Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:2942521.3                      13 END     1           3        7                (no blast hit)

 This cluster: approximate FL confidence score = 57%

 1012769012 Xl3.1-xlk159k18ex.3 - 31 ESTs
                                                                       .......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk159k18ex.3                                                                                                                                                                        GAGCGAAGCCCTTGTGTAAGAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAAATCTGTCCCAATTCTCTGCTCTTTTGAATTACTTATCTTAGCGTAATTTGCCCAAATTAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012687971                                                                                                                                                                              AGCCCTTGTGTAAGAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAxCxAAAAxxxxxxCCxAATTCTCTxxxxxTTTGAATTACTTATCTTAGCGTAATTTGCCCAAATTAAAAAAA
                                                      consensus depths                                                                                                                                                                             2     2     3     4     6     7    10    13    14    19    17    23    21    23    21    23    20    23    21    23    21    23    20    23    21    23    20    23    20    23    21    23    21    23    19    23    21    24    21    26    18    25    22    25    24    27    25    27    25    27    25    28    25    28    25    28    26    28    26    28    27    28    28    28    28    28    27    28    28    28    27    28    26    28    27    28    26    28    25    28    27    28    27    28    26    28    27    28    27    28    27    27    24    24    23    23    24    25    25    25    15    25    14    24    14    24    14    24    14    23    14    23    13    22    14    22    14    22    13    21    11    19    10    18    10    17    10    17    11    17    10    17     7    15     6    12     7    11     5    11     4     9     5     8     4     8     5     8     5     8     2     7     2     5     2     3     2     3     2     3     3     3
                                                                   SNP                                                                                                                                                                                                                                    -A----------
                                               BLH ATG      43      43                                                                                                                                                                        
                                               BLH MIN      43      89                                                                                                                                                                        
                                               BLH OVR      43      41                                                                                                                                                                        
                                               CDS MIN      43      24                                                                                                                                                                        
                                               EST CLI      32      24                                                                                                                                                                        
                                               ORF LNG      43       1                                                                                                                                                                        
                                                                                                                                                                                                                                                                    PROTEIN --- Ce ---- 4e-030     NP_001021934.1 C08B11.9 [Caenorhabditis elegans] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                     PROTEIN --- Dm ---- 3e-033     NP_724152.1 CG31800-PA [Drosophila melanogaster] ----------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                    PROTEIN --- Ag ---- 7e-040     XP_319595.4 AGAP008853-PA [Anopheles gambiae str. PEST] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PREDICTED = Sp ==== 3e-063     XP_001191335.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                     PREDICTED - Bt ---- 5e-067     NP_001029451.2 hypothetical protein LOC507125 [Bos taurus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                     PREDICTED - Gg ---- 3e-067     XP_417656.1 PREDICTED: similar to hypothetical protein MGC955 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Cf ---- 1e-070     XP_539558.2 PREDICTED: similar to CG31800-PA [Canis familiaris] -------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED - Mm ---- 1e-071     NP_001012400.1 similar to hypothetical protein MGC955 [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED - Hs ---- 5e-072     NP_077002.2 hypothetical protein LOC79078 [Homo sapiens] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                          PREDICTED - Dr ---- 9e-079     XP_001920356.1 PREDICTED: similar to Uncharacterized protein C08B11.9 (1207-1) [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PREDICTED = Xt ==== 7e-097     AAI58947.1 Hypothetical protein LOC549419 [Xenopus tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PREDICTED = Xl ==== 1e-103     NP_001088694.1 hypothetical protein LOC495958 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xl3.1-xlk159k18ex.3                                                                                                                                                                                        TAA------------------------ATG---------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAA---------TAA---------------------------------------------------------------------------------------------------------TAA------------------------------TGA------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ]
  5   1   2       bld DMZ  5g3  in                         xl322m18.5p                                                                                                                                                 GCTTATAAGCAGTTGCGACTTGCGAGCGAAGCCCTTGTGTAAGAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAA
  5   1   2       bld Te2N 5x3                        IMAGE:7203984.5p                                                                                                                                                                        GAGCGAAGCCCTTGTGTAAGAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTctttccttttttagagaattggatttttagaacattttattttgctcaggttttATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCCTATTTAAAGTGGTTTTACaaaaagcaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGGGGCGCCTTAAAT
  5   1   2       bld Egg1 5g                         IMAGE:3300833.5p                                                                                                                                                                                  GCACGAGGAGAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATNTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGNACACCATATGAGAACATAGAAAAAAGAGATGCAGAGATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTT
  5   1   2       bld Ga18 5g3  in                        xlk6a11ex.5p                                                                                                                                                                                   TTGTGTAAGAAGACTTGGGAAAGCAGNGGAAAATGGAGAGNGCCAAGGNAACACACATNACCACAGTGGCTCTTGTAGAAAGNAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAANTTGCTCAACAAGNGCAAAAGGNTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGC
  5   1   2       bld Emb1 5g                         IMAGE:3402881.5p                                                                                                                                                                                           GAAGACTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAG
  3   1   2       bld Ga18                             rxlk136o17ex.3p                                                                                                                                                                                             ANGNCTTGGGAAAGCAGTGGAAAATGNAGANNCCAAGGCAGCACACATGNCCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAANCCAATCGCATGGGAGNCCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGNCCAATGCATGTAACAGACTGACTGTTATANNAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAANTCTNTCCCAANTTCTCTNCTCTNTGANTT
  5   1   2       bld Kid  5x3                        IMAGE:7011144.5p                                                                                                                                                                                                CTTGGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGATTGGATTTTAGAAC
  5   1   2       bld Egg1 5g                            PBX0143C10.5p                                                                                                                                                                                                   GGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATG
  5   1   2      seed DMZ  5g3  in                         xl325h06.5p                                                                                                                                                                                                   GGGAAAGCAGTGGAAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTA
  5   1   2       bld Neu2 5x3  out                   IMAGE:2942521.5p                                                                                                                                                                                                      AAAGCAGTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCATGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCATGAACAAGCTATAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTTCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATTAACTACTGAATGAACAAAGTGCACTTCCA
  3   1   2       bld Ga18      in                      xlk139h14ex.3p                                                                                                                                                                                                       CCNNNNTCCGNCCACGCGTCNNNNAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGNCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATNNNTCAGCAGAAA
  5   1   2       bld Ov1  5x3                        IMAGE:8332173.5p                                                                                                                                                                                                        AGCAGTGGAAAATGTAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTTCTTTTTTAGAGAATTGGA
  5   1   2       bld Ga15 5g3  in                       XL467l17ex.5p                                                                                                                                                                                                            GTGGAAAATGGAGAGTGCCAAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAG
  5   1   2       bld Egg1 5g                            PBX0063A05.5p                                                                                                                                                                                                                GAAATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAACATTATTGATAAACTACTGAATGAACAAGTGGCAC
  3   1   2       bld Ga18 5g3  in                      xlk159k18ex.3p                                                                                                                                                                                                                AAAATGGAGAGTNCCAAGGCAGCACACATGNCCACAGTGGCTCTTGTAGAAAGTAATGCAANNCCTAAAGGGGTCCAGTTAGTTAGCNCTTATCAANCNAATCGCATGGGAGNCCCCTCAGNCCTTGTGGNACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGNNCAATGCATGTAACAGACTGACTGTTATANNAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCNCCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAANCTGGGATATAAAACAANNCTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTNACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGNTGTATTGTAAAAAAGCAGAAATANCCAAAANTC
  5   1   2       bld Egg1 5x3                           PBX0127E07.5p                                                                                                                                                                                                                  AATGGAGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCT
  5   1   2       bld Egg1 5x3                           PBX0142E09.5p                                                                                                                                                                                                                  CACGAGGAGTGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTNTAGAGGATTAACAAACTAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCAT
  5   1   2       bld Ga18 5g3  in                      xlk159k18ex.5p                                                                                                                                                                                                                  AAAATGGAGAGNNCCANGNNNCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAANTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGANNNATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGNATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGNGTTTTACAGAAGCAGAAGNGGNTNGCTGTCTTGTTTTTAGNTNTATTGNAAAAAAGCAGAAATAACCAAAATCTGTCCNAANNC
  5   1   2       bld Egg1                               PBX0154G04.5p                                                                                                                                                                                                                     CACGAGGGCCAAGGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCC
  3   1   2       bld DMZ  5g3  in                         xl322m18.3p                                                                                                                                                                                                                          GTGCCAAGGCANCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCNTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATT
  5   1   2       bld Te2N                            IMAGE:7206531.5p                                                                                                                                                                                                                               AAGGCAACACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCTTATTTAAAGTGTTTTTAAGAA
  5   1   2       bld Ga18      in                      xlk139h14ex.5p                                                                                                                                                                                                                                CANNNNNCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCANANNNATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCANNATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGNTGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGNNNNAAACAAANTGTCATTTNNCANCAGNAAGNTTCCTATTTNA
  3   1   2       bld DMZ  5g3  in                         xl325h06.3p                                                                                                                                                                                                                                 GGCAGCACACATGACCACAGTGGCTCTTGTAGAAAGTAATGCAAATCCTAAAGGGGTCCAGTTAGTTAGCACTTATCAAACCAATCGCATGGGAGACCCCTCAGACCTTGTGGAACTTGCTCAACAAGTGCAAAAGGCTGATGATTTTATCAGGGCCAATGCATGTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACCTGTCAT
  3   1   2       bld Ga18 5g3  in                        xlk6a11ex.3p                                                                                                                                                                                                                                                                                                                                                                                              TGCATNTAANNNNNTGACTGTTATAGNAGAGNAGATTCGTATGCTNNNGGANCAAGCTAGAAGGGTCNNGGANNAAGCCAAGAGAGATGCTGATTTNCACCCATGCAGCCTGCAAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCANCGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCNNCAAAGGATTGGGNNCCTAGTTGCCCACATGANTTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAANTNNTNNCNNNNNNCTNCT
  3   1   2       bld Ga15 5g3  in                       XL467l17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                    GTAACAGACTGACTGTTATAGCAGAGCAGATTCGTATGCTGCAGGAACAAGGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAAATCTGTCCCAAATTCTCTGCTCTTGAATTACTAT
  5  -1   2       bld Bla2                            IMAGE:7297371.5p                                                                                                                                                                                                                                                                                                                                                                                                     AGGNCATGCAGTACAGATGACTGTATAGCAGAGCAGATCGTATGCTGCAGGACAAGCTAGAGGGTCCTGAGGAAGCCAAGAGAGATGCTGATTGCACCATGCAGCCTGCAATGTTTAAAAAAGCCAGGAAATATTTATATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAAATCTGTCCCAAATTCTCTGCTCTTTGAATTACTTATTTTAGCGTAATTTGCCCAAATTaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCCCTAAGAA
  5   1   2       bld Emb3                   IMAGE:3399879-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                      GTATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAAATCTGTCCCAAATTCTCTGCTCTTTGAATTACTTATCTTAGCGTAATTTGCCCAAATTaaaaaaaaaaaaaaaaGCCTTCTAGT
  5   1   2       bld Emb3                            IMAGE:3399879.5p                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGCTGCAGGAACAAGCTAGAAGGGTCCTGGAGGAAGCCAAGAGAGATGCTGATTTGCACCATGCAGCCTGCAATGTTGTAAAAAAGCCAGGAAATATTTATTATCTCTACCAACGGGAAAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCCTGGACACCATATGAGAACATAGAAAAAAGAGATGCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTC
  3   1   2       bld Neu2                            IMAGE:2942533.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGACAGCACATAGAGATGATAATATGCACCAAGCAGCGTGCAATGTTGTATAAAGCCAGCATATATTATTATCTCTCCAACGGGGTAGTGGGCAGAGATATTTCTCGATTCTGTCACCAAAGGATTGGGGCCCTAGTTGCCCACATGAATTTCTTGCGGCTTACAAGCTTCAGCATGACATGTCATGGACACCATATGAGAACATAGAAAAAAGAGATTCAGAAATCAGCATTATTGATAAACTACTGAATGAACAAGTGGCACTTCCATCATGCCACGAACCCAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCAGAAGTGGCTGGCTGTCTTGTTTTTAGTTGTATTGTAAAAAAGCAGAAATAACCAAAAATCTGTCCCAAATTGTCTGCTCTTTGAATTACTAAAATTAGCGTAATTTGCCCAAATTAAAAAAAAAAAAAATTA
  3   1   2       bld Ga18      in                      xlk136k21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAACTTTAGAGGATTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAA
  5   1   2       bld Ga18      in                      xlk136k21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTTTAGAGGANTAACAAACTAAAAATCTCTTGACACCTGGATTACTGATCACCTCTGTAATGTGAAATTGTGGCATTATTTGTTTGTGATGCAAGGATGTCACCAACCGCTATTTATCATTTCATCATGCCCTGAGAGTCTTTCCTTTTTAAGAGAATTGGATTTTAAGAACATTTTATTTTGCTCAGGTTTTATATAAACTGGGATATAAAACAAAACTGTCATTTGTCAGCAGAAAGTTTCCTATTTAAAGTGTTTTACAGAAGCaaaaaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)