Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xlk159i20ex.3                        22 END     15         18       68                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xlk159i20ex.3                        22 PI      81       1808     2232                (no blast hit)

 This cluster: approximate FL confidence score = 93%

 1012769085 Xl3.1-546_12E18.5 - 79 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xl3.1-546_12E18.5                                        GAGCTGCAGCTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGCTTGGAACGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCATGTTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATG
                                                  Xl3.1-CHK-1012685865                                              CAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCATGTTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATGCACGAA
                                                      consensus depths                                            11    20    25    28    29    30    32    32    32    32    31    33    31    33    33    33    33    33    33    33    33    33    32    33    33    33    33    33    32    33    33    33    34    34    34    34    33    34    34    34    34    34    34    34    34    34    34    34    34    34    34    35    35    35    35    35    35    35    35    35    35    35    35    35    36    36    37    37    37    37    37    37    37    37    36    38    38    38    37    38    38    38    37    37    36    36    35    35    36    36    36    36    36    36    30    36    32    35    33    35    31    36    32    35    31    35    29    34    22    29    26    29    29    30    18    30    25    26    20    25    13    21    14    20    12    15    12    15    12    14     6    11    12    13    11    14    13    14    11    13     7    13    11    13    11    11    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11     9    11    11    11    11    11    11    11    10    12    10    12    11    11     9    10     6     9     9     9     9     9     9     9     9     9     9     9    10    11    10    13     9    12     9    12    10    13    10    13     9    12     8    12     6    12     8    12     6    12     5    12     5    12     5    12     5    11     6    12     6    13     6    13     6    13     6    17     7    19     8    21     8    21     8    21     8    21     8    20     8    24     9    26    10    26    10    26     9    26    11    26     9    24     9    24     9    24     9    24     8    24     9    24    10    25    10    25    10    26    10    26    15    25    17    27    17    27    17    27    18    27    18    27    24    27    25    28    25    28    26    29    26    29    26    28    26    28    27    29    26    29    27    29    27    29    27    29    27    29    27    29    27    29    25    29    26    29    25    28    25    28    25    27    25    27    26    29    27    28    27    28    26    28    27    28    27    28    27    28    27    28    26    28    26    28    25    28    24    28    24    26    23    26    23    26    22    25    22    24    22    24    22    23    21    23    12    17     4     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGGCTTGGTAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACCTAGGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCTAACTGCAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTG
                                                                   SNP                                                                --A---------
                                                                   SNP                                                                                        --G--------C
                                                                   SNP                                                                                                                --C--------G
                                                                   SNP                                                                                                                            --------C---
                                                                   SNP                                                                                                                                        -----T-C----
                                                                   SNP                                                                                                                                                                -----T------
                                                                   SNP                                                                                                                                                                            ---------T--
                                                                   SNP                                                                                                                                                                                        C-------C---
                                                                   SNP                                                                                                                                                                                                    -----G------
                                                                   SNP                                                                                                                                                                                                                --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                            --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -------A----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---A-----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------TA---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --G----C----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --A--------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                G-----------
                                               BLH ATG      18     673                                        
                                               BLH MIN      18     138                                        
                                               BLH OVR      18      93                                        
                                               EST CLI     -12      60                                        
                                               ORF LNG      18       6                                        
  5   1   2       bld Ga15 5g3  out                      XL430o18ex.5p CCCACGTCGTCCGCCCACGCGCTCCGCAAGAAACCTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAG
  5   1   2       bld Neu4 5g                IMAGE:3556825-IMAGp.IMAGp                GAATTTCCCCGCGGAGAACCTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGATCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTATTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAAACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAG
  5   1   2       bld Emb1 5g                         IMAGE:6636005.5p                   CCACGCGTCCGGAAACCTCGAGAGCTGCAGCTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGNGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGGAAGGAGAGAATTTGTCTCAGTAAAACAATCAGCCTGATGGACCAATTAATGCCCCCTACCAAATGGTACCTATGGCACCCAACTTCAAACAGAACAAAGCCTTTGGTAAATTAGTTAC
  5   1   2       bld Emb1 5g                IMAGE:6636005-IMAGp.IMAGp                           GAACGAAAGGGCTGGCACGCTTTGATTGAGATAGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAG
  5   1   2      seed Unk3 5g                             546_12E18.5p                            AAGAAACCTCGAGAGCTGCAGCTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGACCAATTAATGCCCCTACCAAATGTACCTATGGCACCAACTTCAAAC
  5   1   2       bld Ga15 5g                            XL430o14ex.5p                             AGAAACCTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAANAATGCNCCTCCNGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAANATCTCAAGCCCTCAAAAGACTGTTGGAAGTGNTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCANCCACCTCANTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCGGGAGTNTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCANAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGG
  5   1   2       bld Ga18 5g3  out                     xlk145g20ex.5p                             AGAAACCTCAAGAGCTGCANNTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAANTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGNNAGAGATCACCATGAAAGCAAACAGNCCATGCTGG
  5   1   2       bld Ga18 5g3  out                     xlk149b05ex.5p                             AAGAAACCTCAAGAGCTNNNNNNGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAANTGTCTCAGTAAACAATCAGNCTGATGNNCAATTAGTACCCTTACCAAATGGNCCTATTGCACAAACTCCAAACAGAACAAGGAGNATTAGATCTGTAGAAGAAGATGGACAAC
  5   1   2       bld Ga18      out                     xlk102e17ex.5p                             AGAAANCTCAAGAGCTGCAGNTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTNTTTTCTATAANCCAGGCTGTCCGAGTTTGGAACGATGAAAGTNCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGANGAGNACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGCC
  5   1   2       bld DMZ  5g3  out                        xl310o03.5p                             AGAAACCTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGA
  5   1   2       bld Neu4 5g3  out                   IMAGE:3557226.5p                              GAAACCTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGATCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTATTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAAACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTNTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTTGGACGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATTCTGCAGAGATCACCATGAAAGCAAACCAGCCATGCTGGTTCTATTCACTGAG
  5   1   2       bld DMZ  5g3  in                         xl318l15.5p                              GAAACCTCGAGAGCTGCAGCTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTA
  5   1   2       bld Ga18 5g3  out                     xlk152d22ex.5p                               GAAACCTCAAGAGCTNNNNNTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTNCTAATCATGGCATTCTTGTAACTGTNCGAAANTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGNTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGA
  5   1   2       bld Ga18      out                     xlk116p05ex.5p                               AAACCTCAAGAGCTGCAGNTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTNGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTNATCATGGCATTCTTGTAACTGTCCGAAANTTGGGAGGNGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCANCATGAAAGCAANCAGCCCAT
  5   1   2       bld Ga18      in                      xlk147o20ex.5p                               GAAACCTCGAGAGCTGNNNNTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGNNCAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCNATGCTGGNNNNATTCACTGATGANG
  5   1   2       bld Ga18      in                      xlk146l01ex.5p                                AAACCTCGAGAGCTGNNNNNGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTNCTAATCATGNCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGNTGATCCAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGNCCATGCNNGNTCTATTCNCTGATGANG
  5   1   2       bld Ga18 5g3  in                      xlk124c13ex.5p                                AAACCTCGAGAGCTGNNNNTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGNNTNTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNGNTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTNTCCGAAATCTGGGAGGAGNACAAGTTGATCCAAACATCATCCGTTTTGCATCTNGNAGAGATCA
  5   1   2       bld Ga12 5g3  out                        XL218h20.5p                                   CTCAAGAGCTGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAACTAGAAGATCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTATTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCC
  5   1   2       bld Ga18 5g3  in                      xlk124f12ex.5p                                     CGAGAGCTGCANNTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNGTTTTCTATAACCCAAGCTGTCCGAGCTNNGAATGATGAAAGTGCTAATCATGGNATCCTTGTAACTGTCCNAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGNTTTNCATCTGGNAGAGATCACCATGAAAGNAANNNGCCCNTGCTGGTNCTNTTCACTGATGNNGGAAGGAGAGNANTTNTCTCAGNNA
  5   1   2       bld Ga18 5g3  in                      xlk151h04ex.5p                                      CGAGAGCTNNNNTNGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTNCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAANCAAACAGCCCATGCTNGNTCTATTCACTGATGATG
  5   1   2       bld Ga18      out                     xlk138a08ex.5p                                         GANCTGNNNNNGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTNCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGCCCATGCTGGNNCTNNTNCACTGATGATGGAAGGAGAGGAANTNTCTCAGNAAACNATCAGCCTGATGGC
  5   1   2       bld Ga17 5g                              DN828652.5p                                            TGCAGCTTGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTNCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGATCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTATTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGNTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGT
  5   1   2       bld Neu7 5g3  in                         XL040b24.5p                                             CGAGGGATGAGNATGGACCTTAGGNAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAG
  5   1   2       bld Ga15 5g3  in                       XL466k19ex.5p                                              CAGCTTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCCAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAAGCAANCAGCCCATGCTGGTTCTATTCACTGANTGATGGAA
  5   1   2       bld Ga12 5g3  in                         XL216i04.5p                                                 GCACGAGGGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGA
  5   1   2       bld Ga18 5g3  in                      xlk142n10ex.5p                                                  TTGATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACTAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGNNCAAGTTGATCNAAACATCATCCGTTTTGCATCTGGNAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTNCTATTCACTGATGATGGAAGGNGAGGAANTGTCTCAGTAAACNATCAG
  5   1   2       bld Neu7 5g3  out                        XL020o05.5p                                                   GGATGAGATGGACCTAAGGAAGATGTTGGGTTTTATATTGCTGTTTGTCATCATACAAGAATGCACCTCCAGGCCTACTGACATGGTGGATACTACTGACCTTGAATTAGAAGATCCTGAGCTAGTAAGATCTCAAGCCCTCAAAAGACTGTTGGAAGTATTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGT
  5   1   2       bld Ga18 5g3  in                      xlk131c11ex.5p                                                    GATGAGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGNACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGNTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGNNNTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGANGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAANCTGGGNGG
  5   1   2       bld Ga12 5g3  in                         XL217o10.5p                                                        AGATGGACCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGG
  5   1   2       bld Neu7      in                         XL035c11.5p                                                               GCTTAGGAAGATGTTGGGTTTTATATTTCTGTTTTTTATNATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAA
  5   1   2       bld Ga12      in                         XL188i05.5p                                                                           GTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCAACTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGA
  5   1   2       bld Ga12      in                         XL189i05.5p                                                                           GTTGGGTTTTATATTTCTGTTTTTTATCATACAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCAACTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGA
  5   1   2       bld Ga12                                 XL209c24.5p                                                                                                   CACGAGGCAAGAATGTACCTCCAGACCTACTGATATGGTGGACAGTACTGACCTTGAATTAGAAGACCCTGAGCTAGTAAGAGCTGAAGCCCTGAAAAGACTATTGGAAGTGTTTGGTATTGAGGAACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGG
  5   1   2       bld Ga18      in                      xlk127d12ex.5p                                                                                                                                                                                                                                AACCACCACAGCCTCTTCAGCATGTCAAGCAGCCACCTCAGTATATGGTGGACCTTTACAACACAGTAGCTGATGAAGATGGTGTAACCAAGGACCCAGACCTTCTAGAAGGAAATACAGTCAGGAGTTTTTTTGATAAAATTCACAGCGACCATATGCATTTCTTGTTTAACCTCTGGACTGTGGCCAGAAACGAGAAGATTCTAACAGCAGAACTTCATCTTTTTAAATTAAAACCAAGGCCTTCCGAGCAAGCTTACTTCAAAAGGCACCACTTCTGCCAGATAAGTGTCTATATGGTCCTAGATAAAAATAAGATACAGTTGCCACAAGGAAGAAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGACCAATTAATGCCCCTACCAAATGTACCTATGGCACCAACTTCAAACAGAANNAGGCTTNGNNGATCAGTAGAAGAAGATGGACAACTGCCA
  5   1   2       bld Ga15      out                      XL402j21ex.5p                                                                                                                                                                                                                                                                                                                                             AGGAAATACTGTCAGGAGTTTTTTTGATAAAATTCACAGTGACCATATGCATTTCTTGTTTAACCTCTCGACTGTGGCCAGAAACGAGAAGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCCACGGTGCAGTCTATCATTAATGCCC
  5   1   2       bld Ga18                              xlk127k16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATTCTAACAGCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGNCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGNGCAGNCTATCATTAATGCCCTCAAACTAACAAANGNNTTAGTAGNC
  5   1   2       bld Ga12      out                        XL216l21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGGAACTTCATCTTTTTAAACTAAAACCAAGGCCTTCTGAGCAAGCTTACTTTAAAAGGCACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGTGCAGTCTATCATTAATGCCCTCAAACTAA
  5   1   2       bld Ga18      out                     xlk159i20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCAAGCTTACTTTAAAAGGNACCACTTCTGCCAGATTAGTGTCTATCTGGTCCTAGATAAAAATAAAGTACAGTTGCCACAAGGAAGAAAACTGCTATCATCGAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAGGCTGTCCGAGTTTGGAACGATGAAAGTGCTAATCATGGCATTCTTGTAACTGTCCGAAATTTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGNCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGTGCAGTCTATCATTAATGCCCTCAAACTAACAAAAGGNGTTAGTAGCCTGTGCTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGACGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTNCCACTAAAAACATTTTGGACAAACACCGACAAATGGTGGCNCTGTCTAAGGNAAAACCTAGGGTAACCNATAGAAGACAGACCCCATGTTTNGNGAAANTCTGATANGCACTGTATTNCCAGTTGNTCTGCAA
  5   1   2       bld Ga18      in                      xlk123d10ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAACTGCTATCATCAAAACTTGTACCAATTCATTCTTCAGGATGGGAAGTGTTTTCTATAACCCAAGCTGTCCGAGCTTGGAATGATGAAAGTGCTAATCATGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGACCAATTAATGCCCCTACCAAATGTACCTATGGCACCAACTTCAAACAGAACAAGGCTTGGTAGATCAGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATAGGCTGGTCTGGATGGATCATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGTCCATTTCCTTTGGGTCAGAACATGAGGNCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGNGTTAGTAGCCCGTGTTGTGTTCCTGACAAACTTTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTG
  5   1   0       chi Ga12      in                         XL160i05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTAAAACAGGTCCGAGCTTGGAATGATGAAAGTGCTAATNTGGCATCCTTGTAACTGTCCGAAATCTGGGAGGAGCACAAGTTGATCCAAACATCATCCGTTTTGCATCTGGTAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGGTAAGACTACTCTTCTTAACGCAACTTTACATATATTTTTATTTTAACAAACACTCCTGATTCCACATATTAAAAAGAAACCATGATAATGTACCTATTTTCACAAGAATCAGTTCCCTTGTACCCCACAAATAATGTGACCCTTCCCTTATTTTGTTCCATTGTGATGGGATTGATTTTAGGACTTGAAAGTCCCTCTGCTTTCCATCACCCCGGAATCCATCACTTCAAAATGGAAAAATATATGGGTGCGGTTGCATTACACTGTGCATCTAAAGAATTTTGGTTTTCTTTGAATCTGTGGAATTAGGTATGTTTGTGTAAGAAAATCTGTTATTTTCTTCTGGAAGTTCAGATAGTGTTTATGCACCTTTTCTACATAAAAGCAATTGAATGAGCTCATGTCTAGGAGGGGAGGATAttttccttttcattttttGATACTGCATCTGCAGGTTTCAAATATTA
  5   1   2       bld Ga15                               XL422m15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTTGATCCAAACATCATCCGTTTTGCATCTGGCAGAGATCACCATGAAAGCAAACAGCCCATGCTGGTTCTATTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCCTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGTGCAGTCTATCATTAATGCCCTCAAACTAACAAAAGGTGTTAGTAGCCTGTGCTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGACGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGACAAACACCGACAAATGGTGGCGCTGTCTAAGGTAAAACCTAGGGTAACCAATAGAAGACAGACCCCATGTTTGGTGAAACTCTGATAAGCACTGTATTTCCAGTTGTTCTGCAACTGGGAGTTTCTGAGAACATGACTAGTACTGTATGTTTTATAGATCAAAAATACCAGTCATTTAGT
  3   1   2       bld Ga12      in                         XL188i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCACTGATGATGGAAGGAGAGGAATTGTCTCAGTAAACAATCAGCNTGATGACCAATTAATGCCCCTACCAAATGTACCTATGGCACCAACTTCAAACAGAACAAGGCTTGGTAGATCAGTAGAAGAAGATGGACAACTGCCGTGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATAGGCTGGTCTGGATGGATCATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGTCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCATGTTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAAC
  5   1   2       bld Ga12      out                        XL220a12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGATGGCCAATTAGTACCCTTACCAAATGGTCCTATTGCACAAACTCCAAACAGAACAAGGAGTATTAGATCTGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATTGGCTGGTCTGGATGGATTATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGCCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACGGTGCAGTCTATCATTAATGCCCTCAAACTAACAAAAGGTGTTAGTAGCCCGTGCTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGACGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGACAAACACCGACAAATGGTGGCGCTGTCTAAGGTAAAACCTAGGGTAACCAATAGAAGACAGACCCCATGTTTGGTGAAACTCTGATAAGCACTGTATTTCCAGTTGTTCTGCAACTGGGAGTTTCTGAGAACATGACTAGTACTGTATGTTTTATAGATCAAAAATACCAGTCATTTAGTTTTTATAATATGATTAAAAGTCTATAAAATACTGTACCTATAACTTGTAAATACTGAAA
  5   1   2       bld Ga12      in                         XL158a01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTAATGCCCCTACCAAATGTNCCTATGGCACCAACTTCAAACAGAACAAGGCTTGGTNGATCANTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATAGGCTGGTCTGGATGGATCATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGACCCTGTCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCGTGTTGTGTTCCTGACAAACTTTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGNTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGG
  5   1   2       bld Ga12      in                         XL157a01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCTACCAAATGTACCTATGGCACCAACTTCAAACAGAACAAGGCTTGGTAGATCAGTAGAAGAAGATGGACAACTGCCATGCCAGAGACATCCACTCTATGTAGACTTTGAAGAAATAGGCTGGTCTGGATGGATCATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGACCCTGTCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCGTGTTGTGTTCCTGACAAACTTTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTT
  3   1   2       bld Ga12      in                         XL189i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGGATGGATCATCTCTCCTAGAGGGTATAATGCTTACCACTGTAAAGGATCCTGTCCATTTCCTTTGGGTCAGAACATGAGGCCTACAAACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCATGTTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAA
  5   1   2       bld Ga18      in                       xlk52n15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACCATGCCACTGTGCAGTCTATCATCAATGCCCTCAAACTTACAAAAGGTGTTAGTAGCCCATGTTGTGTTCCTGACAAACTCTTCTCCATAAATCTACTCTACTTTGATGATGATGAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTNCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAANGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTNNCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGNAATAACTTATTTTGTAAATTNNTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTNNACTGGCATTTNAGATTCACCCATTGTCC
  5   1   2       bld Emb1                            IMAGE:6635527.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAAAATGTTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGCTGCGGGTGCCACTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGNGATGTATAGAAATCACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTTCTTTCCTGCCAATGGNGGTTTTTCTTTGCTTTTAACGTTTTGGTCCACAGGCAAAAATTT
  5   1   2       bld Ga18      in                        xlk2a01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTGTTTTGAAACAGTATGATGATATGGTCGCTGGCAGNTGNGGNNNNNNTAAAAACATTTTGGTCAAACACCTACAAATGGTGGTACTGTCTAAGGTGCAAACTAGGGAAACCCATAGAAACAGACCCCATGTTTGGTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGNCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGNAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTNCACTGNCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGNTACAGCAATAAAGCAATACCTAGTACCTAGCAAANTAGAATTGAACTAGAATTGATNNTTCTTTCTGCCANGNGNTTNNNT
  3   1   2       bld Ga18      in                      xlk147o20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATGATGANGAAANNTGTTTGAANANTANGATGANANGNTCGCNGGCAGCNNNNGNNNNCTAAAACATTNNGTNACACACCTACAAATGNTGGTACTGNCTANNNTGCAANCTAGGGAAACCNATAGAAACAGNCCCCATGTTNNNTGAAATTCTAAAAGCACTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGNTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATANCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGNTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATNCATTAAAATNTCATTTAT
  3   1   2       bld Ga18      in                      xlk146l01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ANNAAANGTNNNTTTGAANNNNTANGATGANNNGNNNNNGCAGCNNNNNTGCCNNNAAAANCNTTNGTNNNNNNCCTNNAAANGGTGGTNCTNTCTAAGGTNNAANNTANNNACCCATANNACAGNCCCATGTTTGGTNNAATTCTAAAAGCNNTGTATTTTCAGTTGTTCTGCAACTGAGANTTTCTGANNACTGGACTGTTANTGTTATGCTTTATAGATCAATAAGGCCAGTCATTTCGNTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTANNNCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATNNNCGAAGCT
  3   1   2       bld Ga18 5g3  in                      xlk131c11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNNCTNAAANCATTTTNGTNNACNCCTANNAANNGGTGGTACNNTCTAAGNNNNAANCTAGGGAAANCCATAGAAANAGNCCCCATGTTTGNTGAANNCTAAAAGNNCTGTATTTTCAGTTGTTCTGCAACTGAGAGTTTCTGAGAACTGGACTGTNANTGTTATGCTTTATAGNTCAATAAGGCCNTTCATTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAANCGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATTTTTTATNNCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNTNATTTATAT
  3   1   2       bld Ga18 5g3  in                      xlk142n10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCATNTTTGNTGAAATNCTAAAAGCACNGNNTTTTCAGTTGNTCTGCAACTGAGAGTTCNTGAGNCTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGTCANTTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGNCTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTANCTGCAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATNNCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNTCATTTATATNNAC
  5   1   2       bld Ga18      in                      xlk125d15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGAGTTTCTGAGAACTGGACTGTTAATGTTATGCTTTATAGATCAATAAGGCCAGNCATTTCGGTTTTAGNTTTTCAAAATATGATTACAAGNCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGNATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGNATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGNATCATTTATAGCCACCATGTGNC
  3   1   2       bld Ga18      in                      xlk127d12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GNANCTGANNNTTTCNGANNACTGGACTNNTNNNNNNATNCNTNNTAGAnnnnnnnnnAGTCATTTNNNTTTTANTTTTTCAAAATATGATTNNAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATNNCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATAT
  3   1   2       bld Ga18      in                      xlk125d15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNTTNATAGATNANNAAGGCCAGTCATTTCGNTTTTANTTTTNAAATATGATTACAAGTCTANAAAGGNCTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATANCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATAT
  3   1   2       bld Ga18 5g3  in                      xlk151h04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CANNAAGGNCAGTCATTTCGNTTTTAGTTTTCAAATATGATTNNAAGTCTATAAAGGACTGNNNCTANACATGTAANNACTGGAAGATAGTNTTAATGATCATATNNTTTCAGTCAGTATCTATAGAAAATACTGATATCTANCTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTNCTTCAGAAAGTATCATTTATANCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNNCATTTAT
  3   1   2       bld Ga18 5g3  in                      xlk124f12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGGCCAGTCNTTTCGNTTTTANTTTTCAAANATGATTACNANTCTANAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATNNNNCCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATAT
  3   1   2       bld Ga18      in                        xlk2a01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ANGCCAGTCNNTTCNGTTTTAGTTTTTCAAAANATGANTNCAAGNCTANAAAGGACTGTANCTNNNCATGTAAATNCTGNAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNNCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATANCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAANNTCATNTATAT
  3   1   2       bld Ga18 5g3  in                      xlk124c13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCNNTTCNNTTTTAGTTTTNNAAANNNANGATTNCNAGTCTATAAAGGACTGTATCTATAACATGTAAATNCTGGAAGATAGTATTNANNGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGNAACAATAAAATACANCCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATANCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNTCATTTATAT
  5   1   2       bld Ga18      in                      xlk152n03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCGGTTTTAGTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGNNNCNCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTNNTNCTCTTTGTAATATTTNTATATAAGNAAATTG
  3   1   2       bld DMZ  5g3  in                         xl318l15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGGTTTTAGTTTTTTCAAAATATGATTACAAGTCTATAAAGGACTGTATCTATAACATGTAAATACTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATTTTTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATAAAATATCA
  3   1   2       bld Ga18      in                      xlk152n03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCNNTTTTANTTTNNANANNANGATTACAAGNCTNNNAAGACTNNNTCTNNACNNGNAAATNCTGGAAGATAGTATNNATGATCATATTGTTTCAGTCAGTATCTATAGAAAATNCTGANNTCTAACTGNAANAATAAAATACAACCTAGTATCTCATGTATNCTGTCTGAAAGGGATGATAAGAATTGGANTNNCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAANCACCATGTGGNCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATANCTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCNCCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTNATNTTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATNCATTAAA
  3   1   2       bld Ga18      in                      xlk123d10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCATTTCNNTTTANTTTNNNAANNTGATTNCAAGTCTATAAAGGACTGTATCTATAACATGTAAATNCTGGAAGATAGTATTAAACGATCATATTGTTTCAGTCAGTATCTATAGAAAATNCTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTANNNCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNTCATTTATATNCNCGA
  3   1   2       bld Ga12 5g3  in                         XL217o10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACTGGAAGATAGTATTAAATGATCATATTGTTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATAT
  3   1   2       bld Ga18      in                       xlk66o22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAAGATAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTANCTGCAACAATAAAATNCAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATANCNNCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATNTCATTTATATNNAC
  3   1   2       bld Ga15 5g3  in                       XL466k19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTGGAGGATAGTATTAAACGATCATATTGTTTCCAGTCAGTATCTATAGAAAATNCTGATATNTAACTGCAACAATAAAATNCAACGNTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATT
  5   1   2       bld Ga18      in                       xlk66o22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGNTAGTATTAAATGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCANGNNNNCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTNTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAANTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAA
  3   1   2       bld Ga18      in                       xlk52n15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ANTNAANGATCATATTGTTTCAGTCAGTATCTATAGAAAATNCTGATATCTANCTGCAACAATAAATACAACCTAGTNTCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCNCTCCTTATGCATAGATTACTGTTAATGTTNCTTCAGAAAGTATCATTTATANCNCCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAANTCCGGCAGGTAATANCTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCAT
  3   1   2       bld Ga12 5g3  in                         XL216i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CGATCATATTGTTTCAGTCAGTATCTATAGAAAATACTGATATCTAACCTGCAACAATAAAATACAACCTAGTATCTCATGTATACTGTCTGAAAGGGATGATAAGAATTGGAATGTCCACCTCCTTATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATGCACGAAGCTGG
  3   1   2       bld Neu7 5g3  in                         XL040b24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGCATAGATTACTGTTAATGTTACTTCAGAAAGTATCATTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACANANTANAATATATGGCATTCGNAATATCATTTATAT
  3   1   2       add Ga12      in                         XL157a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTATTTTTTATAGCCACCATGTGGCCTCTGTGAGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACNTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTNTTGATATTCTTTTATTANACAANAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAACACAAAACTTGCCTGCACTGCTTATNACTGCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCNTGCATTGTAAATCTGTANACTTAATGTGTCAGGTTCCTTTTTCTTTNAAAAATGNACATATTAANGANANATGCATNAAAATATCATT
  3   1   2       bld Ga12      in                         XL160i05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCGAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAACTTGNTAATANACAATGCTTGCATTGTAAANCTGTANACTNAATGTG
  3   1   2       bld Ga12                                 XL155d12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGTAATGCAGTACACCACAAATCCGGCAGGTAATAACTTATTTTGTAAATTGTTCAAAATGTTTTCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCNATTAATTGCAGGTAGGTNCAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAANCAAAACTTGCCTGTACTGCTTATNACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTC
  3   1   2       bld Neu7      in                         XL035c11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCCTAAACATATATTTTATAGGCAGCTTGTGCACTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAACTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATGCACGAAGNCTNGGNAAA
  3   1   2       bld Ga12      in                         XL158a01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGGCATTTTAAGATTCACCCATTGTCCATTGCACCATGGTAAACTGTTTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACCTAGTACCTAGCAAAANTAGAATTGAACTAGAATTGAATATTTCTTTCTGCCATGGTGTTTTCTTGCTTTAACGTTTGTCCACAGCAAAATNATCTGTTTGCTCTTTTGATATTCTTTTATTANACAAAAATACATTAAAGGGTGGTTATGTTTTAATGANGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGNACTGCTTATTACTCTCTTGTAATATTTGTATATAAGTAAANTGTTAATATATAATGCTTGCATTGTAAATCTGNAAACTTAATGTGTGCAGGTTCCTTTTTCTT
  3   1   2       bld Ga12                                 XL163n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGTNTTTTTATCCCTAACCTAGTGGGATGTATAGAAATTACAGAGCATATCAATTAATTGCAGGTAGGTACAGCAATAAAGCAATACNTAGTACCTAGCANAANTAGAATTGAACTAGNANNGAATATTTC
  3   1   2       bld Ga18      in                      xlk107k04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAANTNTCA
  5   1   2       bld Ga18      in                      xlk107k04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCACAGCAAAATTATCTGTTTGCTCTTTTGATATTCTTTTATTATACAAAAATACATTAAAGGGTGGTTATGTTTTAATGATGTCAGTGCTCATGTGGCTTTAAACAAAACTTGCCTGTACTGCTTATTACTCTTTGTAATATTTGTATATAAGTAAATTGTTAATATATAATGCTTGCATTGTAAATCTGTAAACTTAATGTGTGAGGTTCCTTTTTCTTTTAAAAATGTACATATTAAAATATATGCATTAAAATATCATTTATATGCACGAAGCTTGGGaaaaataaaaaaattaagnaanaaaaaa

In case of problems mail me! (mike.gilchrist@crick.ac.uk)