Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL456j16ex.5.5                       73 END     1           1        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL424g19ex.5                         83 PI      92        179     1171                hypothetical protein LOC432013 [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012769068 Xl3.1-XL485m02ex.5 - 57 ESTs
                                                                       ...-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL485m02ex.5                                                                                              CTCCTTGGTCCACTGGGCAACTGAGGCTTCTTAAAGAGCTCGTGCATTGGCTGTGAAGCTCACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCAAAAAAAAATAAGAAAAAACGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGGCAGCAGCAACAGCAGCAGCAGAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTTAAGCCCAATGGGGCACCAATGCATGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTACCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCCTCTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTCTCTGTGTCAGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAAATATTAAATG
                                                  Xl3.1-CHK-1012686412                                                                                                    GGTCCACTGGGCAACTGAGGCTTCTTAAAGAGCTCGTGCATTGGCTGTGAAGCTCACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCAAAAAAAAATAAGAAAAAACGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGGCAGCAGCAACAGCAGCAGCAGAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTTxAxxCCxAxxGGGCACCAxxxxxTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTATCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCCTCTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTCTCTGTGTCAGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAAATATTAAATGACTCTA
                                                      consensus depths                                                                                                   2     2     2     3     2     3     3     4     3     6     3     6     3     6     4     7     5     8     6     9     8    10     9    10     9    10     9    10    10    10    13    13    13    13    13    13    13    13    13    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    15    15    16    16    16    16    17    17    17    17    17    17    16    16    15    15    15    15    15    15    14    15    13    15    13    15    13    14    13    14    12    14    12    13    12    14    11    14    12    14    11    14    12    14    12    14    14    15    13    15    12    15    12    15    10    14    12    13     8    12     9    12     7    12     7    12     6    11     6    11     6    10     6    10     6    10     5    10     5    10     5    10     5     9     5     9     5    10     5    10     2     7     2     7     4     6     4     6     4     6     4     6     4     5     2     6     5     6     5     6     5     7     5     8     6     9     6     9     6     9     5     9     5     9     6     8     6     8     6     8     4     7     4     7     3     7     4     7     4     7     4     7     4     7     5     7     4     7     6     8     5     8     6     8     5     8     5     8     7     9     6     7     6     7     6     7     6     6     6     6     6     7     6     7     6     7     6     7     6     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8    10     9    10     9    10     9    10     9    10    10    10     9    10    10    10    10    10    11    13    12    13    14    15    12    16    13    16    15    17    17    20    17    22    17    21    18    22    19    23    19    23    18    23    18    23    21    24    21    24    21    24    22    25    23    26    25    28    23    27    24    27    23    29    24    29    27    32    27    32    26    31    28    31    28    31    25    31    28    31    27    31    28    31    27    30    26    30    27    30    26    30    26    30    26    30    26    29    26    28    22    28    22    28    22    28    22    28    21    27    21    27    21    27    20    27    20    26    20    26    20    26    20    26    20    26    20    26    20    26    20    26    20    26    20    26    19    25    17    24    17    24    17    24    17    24    16    24    11    16     6    13     3     6     3     4
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTGAATTAAGATATAAATATATATTTATACAACAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----GG-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----T-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              T-T---------
                                               BLH ATG     246    1164                                                                                              
                                               BLH MIN     234     157                                                                                              
                                               BLH OVR     246    1393                                                                                              
                                               ORF LNG     246      42                                                                                              
                                                                       PROTEIN --- Sp ---- 1e-018     NP_999663.1 goosecoid transcription factor [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================
                                                                                         PROTEIN --- Ce ---- 8e-026     NP_001024213.1 abnormal ThermoTaXis family member (ttx-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 4e-030     NP_001014727.1 CG12154-PB, isoform B [Drosophila melanogaster] --------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Ag ==== 3e-033     XP_310918.4 AGAP000215-PA [Anopheles gambiae str. PEST] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Ci ==== 2e-039     NP_001027662.2 Otx [Ciona intestinalis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Dr ==== 3e-117     NP_571326.1 orthodenticle homolog 2 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = ?? ==== 2e-150     XP_876837.3 PREDICTED: similar to orthodenticle homeobox 2 isoform 4 [Bos taurus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Gg ==== 5e-152     NP_989851.2 homeobox protein OTX2 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Mm ==== 2e-152     NP_659090.1 orthodenticle homolog 2 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Bt ==== 1e-152     XP_876928.1 PREDICTED: similar to orthodenticle 2 isoform b isoform 5 [Bos taurus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Hs ==== 1e-152     NP_758840.1 orthodenticle 2 isoform b; homeobox protein OTX2 [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED = Cf ==== 8e-153     XP_547830.2 PREDICTED: similar to orthodenticle 2 isoform b isoform 1 [Canis familiaris] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xt ==== 6e-154     AAI35885.1 Orthodenticle homeobox 2 [Xenopus tropicalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Xl ==== 3e-160     NP_001084160.1 homeobox protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL485m02ex.5                                                                                                                   TGA------------------------------------------------------------TAA------------------------------------TAG---------------------TAA------------------------------TGA------------------------------------------------TGA------------ATGATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------ATG------------------------ATG------------------------------------------------ATG---TGA---------------------------------------------ATG---------------------------------------------------------------------TGA------ATG---------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAA------------------------------------------------------------------------------------------------TAG---------------------------ATG------------------------------------------------------------TGA---------------------------------------------------TAATAA------TAA---------ATGTAG------------------------------------------------------------------------------TAG------------TGA------------------------------------------------------------------------------------------------TAG------------------TAA---------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------TGA---------------TAA---------------------------TGA---TGA---------------------------------------------------------------------------------------------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                    [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Em10 5g                         IMAGE:8321961.5p                                                                         CGTTTATCTAGTAGCCAACATCTCCTTGGTCCACTGGGCAACTGAGGCTTCTTAAAGAGCTCGTGCATTGGCTGTGAAGCTCACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTC
  5   1   2       bld Em10 5g                         IMAGE:8320546.5p                                                                                              CTCCTTGGTCCACTGGGCAACTGAGGCTTCTTAAAGAGCTCGTGCATTGGCTGTGAAGCTCACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCAGTCATCTCAGCAGCACAGCCCCTGTGTCATCTGGAGCCGGGCTCGTCTCTCTCTGTCGACCCCTATCACTCATCTCATGATGCAGAGTCTACCTAGACTACACCAGCATCAGTACAGCAGAAGCAGTCACTCTACTGGGGTAGAGTGACTATGACCTAGTTCACTCCGCTGACACTAGCATGCCAGAT
  5   1   2       bld Ga15 5g                            XL466h23ex.5p                                                                                                TGAAGCCCCTGTGTTTGGCACCGACAGTCGCCGACCCCCCCATAGCCTTTGTTCTTTCACTGGATTCTCTGGATTTTATTGCAGGAGAAGAAGAGGGAGGATCATTTGTTCCTTTTTCATTAAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCA
  5   1   2       bld Em10 5g                         IMAGE:8319424.5p                                                                                                                               AAGAGCTCGTGCATTGGCTGTGAAGCTCACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGGNCTCGTCTCTCCTCTGTCCGACCCCTATCCACATCATCTTCATGTATGCAGAGGTCCNTACCTATGACNTACACGCAGGC
  5   1   2       bld Ga18      in                      xlk136o14ex.5p                                                                                                                                     GCTCGTNCATTGNNTGTGNNNNNACATACTAACAAGCCATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGNCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGNCCAGGTCTNGNNCAAAAACCNCAGA
  5   1   2       bld Neu7      in                         XL026f01.5p                                                                                                                                         ATAGCCTTTGTTCTTTCACTGGATTCTCTGGATTTTATTGCAGGAGAAGAAGAGGGAGGATCATTTGTTCTTTTTTCGTTAAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGG
  5   1   2       bld Emb1 5g                         IMAGE:6632834.5p                                                                                                                                                                         CATCGGACATAAAGCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATNGCAGGCTCAACATCCTACTTTTGGGGGTATGGGACTGTGGGATCCTTACTTTGAGCCCCTATGGCATCATCAAGCTTCTCTGGAACCCTGGAAGCTACCTTTTAGGCCAAATGGGGGCAC
  5   1   2       bld Em10 5g                         IMAGE:8320508.5p                                                                                                                                                                                      GCAGCTCATCATTTAATCACATTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCTCTGTCCGACCCCTATCACATCATCTCATGTATGCAGAGGTCTACCTATGACTACCGCAGCATCGGTACGCCAGGAATGCAGCTCACTCCTACTTGGGTAGGACGTGGATTATGAGCCTAGGTCACACTCTCGACTGGACTTTACCCAGGGACATGGTACATCCTAACATCCCTGCCTCCTAGGA
  5   1   2       bld DMZ       in                         xl320m23.5p                                                                                                                                                                                                    ATCACATCTTCTGTCCACTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACNCGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGNGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAANCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAG
  5   1   2       chi Ga12      in                         XL177p16.5p                                                                                                                                                                                                            TTTCTGTCCCTTGTAGAAAATTGTGCGCaaaaaaaaataagaaaaaaCGCCCAACGGATCCAGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTAAGCCCCTCTACCAAGCCACAACCTCACCCAACATGGAGAGGTAACCTCAGCAGACATGTCCCCCAGGACTTCCCCAACGTGAAATATTTTAGCCAGTTTCTTGATGGAGAGATAAGTAATCACTTTATTTTATTATTTTTAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAG
  5   1   2       bld Emb1 5g                IMAGE:6632834-IMAGp.IMAGp                                                                                                                                                                                                                                                                         AGCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCT
  5   1   2       bld DMZ       in                         xl304b16.5p                                                                                                                                                                                                                                                                          GCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACAAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTTCAGTCATCTCAAGCAGCACAGCTCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTGTCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTCTAA
  5   1   2       bld DMZ       in                         xl311p18.5p                                                                                                                                                                                                                                                                          GCAAACACTGATCGCCCGACTTTGTCGCTGCAACGATTTCTTCCGCGGATTGTGCTCCCTGATCAAACACAAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTNAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCANAGTGCCGGCAGCANCAACAGCAGCAGCAGAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTTCAGTCATCTCAAGCAGCACAGCTCCTGTGTCCATCTGGAGCCCGGCCTCCCGTCTCTCCTCTGTCCGACCCCCTGTCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTCT
  5   1   2       bld Ga15      in                       XL485m02ex.5p                                                                                                                                                                                                                                                                                                                                         CAAACACGAGCATGATGTCTTATCTCAAGCAACCGCCATACGCCGTGAATGGGCTCAGCCTGACCGCCTCCGGGATGGATTTGTTGCACCAGTCGGTGGGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCTCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTGTCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTCTAAGCCCAATGGGCACCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGA
  5   1   2       bld Ga15      out                      XL447c16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATATCCCGCGACCCCCAGGAAACAGAGGAGGGAAAGGACCACTTTTACCAGGGCCCAANTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTT
  5   1   2       bld Em10      in                    IMAGE:7981824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAAGGACCACTTTTACCAGGGCCCAACTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCAGAGTCCAGGTCTGGTTCAAAAACCGCAGAGCAAAGTGCCGgcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGAGACCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGAGAGTGGCACCAGCGGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAGCTCTCTGGACCTGGAGCTACTTTAAGCCCAATGGGCACCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTACCTTGGGTTTTATTCCACTGACTGCCTGGATTACAAGACCAACTGCCTCCTGGAGCTGAACTTCATGCTGACTGCTTGGTTATAAGACCAAACCTCTCTTGGAAATTCAGGTTTGTGAGAAA
  5   1   2       bld Ga15      in                       XL517i06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCCCANCTGGATATCCTTGAAGCACTTTTTGCCAAAACTCGTTACCCTGATATCTTCATGAGAGAAGAAGTGGCTCTAAAAATCAACCTACCTGAGTCCANAGTCCAGGNCTGGTTCAAAAACCGCANAGCAAAGTGCCGGCAGCANCAACAGCAGCANCANAATGGAGGCCAAAACAAAGTGAGACCTTCTAANAANAANACCTCTCCTGTTANANAANTGAGCTCGGANAGTGGCACCANCGGCCAATTCANCCCACCTANCANCACGTCTGTTCCNNNCATCTCANNCANCACANCTCCTGTGNCCATCTGGAGCCCGGCCTCCNNCTCTCCTCTGNCCGACCCCCTGNCCNCATCNTCT
  5   1   2       bld Ga18      in                       xlk53h01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCCAAAACAAAGTGAGANCTTCTAAGAAGAAGACCTCTCCTGTTAGAGAAGTGAGCTCGGNGNNNGCACCAGNGCCAATTCAGCCCACCTAGCAGCACGTCTGTTCCAGTCATCTCAAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTATCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAGCTCTCTGGACCTGGAGCTACTTTAAGCCCAANNNNNNCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTACCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCANGNTTTGTGAAGAACTTTCctctctctctctGTGTCAGGTGGAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCANGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAANNNNCAAACCTCATCTTGGNNNNNCCAGGTTTNTTANGAACGTTCTCTCTCTCT
  5   1   2       bld Ga18      in                        xlk8p19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCAGNGNCAATTCAGCCCACCTAGCAGCACGTCTGTTTCAGTCATCTCAAGCAGCACANCTCCTGTGTCCATCTGGAGCCCGGCCTCCGTCTCTCCTCTGTCCGACCCCCTGTCCACATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTNTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTCTAAGCCCAANGNNNNCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTATCTTGGGNTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCNAACCTCATCTTGGAAATTCCNNNNTTTGTGAAGAACTTTCctctctctctctctGTGTCAGGTGGAGANCTTTGCTGAGACANTCCTAGCAANNGCCAAACCTCATCTTGGAAGTTCCANGTTTTGTTAAGAACGNtctctctctctctctGTGTCAGGTGAAGAACTTTCCTGAGACANNACCNGCTCGGGCCAAACCTCATCTTGNAAGTNCNNNGTTTTATGAAGAACTTTCCCTCTCTCTCTGT
  5   1   2       bld Neu4                            IMAGE:3557306.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCATCTTCATGTATGCAGAGGTCCTACCCTATGACCTACACGCAGGCATCAGGGTACAGCCAAGGATATGCAGGCTCAACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGAGCCCTATGCATCATCAACTCTCTGGACCTGGAGCTACTCTAAGCCCAATGGGCACCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTAGCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCctctctctctctctGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACCTTGCTGAGACATTCCTA
  5   1   2       bld DMZ                                  xl221o24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATCAACTCTCTGGACCTGGAGCTACTCTAAGCCCAATGGGCACCAATGCAGTGACAAGTCACCTTAACCAGTCCCCAGTTGCCCTCTCCTCACAGGCCTATGGAGCTTCTATCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCctctctctctctctGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTtctctctctctctctGTGTCAGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACA
  5   1   2       bld Ga18      in                       xlk66n04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTAGCTTGGGTTTTAATTCCACTGACTGCCTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCctctctctctctctGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTGGTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGNCCAGGCTGTAGAGCAANTTNGGNNNGGTTNTGT
  5   1   2       bld DMZ       in                         xl282o01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGATTACAAAGACCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAAGCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCctctctctctctctGTGTCANGT
  3   1   2       bld Ga18      in                       xlk53h01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACAANTNNCCNTANCCAGTCCCNAGTTGCCCTNNNTNACAGGCCTANGNAGCTTCTACCTNGGGTTTTAATTCCNCTGACTGCCTGGATTACAAAGNCCAAACTGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGNNCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCCTCTCTCTCTCTGTGTCAGGTGGAGAACTTTCCTGAGACATGACCAGCTCGGGCCAANCCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTNTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTGGTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAATGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACCCAGGAGCACAGGACCCATAAGCTGTGGACCAGGCTGTAGAGCAATTTGGGGTTGGTGTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATA
  5   1   2       bld Ga15      in                       XL492i11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCATCTTGGAAATTCCAGGTTTTGTGAAGAACTTTCctctctctctctctGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTtctctctctctctctGTGTCNGGTGAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGG
  5   1   2       bld DMZ       in                         xl246i01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAGAACTTTCCTGAGACATGACCAGCTCGGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTG
  5   1   2       bld Ga18      in                       xlk53j13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTATGAAGAACTTTCCCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATTCCTAGCAATGGCCAAACCTCATCTTGGAAGTTCCAGGTTTTGTTAAGAACGTTCTCTCTCTCTGTGTCAGGTGGAGAACTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTCCTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGNATGCANNTGTGAACTCCACACCAGGNGGGGGGTCGTACTGTGNNTTANTNACAGGTTTATTATTAGCAGGANGNTTCAGGNATTTAGCNCAAAANNGATGCCCTTT
  3   1   2       bld Ga18      in                       xlk66n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCNTGNAANNNNCANNTTTNNTTANNNACGTTCTCNCTCTCNNNNTCAGNTGNNNACNTNGCTGAGACANATNCANNTCTGGCCNAGTCTGGTTGGAAGAANNNNNNANCAAANNAACACAANGNCCATTTATTTNNCCCACACAGNACCCTGGTCTAAGCTCTGGACTAGATCTGNAGNCCTCTCCATGCNAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGANNCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGNCCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTNNNGCAACTNNNGNAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTNNNNNTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACANCCATANCCTTTTCCCTGGNTCTGGCAAATANGTA
  5   1   2       bld Ga15      in                       XL516b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCACGCGNTCCGTTTTGCTGAGACATATCCAGCTCTGGCCAAGTCTGGTTGGAAGAAGCAATAAGCAAAACAACACAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACC
  3   1   2       bld Ga18      in                      xlk136o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTNCTGAGACANNNCCAGCTCNGNCAAGTCTCGTTGNAAGAAGNAATAAGCAAAACAACNNAAAGNCCNTTTNTTTNNCCCACACAGNNCCTGNTCTAAGCTCTGGNCTAGATCTGAAGNCCTCTCCATGCANNGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGNCCCATAAGCTATGGNCCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTNNNGNAACTNNNGNAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTATAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTNNNNNTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAANCCTTTTCCCCTGGATCTGGCAAATATGTANAAAAANA
  5   1   2       bld Ga15      in                       XL458p15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAGACCATTTATTTTACCCACACAGAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAATGACATTTTTTATCCAATGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACCCAAGAGCACAGCACCCATAAGCTGTGGACCAGGCTGTAGAGCAATTTGGGGTTGGTGTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTaaaacaaaacaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGtttttttttATCTGTGCTAGACTTCAAAACTGTGATGTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCG
  5   1   2       bld Ga15      in                       XL415n21ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAACCCTGGTCTAAGCTCTGGACTAGATCTGAAGACCTCTCCATGCAATGGAAAAAAGGACATTTTTTATCCAGTGACCAAGAGCCACACTAAGTCCTTATCTTGTTACATTTTAGCAGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCNAACCAACGCA
  3   1   2       bld Ga15      in                       XL492i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTTACATTTTAGCAGGNGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATA
  3   1   2       bld Ga15      in                       XL485m02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACATTTTAGGCAGGGTGGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATA
  3   1   2       bld Ga18      in                       xlk53j13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTACATTTTAGCNNNGNNAAAGATGGAGAAGAAATCAGNCCAACACAGGAGCACAGGACCCATAAGCTATGGNCCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAANCTCTGCTCTTTCATGNCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTNNNGNAACTNNNGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTNNNNTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAANCCTTTTCCCTGGATCTGGNAAATATGTA
  3   1   2      seed Ga15      in                       XL516b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGATAAAAGATGGAGAAGAAATCAGTCCAACACAGGAGCACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATC
  3   1   2       bld Ga15      in                       XL439m06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAAAAGATGGAGAAGAAATCAGTCCANCCCAGGAGCNCAGGACCCATNAGCTGTGGACCAGGGCTGTAGAGCAATTTGGGGCNGGNGTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCANTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATTTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGTCGTACTGTGATTTAATAACAGGTTTATTACTAGCAGGAAGATTCAGGATTTAGCGCAAANCCGATGCCCTTTAATCTTATTCCGACCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATNCAATCACACATCCATAAAC
  5  -1   2       bld Bla2                            IMAGE:7297854.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGATGACTCGAGAAGATTCAGCAGCATACTTTGTCTTGCGTGTAGTGGAGATCTCACCAGGCCGCCATAGTGGACAGTTAGACATTGGTGTGTATGTGTATGTGCTGAGATCAACTCTGTCTTCATGCTAGAAAGACATTCAGATTGAGTGAATGGCAAGGATTGTCCAAGAGCACTATTTATTTAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTaaaacaaaacaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGtttttttttATCTGTGCTAGACTTCAAAACTGTGATGTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCtttttttgttttgttttgTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAAATATTAAATGACTCTAGCACaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATCGCCCAAGATCCGG
  3   1   2       bld DMZ       in                         xl246i01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGGACCCATAAGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCGGAT
  3   1   2       bld DMZ       in                         xl304b16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCTATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCNTTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACC
  3   1   2       bld DMZ       in                         xl311p18.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGACCAGGCTGTAGAGCAATTTGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTNTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACC
  3   1   2       bld Ga15      in                       XL415n21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACCAGGCTGGTAGAGCAATTTTGGGGGTTGGTTTATGTGTGTATGTTGGCTGGAGACTCAAACTNTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTT
  3   1   2       bld Ga15      in                       XL458p15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAGAGCAATTTGGGGGGTTGGTGTANGTGGGGTATGTTGGNNGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGNGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAAACAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGTTTTTTTTTATCTGTGCTAGACTTCAAAACTGTGATGTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAAT
  3   1   2       bld Ga15      in                       XL517i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGAGCAATTTGGGGNTGGTTTATGNGTGTATGTTGGCTGGAAGACTCAAACTCTGCTCTTTTCATGGCTAAGAAAGAACATTTCAGGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCT
  3   1   2       bld Ga18      in                        xlk8p19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTANNTNNGTATGTTGNCNGGAGACTCAAACTCNGNTCTTTCATGGCTNAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTNNNAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGNCTTCAAAACTGTGNTCTCTTGTATTGTATGCAACTGTGANCTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTNNNGNAACTNNNGNAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGNTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAANCCTTTTCCCTGGATCTGGNAAANAT
  3   1   2       bld Em10      in                    IMAGE:7981824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTTGGCTGGAGACTCAAACTCTGCTCTTTCATGGCTAAGAAAGAACATTTCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATTTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGTCGTACTGTGATTTAATAACAGGTTTATTACTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGACCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTTGTTTTGTTTTGTCCCTGACCCTGATTTAATTGCAACAAGAAAGCGCCTTGTCCTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACATCCCTAAACCTCTCCCGCAAAGCAAAAACGCATCTTGTGCAATAAATCAA
  3   1   2       bld DMZ       in                         xl282o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGCTAAGAAAGAACATTTNCAGGATCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTATAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTCCCC
  3   1   2       bld DMZ       in                         xl320m23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCTGAGTGAATTGTGCAACGGATTGTCCAAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCNTTATGTAGTTTTTAAANCAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCNTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCNTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTATAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTGTGTTTTGTTTTGTCACTGACCTTGATTTAATNGCAA
  3   1   2       bld Ga12      in                         XL177p16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAGATGCACTATTTTATTTAAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCC
  5   1   2       bld Gas3      in                      xlnga003c15.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGAAAACAAATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCtttttttgttttgttttGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCT
  5   1   2       bld Ga15      in                       XL417o24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCtttttttgttttgttttGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAAATATTAAATGACTCTAGC
  3   1   2       bld Ga15      in                       XL417o24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATTAATAATGTTTATAAGAATCCATTATGTAGTTTTTAAAACAAGACAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTT
  3   1   2       bld Ga15      in                       XL441n17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGTTTTTAAAACAAGNCAAAAAAAAAGACAATCAATGTGTGTCTTCTATCAATGGTAAATTTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGTCGTACTGTGATTTAATAACAGGTTTATTACTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGACCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACATCCATAAACCTTTTCCCCCTGGATCTGGCAAAT
  5   1   2       bld Ga15      in                       XL441n17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGTTTTTAAAACAAGACaaaaaaaaaGACAATCAATGTGTGTCTTCTATCAATGGTAAATTTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGTCGTACTGTGATTTAATAACAGGTTTATTACTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGACCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATATCATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCttttttttgttttgttttGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACATCCATAAACCTTTTCCCCCTGGATCTGGCAAATATGTATAAAAAATATTAAATGACTAGCACNANAAAAA
  3   1   2       bld Gas3      in                      xlnga003c15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGGCCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCCTGGATCTGGCAAATATGTATAAAAAAATATTAAATAACTATAGCACAAACAAAA
  3   1   2       bld Neu7      in                         XL026f01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAATCAATGTGTGTCTTCTATCAATGGTAAATCTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGGTCGTACTGTGATTTAATAACAGGTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATCTTATTCCGAGCGAGCGCATGGGCCTGTGCGCAACTGTGCGCAATTGTGCGCAACTGCAGTTCAACCTTTCTTTTCCTCGACCGATTCCTCTTGAGTTTATTTTATATTCGAACCAACGCAGTTACGCAGGGACTGGAAGCCGCAATGTAGAAAAGAACAGGACAAATGATTATTATTTAATAACTAAAAGCCTTTTTTTGTTTTGTTTTGTCACTGACCTTGATTTAATTGCAACAAGAATGCGTTTTTGCTTTGCCTTTGTGAATTAAGATATAAATATATATTTATACAACACACAGCCATAAACCTTTTCCCC
  5   1   2       bld Ga15      in                       XL439m06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATCAATGTGTGTCTTCTATCAATGGNAAATTTGTGGTTTTTTATCTGTGCTAGACTTCAAAACTGNGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGGAGGGGGTCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)