Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7980522.5.5                    52 PI      89         15     1206                (no blast hit)
     2   0.0    0Xl3.1-xl278k15.5                           22 PI      89        212      497                Xsox17-beta protein [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:4175390-IMAGp.5                 5 PI      80        240      474                xSox18beta protein [Xenopus laevis]
     4   0.0    0Xl3.1-IMAGE:7295756.3                       4 PI      82         62      497                (no blast hit)

 This cluster: approximate FL confidence score = 95%

 1012769073 Xl3.1-xlk136o13ex.3 - 49 ESTs
                                                                       ....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xl3.1-xlk136o13ex.3                                   AGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTGTTTTTTTTATTTTGCACTTTTATAAATAAACATTAAAATATCAAAAAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686710                                         TTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTGTTTTTTTTATTTTGCACTTTTATAAATAAACATTAAAATATCAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                        8     9    12    12    15    17    16    19    17    19    17    19    17    19    17    19    16    19    16    19    16    20    16    20    16    19    16    19    16    19    16    19    16    19    16    19    17    20    16    20    17    20    17    20    18    20    18    20    18    20    17    22    18    22    18    22    18    22    17    22    16    21    16    21    17    21    16    21    17    21    16    21    16    21    16    21    15    21    16    21    15    20    14    19    14    19    14    19    14    19    17    22    17    22    17    22    16    22    17    22    17    22    17    21    15    21    17    21    16    22    16    23    14    22    13    20    11    19     7    14     6    12     6    13     7    14     6    13     7    13     6    14     7    14     9    14     7    16    11    18    14    18    14    18    15    18    14    18    16    19    16    19    12    19    15    19    16    20    16    20    15    20    18    21    21    24    18    25    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    23    24    24    24    24    24    24    24    24    24    24    24    24    24    23    24    24    24    23    24    23    24    23    24    22    23    22    23    22    23    22    23    22    23    22    23    22    23    22    23    22    25    22    25    22    25    22    25    21    26    22    25    25    25    25    25    23    25    24    25    23    25    23    25    21    25    16    21    11    12     7     8     5     7     4     6     3     3
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AATGAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTTACTGATCAAAATGACTTTGAT
                                                                   SNP                                                           --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------T-
                                               BLH ATG      71    1024                                   
                                               BLH MIN      65     140                                   
                                               BLH OVR      71     154                                   
                                               EST CLI     -11      81                                   
                                               ORF LNG      71      11                                   
  5   1   2       bld Emb4 5g                         IMAGE:4203277.5p CACGCGTCCGCCCACGCGTCCGCTCGCCGCTGAGCGGGAGCTTTGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGCCCAGCCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGGCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTACAGAAGCAAAGCCGAAACTCGGATCCGCCGACCTATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAGGCAGAGAGGCTGAGGGTGCAGCACATGCAGGACCACCCCAACTACAAGTACAGACCCCGCAAGAGGAAACAGGTGAAGAGGATGAAAAGGGCA
  5   1   2       bld DMZ  5g3  in                         xl339k09.5p                       CGCCGCTTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAAG
  5   1   2       bld Em10 5g                         IMAGE:8321995.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAATAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGGATTGGCTGAAGCAGATCCTGTG
  5   1   2       bld Em10 5g                         IMAGE:8317757.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCAGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTNCACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAAACCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAG
  5   1   2       bld DMZ  5g3  in                         xl334k09.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGG
  5   1   2       bld DMZ  5g3  in                         xl335k09.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGNAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAAGC
  5   1   2       bld DMZ  5g3  in                         xl336k09.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACC
  5   1   2       bld DMZ  5g3  in                         xl337k09.5p                        CGCCGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAG
  5   1   2       bld Emb9 5g                         IMAGE:7977665.5p                           CGCTGAGCAGGAGCTTTAGGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAATAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGGTACAGGTTACCCACCTCCTGAGAGCTCCCCTCTGGATTTTGGGCTGA
  5   1   2       bld Em10 5g                         IMAGE:8318300.5p                                          TTAGGAGCAGCCAGTGACCAGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAG
  5   1   2       bld Ga18 5g3  in                      xlk136o13ex.5p                                           TAGGAGCAGCCAGTGACCTGCAGCAATCNCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGNTACGGNGCGACGATCAGAATCAGGGAAAGNGCTCAGTACCAATAATNATGAGTGG
  5   1   2       bld Ga14 5g                             Ga14-p7c4.5p                                             GGAGCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGGAAGGCTC
  5   1   2       bld Tbd2 5g                         IMAGE:3201353.5p                                                CAGCCAGTGACCTGCAGCAATCGCATTAGTATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGATGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCATGAGGAAACAGGTGAAGAGGATGAAGAG
  5   1   2       bld Tbd2 5g                IMAGE:3201353-IMAGp.IMAGp                                                GCAGCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGT
  5   1   2       bld Em10 5g3  in                    IMAGE:7982035.5p                                                GCAGCCAGTGACCAGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTTCTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACC
  5   1   2       bld Em10 5g                         IMAGE:8319937.5p                                                   GCCAGTGACCTGCAGCAATCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAATAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTTCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTAGATGGGTACAGTTTACCACTCCTGAGAGCTCCCTCTGGATTTGCTGAGCAGATCTGTGTCTTCACTCTCAGCCCAGACGATGCCGATGATGCCTAAGCTTCACTCAGCTAATTCACACACACTCTG
  5   1   2       bld Ga18      in                       xlk67d19ex.5p                                                        AGCCAGTGACCTGCAGCAATCNNAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACNNNGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGNNNNNTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCNANNNNAGGGTCGGATCCGCCGACCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGANCACCCCAACTACAAGTACAGACCCCGCANNGGNAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGANNNNNTTATGGGCACTGATGGAAGGATGTNCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAANCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCNGAGAGCTCCCCTCTGGATTTGGCTGAGNNAGATCCTGTGTNNTCACATCTNNAGCCCAGGNCGAGNNNCAGATGATGCCNA
  3  -1   2       bld Bla2      in                    IMAGE:7296290.3p                                                                     TCGCAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTACGGCAGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGTGCCAGTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGCCAATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCCACCCCCACTACAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAAGCGCAGGANAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTGGGTTTCATGAACAGACTTACCCCAGCTTCCCAAGGCAG
  5   1   2       bld Ga18      in                        xlk8n04ex.5p                                                                       GCAATCNNAATAGATTCTTCTCCTGTCCAACCCTCCTCATCATGAGCAGCCCTGATGGTGGCTANNNNGCGACGATCAGAATCAGGGAAAGTGCTCAGTACCAATAATGATGAGTGGACTCGGGCAGNNNNNTGGTCCGAACCCATGACTTCTCTCGGGGAGGGGAAACTGAAAAGCGATGNCAATTCCAGAAGCANNNNNAGGGTCGGATCCGCCGACCNTGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGNAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGANCACCCCAACTACAAGTACAGACCCCGCANNGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCNNNTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGNTCCTCATTATGATGGGNACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAG
  5   1   2       chi Brn1                            IMAGE:4740338.5p                                                                                                                                                         GACTACCCTGATGGGATCCTACAGCTGGACAGAGAGCCTGGACTGCTCCCCCATGGATGGAGACCTCTCAGATGGGCTGTCCCCGCACAGGTTCTTTCCTGAGAGAAGGGGTCTTTTTACTCGTTTCCGAAGACCCATGAACGCCTTTATGGTGTGGGCTGGGGACGAGCGGAAAAGGCTAGCCGTGCAGAATCCAGACCTGCACAATGCGGAGCTCAGCAAGATGCTCGGGAAATCCTGGAAAGCCCTCTCTCCAGCCCAAAAGAGGCCCTATGTAGAAGAGGCAGAGAGACTGAGGGTCCAGCATATGCAAGATTATCCCAACTACAAGTACACGCCAAGGAGAAAGAAGCAAATAAAGAGGATCTGTAAACGGCTAGACACTGGTTCTCTGCTCGGCGGCTTATCGAAAGATCAGAATCCGGTGCCACACACCACGGGGCGCAGGACCGGCACGGCCAAAGAGGAGAATGGT
  3  -1   2      shim Bla2      in                    IMAGE:7296214.3p                                                                                                                                                                                                                                                          AATTCCAGAAGCAAAGCCGAGGGTCGGATCCGCCGACCCATGAATGCCTTTATGGTGTGGGCAAAGGACGAGCGCAAGAGGCTGGCGCAACAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGCAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCGCAGTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTCAACTCCAGCTACACTCACCAGCACAACTCTGGGCCTCTATGTGGTAGGCAATGCCCAACTGACAATAGTGAGGCATCAGTGAGGTAGATGCTGCAACTCCACCTGTCATGACGAGACTGCAGTCACAGATACAGACCAGTGGACTCCTCCGAGTACATGGCACATACACGTATAGAGAGGATAGTCCTGTAACGGATCGAGCTACTTTCT
  5  -1   2       bld Bla2                            IMAGE:7299379.5p                                                                                                                                                                                                                                                                                                                                    GTGGGAAGAAAGATACAAAggggggggCGCCCCCTTTGGGAGAAAACCTCACAAAAGGGGTGTCCCCCAATTTTTgggggaggggcaggggggcAAACCCCCCTAAACCGTTTAAATTTTGCAATGGAGGTTTACCGGCAGAACCCCTTTGGGAAACAAAGGTGGGTCACAATCAACCCACCCAATAAAATAAGCCCCCAGAGAAACTGGAAAGGATAAGGGCAGAGAACGCTTCTTCCCTTCAGAAGCGCAAAAGCGCAGTATGGCATGATGAAGATGTGCCGGAGACTTCAATTGGTTTCATGAGCAGACTACCCCCAGTTCCCCAGGCCAGCCATTACAGGGACCCCAAGCCATGGCTCTACATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGATTGGGCTGAGGCAGATCCTGTGTTCTTCACATTTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTNTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTTTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgtgcttttaaatcatttttatacattgttttttttattttgcacttttataaataaacattaaaatttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCCAAGATGG
  5   1   2       bld Ga18      in                      xlk108f14ex.5p                                                                                                                                                                                                                                                                                                                                      CGCAAGAGGNTGNNNNNCAGAACCCCGACCTGCACAACGCCGAGCTCAGCAAGATGCTTGGAAGTCGTGGAAGGCTCTGAGCCTGGCAGAGAAGCGGCCCTTTGTGGAGGAAGCAGAGAGGCTGAGGGTGCAGCACATGCAAGACCACCCCAACTACAAGTACAGACCCCGCAGAGGAAACAGGTGAAGAGGATGAAGAGGGCAGAGAACGGCTTCATGCACATGACAGAGGCGCAGGAGAGCNNNTTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGNAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGNAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGNCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCANCAGCACCCCCAGGCTGGNNAGNCTTNCCCCTCCCCCCGAGGCTCANNAGTTGGNCAGNNNNATCAAANCCNANC
  3   1   2       bld Ga18 5g3  in                      xlk136o13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GNAGTTANGGGNNCTGATGNAAGGATGTGCCTGGANAACTTCAACTTGGGTTNCNATGAGNAGNCTTNCCCCCAGCTTCCCCAGNCNAGNCACTACAGGGNACCCCAANCCATGNCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGANCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATNNCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGNCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATNCCAGANCTCCCCACACATGTACTATGGACAGATGTACCTNNCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGNCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAnTCATTTTTATACATTnTTTTTTTTNT
  5   1   2       bld Ga18      in                       xlk68i11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTATGGGCACTGATGGAAGGATGTGCCTGGAGAACTTCAACTTGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGNAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTNGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCANNNNNATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGNCGTTTCAGGCTANNG
  3   1   2       bld Ga18      in                       xlk68i11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTATGGGCACTGANGNAGGATGNNCNNGNAGACTTCNNCTNGGTTNCCATGAGCAGNNTNNNNCCAGCTTCCCCAGGCCAGCCNCTACAGGGNACCCCCAANNCATGGCTCCTCATTATGATGGGTACAGTTNNCCNACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATNNCCTACAGCTACAACTCCANCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATNCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTNCCAGGCTCTACCAGGCATCACCAGCACCCCCAGNCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGNCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTGTTTTTTTTAT
  5   1   2       bld Emb1                            IMAGE:6866279.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCGGGTTTCCATGAGCAGACTTACCCCCAGCTTCCCCAGGCCAGCCACTACAGGGAACCCCAAGCCATGGCTCCTCATTATGATGGGTACAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATGCCCTACAGCTACAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGGCTCAGAATGTnnnnnnnnnnnnnnnnT
  3   1   2       bld Ga18                             rxlk106i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNCCATGGCTCCNNATTATNNNGGGTACAGNTTACCCNCTCCTGAGANCNCCCNNTNNATTTNGCTNNGCAGANCCNNNNNTCTTCNNNNCTCCANNCCAGGACGAGTGCCAGATGATGCCCTANAGCTACAACNCCANCTANACTCACCAGNNCAACTCTGGCGCCTCTATGTTGGNNNGCAGATNNCACAANCTGAGCAAATAGGTCAAGGCAGTCCAGTGGAGGGTATGATGGCATNNCAGANCTCCCCACACATGTACTATGGACAGATGTACCTNNCAGGCTCTAACAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGNNAGAGCAGATCAAACCCAACAGGCTGACATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGCATTACCACGGGCAGGAATCAGTGGTNCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATACCCTATTCACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAACAAAACCTGACTCTGTGTCTTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACTGGGCAGTAACAAATGAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTTACTGATCAAAATGACTTTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATnnATTGTTTTnT
  3   1   2       bld Ga18      in                       xlk67d19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCATTNNGATGGNTNNAGTTTACCCACTCCTGAGAGCTCCCCTCTGGATTTGGCTGAGGCAGATCCTGTGTTCTTCACATCTCCAGCCCAGGACGAGTGCCAGATGATNCCCTACAGCTACAACTCCANCTANNCTCNNNAGCACAACTCTGGNGCCTCTATGTTGGTAAGGNAGATGCCACAANCTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATNCCAGANCTCCCCACACATGTACTATGGACAGATGTACCTNCCAGGCTCTACCAGGCATCACCAGCACCCCCAGNCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGNCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTG
  3   1   2       bld Ga18      in                      xlk108f14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCNCCAGNCCAGGACGANTGCCAGATGATGCCCTACAGCTANAACTCCANCTANACTCACCAGNACAACTCTGGNGCCTCTATGTTGGTNAGGNAGATNNCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATNCCAGANCTCCCCACACATGTACTATGGACAGATGTACCTNNCAGGCTCTACCAGGCATCACCAGCACCCCCAGNCTGGGCANNCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGNNAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGNCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTAT
  3   1   2       bld Ga18      in                        xlk8n04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGCCCAGGNCGANNNCNAGNTGATNNCCNACAGNTANAACNCCAGCTNNNCTCACNAGNNCAACTCTGGCGCCTCTATGTTGGTAAGNNAGATNCCACAANCTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATNCCAGANCTCCCCACACATGTACTATGGACAGATGTNCNTNNNAGGCTCTACCAGGCATCACCAGCACCCCCAGNCTGGGCANCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGNAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGNCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGANNCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAANTCATTTTTATACAT
  5  -1   2       bld Bla2      in                    IMAGE:7296214.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGCCTACAGTACACTCCAGCTACATCACCAGCACACTCTGGCGCTNTATGTTGTAGGCAGATGCACNAACTGAGCAAATAGTGAAGGCAGTCCAGTGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATGCAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgtgcttttaaatcatttttatacattgttttttttattttgcacttttataaataaacattaaaatatcaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCAATCGCCCATGAAGTT
  3   1   2       bld DMZ  5g3  in                         xl334k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAACTCCAGCTACACTCACCAGCACAACTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAANCGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACCATTGTTTTT
  3   1   2       bld DMZ  5g3  in                         xl335k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACTCACCAGCACAANTCTGGCGCCTCTATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATA
  3   1   2       bld Em10 5g3  in                    IMAGE:7982035.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTTGGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATGCAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCCATTTTTATACGATTTGC
  3   1   2       bld DMZ  5g3  in                         xl339k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATGTTGGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTNTNATTTTTGTGCTTNTAAATCATTNT
  3   1   2      seed DMZ  5g3  in                         xl336k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGTAAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACAT
  3   1   2       bld DMZ  5g3  in                         xl337k09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCAGATGCCACAAACTGAGCAAATAGGTGAAGGCAGTCCAGTGGAGGGTATGATGGCATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTNAAATCATTTTTATACAT
  5  -1   2       bld Bla2      in                    IMAGE:7296290.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATGCCAGAGCTCCCCACACATGTACTATGGACAGATGTACCTGCCAGGCTCTACCAGGCATCACCAGCACCCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgtgcttttaaatcatttttatacattgttttttttattttgcacttttataaataaacattaaaatatcaaaaaaaaaaaaaaaaaaaaaaaaaCTCGAGGGGGGCCCGTACCCATTCGCCTTAGATGGGATG
  3   1   2       bld Unk4                                726_21M07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGGCTCTACCAGGCATCACCAGCACCCCAGGCTGGGCAGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTGTTTTTTTTATTTTGCACTTTTATAAATAAACATTAAAATATC
  5   1   2       bld Ga12      in                         XL191f07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCCTTCCCCTCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCTGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgtgcttttaaatcatttttatacattgttttttttatttt
  3   1   2       bld Ga12      in                         XL191f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGCCTTCCCCTCCCCCCCGAGGCTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCTGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATACATTGTTTTTTTTATTTTGCACTTTTATAAA
  3   1   2       bld Ga18      in                      xlk106e16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCACGCGTCCGGTTGGNNAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATNCATT
  3   1   2       bld DMZ       in                         xl322p04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATAC
  5   1   2       bld DMZ       in                         xl322p04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTCAGCAGTTGGGCAGAGCAGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTtttgtgcttttaaatcatttttatacattgttttttttattttgcacttttATAAATAAACATTAAAATATCATCCTA
  5   1   2       bld Ga18      in                      xlk106e16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGGCNGAGNGATCAAACCCAACAGGCTGATATGATGGCAGAGGACAGGACTGAATTCGAGCAGTATCTCAGCTATGTGTCTAAGTCAGACCTGGGCATGAATTACCACGGGCAGGAATCAGTGGGGCCTACTGCAGACAATGGGCCCATCTCTTCTGTCCTTTCCGATGCCACTACTGCTGTATATTACTGCAACTACCCCAGTGCCTGAGCCCATGCCCTATTCACACACACACCTCATTATTGGGGGCCTAGTCGTTTCAGGCTAGAGAGAGTTTCCAGGGGAAGAAAACCTGACTCTGTGTCTTATTATCTTATTGACTCTCTAATTTATGTAACTTATTTTCCATACAACGGGGTCGGTAACAAATTAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTGATCAAAATGACTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGNACACTGcttttatttttgtgcttttaaatcatttttatacattgttttttttATNTTGCACTTTTATNNNTAAACATTAAAATATCaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk163f22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGTAACAAATGAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTTACTGATCAAAATGACTTTGATCTCGATATTTTCATTGAATGCAATGTGAAACGGTGTGATTATTGTGTACGTGGTACACTGCTTTTATTTTTGTGCTTTTAAATCATTTTTATnnATTGTTTTT
  5   1   2       bld Ga18      in                      xlk163f22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTAACAAATGAAATATTGTCTTCCTTTAGGACGAAAGAACTGGCTCCAGACTTACTTACTGATCAAAATGACTTTGATCTCGATATTTTCATTGAATGCAATGTGAAANGGTGTGATTATTGTGTACGTGGTACACTGCttttatttttgtgcttttaaatcatttttatacattgtttttttttttGCACTTTTATAAATAAACATTAAAATATAATCCTGaaaaaaaaaa
  3   1   2       bld Ga18                             rxlk155g10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGGCTCCAGNCTTNCTGATCAAAATGACNGATCTCGATATTTTCATTGAATGCAATGTGAANCGGTGTGATTATTGTGTNCGTGGTACNCTGCTTTTATTTTTGTGCTTNNAAATCATTNNTANNCATTGTTTTTTTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)