Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 29 Mar 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 86%

 1012769056 Xl3.1-IMAGE:6958228.5 - 50 ESTs
                                                                       .........-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6958228.5                                                            TACAGAATGCGTTCCATTCATAAAGTGCCGTGATCCTGGAGTCGTCAGAGCCGGACAAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTACCCCCCTCCCCCACTCTCCCAGAGCATCTCGGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTGGATTCAGGAAACTGTGTGGTTTAACCCTCTCAGTGCCAAAAAGGGCCTTGAAGGAGCTAGGACAGGCATGGATAATCTCTAGCCTTCAGATGTTTAACTACAACTACCAAGAGCCGAAGAAGTTGGAGTTGAACCGCATCGACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTTCCCCCCCCCCGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCAGGTCTTGATTTTAAATAAAGAAC
                                                  Xl3.1-CHK-1012686697                                                                  ATGCGTTCCATTCATAAAGTGCCGTGATCCTGGAGTCGTCAGAGCCGGACAAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTACCCCCCTCCCCCACTCTCCCAGAGCATCTCGGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTGGATTCAGGAAACTGTGTGGTTTAACCCTCTCAGTGCCAAAAAGGGCCTTGAAGGAGCTAGGACAGGCATGGATAATCTCTAGCCTTCAGATGTTTAACTACAACTACCAAGAGCCGAAGAAGTTGGAGTTGAACCGCATCGACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTxxGTxAGGTCTTGATTTTAAATAAAGAACCAAGTG
                                                      consensus depths                                                                 2     2     2     2     2     2     2     3     2     5     6     7    12    17    16    22    17    23    18    23    20    25    24    27    24    28    24    28    24    28    25    28    25    28    25    28    25    28    25    28    27    29    27    29    26    29    27    29    27    29    27    29    27    29    28    29    28    29    28    29    28    29    28    29    27    29    29    30    29    30    30    30    29    31    30    31    30    31    30    30    28    30    29    29    27    29    27    29    27    29    25    28    24    28    23    28    25    28    21    26    21    25    21    25    22    25    20    24    21    24    19    23    18    22    18    22    17    21    16    21    17    21    15    21    15    20    10    17     9    16     9    15     7    14     7    14     7    14     8    15     8    15     6    12     6    12     6    12     4    11     5    11     4    11     5    10     5     9     4     8     3     8     3     7     3     6     3     5     3     5     3     4     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     6     6     8     6     9     6     9     5     9     5     9     5     9     5    10     5    11     5    12    11    13    10    13    10    13    10    13    10    13    10    13    11    13    11    13    10    13    11    13    10    13     9    13    11    14    10    14    11    14    11    13    11    14    11    15    11    16     8    16     7    16     7    16     8    16     8    16     8    16     7    16     7    16     7    15     4    13     2    10     2     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                        -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------G-----
                                               BLH ATG      60     229                                                            
                                               BLH MIN      60     114                                                            
                                               BLH MPR      12     114                                                            
                                               BLH OVR      60      63                                                            
                                               CDS MIN      60      32                                                            
                                               EST CLI      61      32                                                            
                                               ORF LNG      60       3                                                            
  5   1   2       bld Oo1  5g                         IMAGE:5079407.5p GTGACTGCGCTCATCACACCGAGGCGTCAGCAAGAGGAGGGGCCAATCAGAAACGTCGTTACAGAATGCGTTCCATTCATAAAGTGCCGTGATCCTGGAGTCGTCAGAGCCGGACAAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGTTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCNAGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTACCAAAGTGTGCTGGAATACTTGGTGAACTGGTTTGAAGAAGAGGACTTTTACTCCANAAGCTGGGGCGGTGGGCTTTATGGCTTTTGCTGGCCTTGCCTGGAGAAAACACCTGCTTGCCCTGAAGGTTCCACTCCTCTTAATTTAGGCCAGTTTGGGCCCCCAAAAAATGGCCTCCCCAAATTCCGAAGGCTGTGGGGGGG
  5   1   2       bld Oo1  5g                         IMAGE:6643205.5p                                                            TACAGAATGCGTTCCATTCATAAAGTGCCGTGATCCTGGAGTCGTCAGAGCCGGACAAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGTTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTGGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCANAAGCTGGGGTGGAACATAAGGAAGAATGATCGGGTGTCTCCACTGGAACTATTCATCTGNCTGGGTTGGCAGGTACTTTGNAACAGCGAAGATTTTGGCTGACTGTAATGACCCCATCTTTGAGGATGATCCGGGCAGCTTTTACCC
  5   1   2       bld Ooc1 5g                          Ooc1-db30h12.y1                                                                                        gggtcgacccacgcgtccgcccacgcgtccgCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAGAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTGTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTTGGGGAACGGCTATATTCTGACCTAGCGGGTGCCCGTAACAGC
  5   1   2       bld Emb1 5g                         IMAGE:5155887.5p                                                                                                          CCACGCGTCCGAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTTCCACCGTTGGTGAGCATTGGTAGTCGGGATGAGCCCGGGGGACAGTAACAAGGGTGGCTAGAAATACTTGGGGGAAACTGGTTTGGAAAAAAAGGGAACTTTAACTCCCGAAGCTGGGGCCGTTGGGTTTTATTGCTTTTGGTTGGGCTGGCCCGGGGGAAAAAACCACCTGGGTTGCCCTGAAAGGGCTTCCCCTCCCCTTTATTTTAGGGAAAGTTTGGGCCACCCAAGAAATGGCTTCCCCAAAATTCCAAAAAATTTgggggggggggggAAACCCTTATAGGGGGGAAATAATAGGTTTTCCGGGGGGGTGTGTT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5074505.5p                                                                                                            ACGCGTCCGAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGC
  5   1   2       bld Egg3 5g                         IMAGE:6326987.5p                                                                                                               CCCCGGGGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGGAACATAANGGAAGATGATCGGGGTGTCTTCCCCTGAACTTATTCCTCTGGGCGGGTGGGCAGGGACCTTTTGAACACCGGGAATTTGGCTGACTGGGGTGGAACCATCCTTGATGAGGATTAGGGCACCTTTACCCCCCTTCCCCATTTTTCCAAAAGAATTTCGGGAAATTCCCAGGCTTATCCAACCCCCCT
  5   1   2       bld Ov1  5g3  in                    IMAGE:5073861.5p                                                                                                                     CCACGCGTCCGGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGA
  5   1   2       bld Neu7      in                         XL017b06.5p                                                                                                                         ATGGATTCGGGGCCCGAANGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACCAAGTGTGCTAG
  5   1   2       bld Ov1                             IMAGE:6318949.5p                                                                                                                         TGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTANGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGNTGCCCATCTTTGATGATGATCAGGCAGCTTTACCCCCCTCCCCAATTCTCCAGAGCATCTTCGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGGTGCACCAACTATATCGGTTTTGGGATCCCGGAAAACTggggggggTTAAC
  5   1   2       bld Ga18                              xlk149b01ex.5p                                                                                                                         ATGGATTCGGGGCCCGAAGAGCTGATNNCCNGNTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGANNNNNGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGNGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTNNTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGNTCACTCTCTTATTAGGCAGNTGGNACGAAGATGCTCACAAATCAGAGCTGGGGTGGAANATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATNCATCTGTCTNGNTGGNAGGTACTTTGAACAGCGGGATTTGGCTGACTTTGGTGNNCCATCTTGATGATGATCAGNCAGCTTTACCCCCCTNCCCCACTCTCCCAGAGCATCTCGGCAANATCCATGCTATCCACTCCCCTTCT
  5   1   2       bld DMZ                                  xl294p22.5p                                                                                                                            ATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGACCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAANATGCTCACAAATCAG
  5   1   2      seed Ga12      in                         XL210l05.5p                                                                                                                               CACGAGGCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTANGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATA
  5   1   2       bld Ga12      in                         XL170n15.5p                                                                                                                                 AGGAATTCGGACGAGGTGATGCCCGGCTGTTCCGGTTGAGGCCTGTGATCTTCCCGAGGACTTGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTC
  5   1   2       bld Ov1                    IMAGE:6318949-IMAGp.IMAGp                                                                                                                                 CCTTTGGGAATTCGCCCCATGGCTCGTTACCGGTTGGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGAT
  5   1   2       bld Ooc3      in                    IMAGE:3436492.5p                                                                                                                                   GCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGNAGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCAGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATTGCTTGCTGGCCTGCCTGGAGAAACACTGCTGCCTGAGGCTCACTCCTCTATTAGGCAGGTTGGCACGAAGATGCTTACAAATCAGAGCTTGGGTGGAACAT
  5   1   2       bld Ga12      in                         XL168a24.5p                                                                                                                                   AATTCGGACGAGGCTGATGCCCGGCTGTTCCGGTTGAGGCCTGTGATCTTCCCGAGGACTTGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCCGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCT
  5   1   2       bld Egg4      in                    IMAGE:3744512.5p                                                                                                                                    CCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTANCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTAGTTTCCCACCGTTGCTGACCATTGTTAGTCAGATGATCCANGCGACAGTAACAAGTGTACTAAAATACTTGATGAACTGATTTAAAGATAAGAACTGTACTCCAAANCTAGATCATTAGCTTTATACTTTCCTAGCCCTCCTAGACAAACCACTTCTGCCTGAG
  5   1   2       bld FaB       in                    IMAGE:8070417.5p                                                                                                                                     CCGAAGAGCTGATGCCCAGGCTGTTACCGTTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCACCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTAATAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCCCT
  5   1   2       bld FaBN                            IMAGE:8078143.5p                                                                                                                                       CGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCANCAATCAGAGCTGGGGTGGAAACATANGAAGATGATCGGGTGTCTCCACTGAACTTATCATCTGTCTGGTTGGCAGGTACTTGACAGCGAGATTGGCTGACTGTGTGACCATCTG
  5   1   2       bld Neu7      in                         XL033d18.5p                                                                                                                                             CTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCA
  5   1   2       bld Ga12                                 XL141k16.5p                                                                                                                                              CTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGC
  5   1   2       bld Eye1                            IMAGE:6958228.5p                                                                                                                                              TGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTAcccccctcccccACTCTCCCAGAGCATCTCGGCAATATCCATGGCTATCCACTCCCCCTTCTCATCCAGGTGGTGCACCCAAACTATATCGGTTTTTTGGAATT
  5   1   2       chi Em10                            IMAGE:7980020.5p                                                                                                                                                           TTGGAGTCGTCAGAGCCGGACAAGCATGGATTCGGGGCCCGAAGAGCTGATGCCCAGGCTGTTACCGGTTGAGGCCTGTGATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATANGGAAGATATCGGGTGTCTCACTGAACTTATCATCTGTCTGGTGGCAGTATTTGACAGCGAGATTGCTGATGTGTGACCATCTGAGATATCGGCGCTTACCCCCTCCCATCTCCGACATCCGCATTCATGATCATCCTCCACATGTGCCACTATGTTTGATCGACGG
  5   1   2       bld Em10                            IMAGE:7979700.5p                                                                                                                                                                              GATCTTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCTGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTATTCATCTGTCTGGTTGGCGGTACTTTGACAGCGAGATTGGCTGACTGTGGTGACCATCTTGAGAGATCAGCAGCTTACCCCTCCCCATCTCAGACATTGGCAAATCAGGCACCACTCCTCCATCAGGGGCACACTATCGTTTGATCAGACTGGTGTTACTCCATGCAAAGCTTGAA
  5   1   2       bld Ga14                               Ga14-p10b3.5p                                                                                                                                                                                 ATTCCCGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTCAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTCTGTCTGGGGGAACGGCTATATTCTG
  5   1   2       bld Te2N                            IMAGE:7205845.5p                                                                                                                                                                                      CGAGGACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGGGATTTGGCTGACTGTGGTGANCCATCTTGATGATGATCAGGCAGCTTTAcccccctcccccACTCTCCCAGAGCATCTTCGGAATATCCATGCTATCCACTCCCCTTCTCATCCGGTGGTGCACCACCTATTTTCGTTTTGGGATTCGGGAAAACGGGGGTGGTTTAACCCCTCCCAGGGGCCCAAAAGGGGCC
  5   1   2       bld Ga12      in                         XL149p22.5p                                                                                                                                                                                           ACTATGATCCCTCCGTGCCGCCTCGGACCCCTCAGGAGTATCTGCGGAGAGTCCAGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCT
  5   1   2       bld Em10                            IMAGE:8318655.5p                                                                                                                                                                                                        CAGATGTGAAGCCCCTGATACTGCCTGTGCTACTGAACCGCTGATTGAAGCAGCACGTTGTCCTGATGTAGTCATTGCACAGATTGATCCCAAAAAGTTGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATC
  5   1   2       bld Emb1                            IMAGE:5155428.5p                                                                                                                                                                                                                                                                                                          TGCGAAAGAAACAGACCGTTAGCATATCTCTGTCGGGATGCCAGCCTGCTCCTGATGGGTACTCTCCAAGCCTCCGCTGGCAGCAGCAACAAGTAGCACAGTTTTCTGCTGTCCGCCAGAGTCTGCACAAGCACAGGGGTCACTGGAGGTCTCAGCCTTTGGACAGCAATGTTACAATGCCAAGCACAGAGGATGAAGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTAccccccctcccccACTCTCCCAGAGCATCTCGGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTTGGATTCAGGAAAACTGTGGTGGTTTTAACCCCTCTCAGTGCCCAAAAAAGGGGCCC
  5   1   2       bld Egg6      in                    IMAGE:4435430.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTGGACACCAATGTTACAATGCCAAGCACAGAGGATGAATATAGCTGGAAAAAGATCTGTCTGGGGGAACGGCTATATTCTGACCTACCAGCTGCCCTAAACAGCGAGACCCAGCCTCCCACAATTGATTACATTAAGGTTGGTTTCCCACCGCTGCTGAACATTGTTTATCTGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGAGATCTGGATTGAAGAGAGGAACTTTACTCCATAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGACGGTACTACAATGCTCACAAATCAGAGCTTGTGTG
  5   1   2       bld Bla1                            IMAGE:3381132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGGGAGAGCTGGAAAAAGTTCTGTCTGGGGGAACGGCTATATTCTGACCTAGCAGCTGCCCTAAACAGCGAGAGCCAGCATCCAGGAATTGATTACATTAAGGTTGGTTTCCCACCGTTGCTGAGCATTGTTAGTCGGATGAGCCAGGCGACAGTAACAAGTGTGCTAGAATACTTGGTGAACTGGTTTGAAGAGAGGAACTTTACTCCAGAGCTGGGTCGTTGGCTTTATGCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTACCCCCCCT
  5   1   2       bld Egg1                               PBX0129B03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCTTTGCTGGCCTGCCTGGAGAAACCACTGCTGCCTGAGGCTCACTCTCTTATTAGGCAGTTGGCACGAAGATGCTCACAAATCAGAGCTGGGGTGGAACATAAGGAAGATGATCGGGTGTCTCCACTGAACTTATTCATCTGTCTGGTTGGCAGGTACTTTGAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTAcccccctcccccACTCTCCCAGAGCATCTCGGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTGGATTCAGGAAACTGTGTGGTTTAACCCTCTCAGTGCCAAAAAGGGCCTTGAAGGAGCTAGGACAGGCATGGATAATCTCTAGCCTTCAGATGTTTAACTACAACTACCAAGAGCCGAAGAAGTTGCAGTTGAACCGCATCTACAGCACTTCACTTTGCCAATCCCTCAATTTTGGCACCAACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATA
  5   1   2       bld Ov1                             IMAGE:8330570.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAACAGCGAGATTTGGCTGACTGTGGTGACCCATCTTGATGATGATCAGGCAGCTTTAcccccctcccccACTCTCCCAGAGCATCTCGGCAATATCCATGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTGGATTCAGGAAACTGTGTGGTTTAACCCTCTCAGTGCCAAAAAGGGCCTTGAAGGAGCTAGGACAGGCATGGATAATCTCTAGCCTTCAGATGTTTAACTACAACTACCAATAGCCGAAGAAGTTGGAGTTGAACCGCATCGACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGttttttgttttgtttttttttttttCAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCAACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGTAAAAGTCGTTAAATCATTGTGTAGCATGGGAAAGCTGT
  3   1   2       bld FaB       in                    IMAGE:8070417.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCCCCCTTCCCCCACTTTCCCAGAGCATCTCGGCAATATCAAGCTATCCACTCCCCTTCTCATCCAGTGGTGCACCAACTATATCGTTTTTGGATTCAGGAAACTGTGTGGGTTAACCCTCTCAGTGCCAAAAAGGGCCTTGAAGGAGCTAGGACAGGCATGGATAATCTCTAGCCTTCAGATGTTTAACTACAACTACCAAGAGCCGAAGAAGTTGCAGTTGAACCGCATCTACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTTTGAAGGAGCAACGGTCTTATTTATTGTTCGTTTTGTTTTTTGTTTTTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGGTGGGAAAGAGTAGTTAAATCAGTGGGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTGTAGTCCGAGAAAAACTCCAGTCAC
  3   1   2       bld Ov1  5g3  in                    IMAGE:5074505.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAGCCGAAGAAGTTGGAGTTGAACCGCATCGACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTTCAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTGTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTTCCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAACCAAGTGCTTCCTACAACAAAAAAA
  3   1   2       bld Ov1  5g3  in                    IMAGE:5073861.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGAAGAAGTTGGAGTTGAACCGCATCGACAGCACTTCACTTTGCCAATCCCTGAATTTTGGCACCGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTTCAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTGTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTTCCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAACGAAGAAATCCTACAACAACAAAAAAAAAAAAGGGCGGCCGC
  3   1   2       bld Ooc3      in                    IMAGE:3436492.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTAATGTTCGTTCTGTTTTTTGTTTTGTTTATTTTTTTTCAAGTAATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAAGTGGGGTTGGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAACCAAGTGCTTCCT
  5   1   2       bld Egg5      in                    IMAGE:3431427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGACCAATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGttttttgttttgttttttttttttCAAGTCATTTTTCATATATTGGCNNCAAAGTTGGAAAGATATTTAAGTGCCTCAGTGGGTTNTGTGGAAANCCATTTTCCATTCATTAAANCCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTTGCCTTTAATTTTGGACTGTTccccccccccAGTTTGCCTGTTATCATCTGTG
  3   1   2       bld Egg4      in                    IMAGE:3744512.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATTGCACGTCGACCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTGATTTTAAATAAAGAACCAAGTGCTTCCTAAAAAAA
  3   1   2       bld Egg6      in                    IMAGE:4435430.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTCTTGCCTGCCATTGGCAGTATAGTATAATGTTTTCCCTTTCTTGGAGTCTGAAGGAGCAACGGTCTTATTTATTGTTCGTTCTGTTTTTTGTTTTGTTTTTTTTTTTCAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTGTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTTCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTA
  3   1   2       bld Ga12      in                         XL168a24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTTTTNCCNTTTTTGGNGTTTGAAGGNGNNACGGTTTTANTTANTGGTCNNTCCGGTTTTTGnTTTGTTTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCNTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTGATTNTAAATAAAGAA
  3   1   2       bld Neu7      in                         XL017b06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAACGGTNTTATTTATTGNTCGGTCNGNTTTTTGGTTTGnTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTT
  3   1   2       bld Egg6                            IMAGE:4435948.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTATTTATTGTTCGTTCTGTTTTTTGTTTTTGTTTTTTTTTTTTCAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTGTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTTTCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTTGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTT
  3   1   2       bld Egg6                            IMAGE:4412781.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTTTGGNTTGGTTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTGGTGGAACCCATTTTCCATTCATTAAACCCCACCCTGCTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTA
  3   1   2       bld Ga12      in                         XL170n15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTGNTTTTTTTTTTTTTCAAGTCATTTTTCATATATTGGCCAAAGTTGGAAAGATATTAAGTGCCTCAGTGGGTTTGTGGAAACCATTTTCCATTCATTAAACCCCACCCTGNTGTTAACCCCTCTTTTGCCAGTTGTTCAACAAGNTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTATGTATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTT
  3   1   2       bld Neu7                                 XL041j19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAAGCTGGGAAAGAGTCGTTAAATCAGTCTGTAGCATGGGAAAGCTGTGAAACTGTACAGTTAAGATTANGNATTTGCCTTTAATTTGGACTGTTCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTACCTTTGTTAGGTACTNATTTTAAATAAAGA
  3   1   2       bld Neu7      in                         XL033d18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTAANANTANGGANTTGCCNTTAANTTGGNCTGNTCCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTNATTTTAAATAAAGAACCAAG
  3   1   2       add Ga12      in                         XL149p22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGCCCTTAAATTNGACNGGTNCCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTACTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTNGATTTTAAATAAA
  3   1   2       bld Ga12      in                         XL210l05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAATTGGGNTGNTNCCCCCCCCCCCCCAGTTTGCCTGTTATCATCTGTGTCTGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTT
  3   1   2       bld Egg5      in                    IMAGE:3431427.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAGCTGCCTCTGTAATATGGTCTGCTCCTAAACCTGGGACTCTGCAGTGTATTAGAATACCTTACCCCTTTCCTTTGTTAGGTCTTATTTTAAATAAAGAACCAAGTGCTTCCTACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)