Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6639059.5.5                    21 PI      94       1016     1150                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:7298494.5                      16 PI      91       1017     1150                (no blast hit)
     3   0.0    0Xl3.1-XL209d12.3                           16 PI      90       1016     1145                (no blast hit)
     4   0.0    0Xl3.1-xlk106k09ex.3                        11 PI      91       1017     1150                (no blast hit)
     5   0.0    0Xl3.1-xl303f05.3                            6 PI      91       1015     1148                (no blast hit)
     6   0.0    0Xl3.1-XL436e18ex.3                          5 PI      92       1017     1158                (no blast hit)
     7   0.0    0Xl3.1-IMAGE:6950366.5                       4 PI      89       1016     1150                (no blast hit)
     8   0.0    0Xl3.1-IMAGE:6950311.3                       3 PI      92       1018     1150                (no blast hit)
     9   0.0    0Xl3.1-XL424i09ex.5                          3 PI      92       1020     1144                (no blast hit)
    10   0.0    0Xl3.1-XL053i07.5                            3 PI      91       1017     1150                (no blast hit)
    11   0.0    0Xl3.1-IMAGE:4740541.3                       2 PI      92       1019     1150                (no blast hit)
    12   0.0    0Xl3.1-IMAGE:6954069.5                       2 PI      91       1018     1150                (no blast hit)
    13   0.0    0Xl3.1-XL457m24ex.5                          2 PI      88       1014     1158                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012768916 Xl3.1-IMAGE:7202438.5 - 43 ESTs
                                                                       -10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:7202438.5           GATTTGTGACGCCAGGATTAGGTGGGCGGCCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGGTGTACAGTGTAAATAAATACCT
                                                  Xl3.1-CHK-1012687027                 TGACGCCAGGATTAGGTGGGCGGCCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTxAAxGGTGTACAGTGTAAATAAATACCTTGTACT
                                                      consensus depths                2     2     4     4     4     4     9    11    10    13    14    15    15    16    15    18    17    19    17    20    18    20    18    20    19    21    19    21    21    21    21    21    21    21    21    21    22    22    22    22    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    24    24    24    24    24    24    24    24    24    25    25    25    24    25    24    25    24    25    24    25    24    25    24    25    24    25    23    25    22    25    23    26    23    26    22    25    21    24    21    24    20    25    20    25    20    26    19    24    19    24    18    23    18    23    17    23    15    21    16    23    15    22    12    20    10    18     9    16     8    15     9    15     8    15     9    15     8    15     8    15     9    14    10    14     8    14     7    15     8    15     6    14     9    15     9    13    10    13     9    13     9    12     9    12     9    12     9    11    10    11    10    11    10    12     8    12    10    12    11    13    12    13    13    14    12    14    11    13    12    13    12    13    13    14    13    14    13    14    13    14    14    14    14    14    16    16    16    16    16    16    15    15    14    14    14    14    14    14    14    14    14    14    13    14    15    15    15    15    15    15    15    15    15    15    13    15    14    15    14    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14     9    14    10    14     7    14     7    14     7    14     7    14     7    14     6    14     6    14     6    14     6    14     6    12     3     9     2     6     2     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATT
                                                                   SNP                                               ----G-------
                                                                   SNP                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                           -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ----G-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---------A--
                                               BLH ATG     158     845           
                                               BLH MIN     158     122           
                                               BLH OVR     158     807           
                                               EST CLI      18       7           
                                               ORF LNG     158      43           
  5   1   2       chi Te1                             IMAGE:6930879.5p GGGGAGATGAGATTTGTGACGCCAGGATTAGGTGGGCGGCCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCCGGGAACACCAAGGTACAAAACCTTCCCCGGGCCTGGCTGAAAAGAAAAGGTTTCCTACCTTAAAGGGAAAAGGGGCAGGGAGGGCCACCATTATTTTCCAAAACTGGaaaaaaaaTCCCCAATTCCAAGGGCCACCCGGGGAAATTCCTGGGTTATTCCCCACCCAATTCGGTTCCCCCATTTCCCCGAAGT
  5   1   2       bld Oo1  5g                IMAGE:6640992-IMAGp.IMAGp           GATTTGTGACGCCAGGATTAGGTGGGCGGCCGGAGTGAAGGAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGAGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGTGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTAC
  5   1   2       bld Oo1  5g                         IMAGE:6640992.5p            ATTTGTGACGCCAGGATTAGGTGGGCGGCCGGAGTGAAGGAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGAGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGTGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAGGACGGGTTTGATCCCCTCACATACATTATAGGGCCCAGATGAAGATCTCCCCCAGGAAGATGGAGTGCTTTAGAATTTGTGTGCCACGCTCCCTCTGAATACNNTCAGTCTCGCTCTTCCCCTTTTCCNTANNCATNCTACCAGGCCTGANAAAAGGGATT
  5   1   2       bld Ga12 5g3  in                         XL195j24.5p             GGCACGAGGCCAGGATTAGGTGGGCGGCCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGA
  5   1   2       bld Tad1 5g                         IMAGE:6938840.5p                                      GGGCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGGATCAGTACTGTGGAGAAAGAGTGCCCGCCCCTCACCTGGGCTCATTTCCCTACAACTGGTCCCAGTCCCAAAAAGAAC
  5   1   2       chi Te2                             IMAGE:7392423.5p                                        CCGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATCAAACTGAAAAAATCAATCAAGGCACCGGAATCTGTATCCACATCGTCACATCAGAGTCATCTTCATAAGGCCTCTACTACAGATTGAGATGTGGTTCTGTGTGACGAGAAGATGTAAACTACTATGCCAGTGAGAGTTCTACAGATCATATGGAGAGATGCGCCTCACTGCTCATCTACATGTCAGTCAAGACGTTGATCTCACATCTATAGCAATAGATCCCAGAGTGATGTAGATGTGGCACTC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202438.5p                                         CGGAGTGAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATANGGCCAGATGAAGATCTCCCAAGGAAGATGGAGTGCTTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCCAGGTCTCGCTCCTCCCCTTTCCCCTACCATTCCTACCCAGGCCCGGAAGAAAGGGGATTTATTTTGGAACCCCCCT
  5   1   2       chi Tbd7      out                        XL093l14.5p                                           ATATTTAGGTGTGCACCTTTCTAAAATCCTGTCCTGTTTTATTAAGTTTTACTGAGATATTACTGGCCTTTGTCATGTTGTTTGCTTTTCTAAGCACAGGAGTGTTGGTGTCTGTCCTTCTCTGTTATGATACAGATGCCGCTGGGACTAAAGCCAACATGCAGAATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGT
  5   1   2       bld Tbd7 5g3  in                         XL087o15.5p                                           GCAGGCAATTCGGCACGAGGNATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGAGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGTGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCAACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGA
  5   1   2      seed Lmb1 5g3  in                    IMAGE:8531820.5p                                           GAGTGAAGGAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTG
  5   1   2       chi Emb4                            IMAGE:4681316.5p                                               GAAGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACACGATCAGTACTGTGAGAAGAGTGCCGCCCTCCCCTGGCTCATTCCTACATTGTCCACGCCAAAAGAGGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAACCACTCCCCCGGAACAAGGACGGGTTAAAATTTGGGGGGCCACGCTTCCCTCTGAAAACCTTCAGGTCTCGGTTCCTTCCCTTTTCCCTTACCGTTCCTACCAGAGCCCTGGGAAAAGGGATTTTATTTTGGAACCCCACACTTGGGGGccccccccccAGGCCGCACGGTATCCCAGGGAAACCCGAAGGGGCCCACC
  5   1   2       bld Te2  5g                         IMAGE:7209209.5p                                                   CAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAGACGGGTTTGATCCNTCACATACATTATAG
  5   1   2       bld Egg1 5g                            PBX0125H11.5p                                                           CACGAGGCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTTAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGT
  5   1   2       bld Em10 5g                         IMAGE:8321477.5p                                                                ATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCCGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTA
  5   1   2       bld Oo1  5g                         IMAGE:5079084.5p                                                                       TTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCCTCACATACATTATAGGGCCAGATGAAGATCTCCCCAGNAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTTCCCTACCATTCCTAACAGGCCTGAGGAGGGGATTTATTTGGGACTCACCTTGGGCCCCCAACCCCACCCATTCAGA
  5   1   2       bld Te2  5g                         IMAGE:7392119.5p                                                                             GATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTTGTCAGTCCAAAAGACGGGTT
  5   1   2       chi Kid                             IMAGE:7010722.5p                                                                                         AGCAGCTAGACGTTAATCGGTGTTGCGGGATATTTAAACAGCGATACTGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAGACGGGTTTGATCCCTCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTGTGTGCACGCTCCTCGGATACTCAGTCCGCTCT
  5   1   2       bld Egg1 5g                            PBX0107A03.5p                                                                                               CACGAGGGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGA
  5   1   2       bld Neu7 5g3  in                         XL040o19.5p                                                                                                GGTACTGCGGCATGTGTTAAGGAAATCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCAT
  5   1   2       bld Egg1 5g3  in                    IMAGE:3301393.5p                                                                                                                  GCACGAGGCGGGATTCAACGGCGGATAACTGGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAACAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAAGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGGCGGCCTCACCTGGCTCATTCCTACATTGTCCAGGTCCAAAGGACGG
  5   1   2       bld Ov1  5x3                        IMAGE:6318555.5p                                                                                                                                                GGCAAATGAAAAGCCACAGCAGAACTATATCAGGATGCCGCTGGGACTAAAGCCAACATGCAGCATGTGCAAAACAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCCGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATTAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAAATACTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGNCTGAGAAAGGGATTTATTTGGACTCACATTGGGCCCCACACCAGCCATCAGTATCAAAGGAAACGATGGCCCACCCCACCTGATTCAGTGATTTCATAGACTGGTATCGTTCCAN
  5   1   2       bld Neu7      in                         XL003h13.5p                                                                                                                                                                                                                          CAAACACATCTTCCATGTGGAAGAAAGGAAGCCAAGGCGAGATCCTGTGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCCGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAG
  5   1   2       bld Emb4      in                    IMAGE:4203324.5p                                                                                                                                                                                                                                                        CGTCGACCCACGCGTCCGGTAATAACTGCAGCGGCAAGAGCAGCACTGCTGCTGGTGGAAACAACAATAACAACAGCAGCAGCAGCACAAGTGGTAGCAGCTCTTATACCGGCACAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGT
  5   1   2       bld Egg1                               PBX0063D01.5p                                                                                                                                                                                                                                                                                                                                                                        ACCAACCTTTGCAAGTACTTCCACCTCCCAGCAGAGTAATGGTGGAAACACTAAACAGTCGAAGCAGGAAATCCACCGCAGATCAGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCC
  5   1   2       bld Ov1       in                    IMAGE:5048567.5p                                                                                                                                                                                                                                                                                                                                                                                                                             CACGCGTCCGGCAGGAAATCCACCGCAGATCCGCTCGACTCAGGAACACCAAGTACAAAGCTACGCCGGCTGCTGAAAAGAAGGTTTCTACTAAAGGAAAGGGCAGGAGGCACATATTCAAACTGAAAAATCCAATCAAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACACCAGCCATCAGTATCAAGGAAACGATGGCCAACCAC
  5   1   2       bld DMZ       in                         xl253g04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAGGCACCGGAATCTGTATCCACCATCGTCACATCAGAGTCCATCTTCCATAAGGGCCTCTACTACCAGATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCGGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTGCACTGAGCT
  5   1   2       bld Ga12      in                         XL166e05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCCTCTACTACCGNATTGGAGATGTGGTTTCTGTTGTGGACGAGGAAGATGGTAAAACATACTATGCCCAAGTGAGAGGTTTCATACAGGATCAGTACTGTGAGAAGAGTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAGAAATGCCGGCCTTCCTATGTGTTTGTCTTTTTTCCTTAATGATGGCATTGGGATCAACCATCATTTTTACCGGCCA
  3   1   2       bld Ga18                             rxlk157e22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAGGNCTCTACNNCAGNNNNAGATGNNNTTTCTNTTNTGGNCGANGNANGATGNNAAANATNNNATNCCNAAGTGAGAGNTTCANACAGGATCAGTACTNTGAGAAGAGNNCCGCCCTCNCCTGGCTCNNTCCTACATNGTCCAGTCCAAAAGACGGGTTNGNNCCCNCCNCATACATTATAGGGCCAGATGNAGNTCTCCCCAGNNAGATGGAGTGCTTAGANTTTGTNNNNNNGCTCCCTCTGAATACTTCAANTCTCGCTCTTCCCCTTTCCCTACCATTCCTNNCAGGCCTGAGAAGGGATTTATTTGNACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGNCCANCCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGNCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACNNNNNAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTNTCATNTTAAAGGTG
  3   1   2       bld Ga18                              rxlk70k09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCTGTNNNGGACNNGNANATGGTAAANCNTNCTANGCCNNAGNGANNAGNTTTNANNNNAGGATCAGTNCTGTGNGAANNGNNNNCCCTCNCCTGGCTCATTCNTACATNGNCNAGTNCAAAAGACGGGTTTGANCCNNCNNATACNTTATANGGCCNAGATGAAGATCTCCCAGGNAGATGGAGTGCTNAGNATTTGTGTNNNNNGCTCCCTCTGAATACTTCAANTCTCGCTCTTCCCCTTTCCCTACCNTTCCTACCAGGCCTGAGAAGGGATTTATTNGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATNCCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGNCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGNCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCNNNNNAAG
  3   1   2       bld Tbd7 5g3  in                         XL087o15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCCGCCCTCACCTGGCTCATTCCTACATTGTCCAGTCCAAAAGACGGGTTTGATCCCTCCACATACATTATAGGGCCAGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACGTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGTGAAATGTCAACATCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCGCTTTCCAGGTAAANAACACTGTAGGTTAATAATTAAAA
  3  -1   2       bld Ga11                            IMAGE:3475142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTGGAGCTCAGCTTGCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGAATTCCCCGGGATGAAGATCTCCCCAGGAAGATGGAGTGCTTAGAATTTGTGTGCCACGCTCCCTCTGAATACTTCAAGTCTCGCTCTTCCCCTTTCCCTACCATTCCTACCAGGCCTGAGAAGGGATTTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCGGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTG
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8531820.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCGGGTTTGATTCCCTCTCACCATACATATAGGGCAGATGAGATCTCCCAGAGATGAGGGCTAGAGTTGTGCACGCTCCCCTCTGATACTTCAAGTCTCGCTCTCCCTTTCCTACCATCTACAGGCTGAGAGGATTATTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTTTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACAAGGGCAGATAGAAGAAAAAAAAAGTGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTTACAGCCTCTCACCCACGCC
  3   1   2       bld Thy                             IMAGE:8550957.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGAGAGAGTAGATGTGCAGTCTTGATATCATTCGTTTCCTTCCTACATCTACAGCTGGAGGATTATTGATACATTGCCCACCCAGCATCAGTTCAAGAAAGTGGCCACCATGATTCAGGATTCATAGCGTATCTCCACACCAGCATTCTCATGTGTAGCTAGGTTGCCACCTTTCTGGAAAAAATACCAGCCTTCCTATATATTTTCTNTTTTCNTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCTTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTATTTATCACTTAAAGGGACCAGGAATAATCTGTT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202438.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTACCATCNTACAGCNNTGAGAAGGATTANTTGGACTCACATTGGCCCCACCCCAGCCATCAGTATCAAGGAAACAATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAACTAGGATTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTAAAGGTGACAGGAAATAACTAATAA
  3   1   2       bld DMZ       in                         xl253g04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTCACATNGGCCCCACCCCAGCCATCAGTATCAAGGAAACGATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAGCTAGGGTTGCCACCTTTTCTGGAAAAAAATACCGGCCTTCCTATATATTTATCTTTTTTCCTTAATAATAACATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACTAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTATTTATCATNNA
  3   1   2       bld Ga12 5g3  in                         XL195j24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCAGTATCAAGGAAACAATGGCCAACCACTGATTCAGTGATTCATAGACTGTATCGTCCACACCAGCATTTCTCATGTGTAACTAGGATTGCCACCTTTTCTGGAAAAAAATACCAGCCTTCCTATATATTTATCTTTTTTCNTTAATAATAACATTGGGATCAACCATCATTTTTGCCGGCCAGGCCGGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTAAAGGTG
  3   1   2       bld Egg1 5g3  in                    IMAGE:3301393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCACCTTTTCTGGAAAAAAATACAGCCNTTCCTATATATTATCTTTCCCTTAATAATACCATGGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAACAGAGAGAGTTTGTTGCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATAAA
  3   1   2       bld Ga12      in                         XL166e05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTTGTCTTTTTTCCTTAATGATGGCATTGGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAGTACCGGTCAGGTGGCAACCCTATGTGCAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGTCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGT
  3   1   2       bld Neu7      in                         XL003h13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGATCAACCATCATTTTTACCGGCCAGGCCAGTAAAATACCGGTCAGGTGGCAACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATATTTCCAGTGTGCAATGTTACTAAATATACAAGAGGAAGCAACACTTTGCCTCAGGCAACTGTTAGTAAACAAAACTTTTTAAA
  3   1   2       bld Neu7 5g3  in                         XL040o19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AACCCTATGTGTAGCTGATTTTGCCAAATGAATTAAACAGAGAGAGTTTGTTGCCTTTAGAAGAAACGTTTGGGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCCATCTAATGCCATTAGAGTAATACAGTCCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGAAGAACACAGGAGAACACGGGCAGGGGTTTGAACTAGTTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTNATTCTGAAATCATATATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGG
  3   1   2       bld Egg1                            IMAGE:3301973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGCACAGGCATAGCACCTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGGGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGAACAGGCTTTTGTGGCCGCAGTACAATTATGGGAGGAGAACAGGGGCAGATAGAAGGAAAAAAAGGGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATAAAAAA
  3   1   2       bld Emb4      in                    IMAGE:4203324.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATAGCACGTGAAGTCATGTCTAGCAACCAATCAGCACTTGCACTGAGCTATTCCTGTAAAATGGAGAACTGAAGTGCTCGGTATAGTTATTAAACATCTGAGAAATGTCAACTTCTATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGAGGTTTAATTAGTTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGAAAAAAAAAGTGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATATAAAAAAAAAAAAAAA
  3   1   2       bld Ov1       in                    IMAGE:5048567.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TATCTAATGCCATTAGAGTAATACAGTTCAAGACCAGTCCAGATGGGCAGTGCTGACATCCCTCCTGCTTTCTATGGTAAATGAACACTGTGAGGTTTAATTAATTAAAATAGCTTCACAGTGTGACTTTTTGTGCTTTCTCTCAGAAGGACAGGCTTTTGTGGCAGCAGTACAATTATGGGAGGAGAACAAGGGCAGATAGAAGAAAAAAAAAGTGCAATTTCAAACCAGGGGTTTGAACTAGCTTTAGTGATTTGGCTTCTGATACCACAGGCCCAAGCATGAATTGATTCTGAAATCATAGATGATGGTGGGATATTTTTTATTTTATCATTTTAAAGGTGTACAGTGTAAATAAATACCTTGTACTATA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)