301973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATAAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4203324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATAGCACGTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGAGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGAAAAAAAAAGTGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATAAAAAAAAAAAAAAA
  3   1   2       bld Ov1       in                    IMAGE:5048567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGAGGTTTAATTAATTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGAAAAAAAAAGTGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATA

In case of problems mail me! (