Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7019362.5.5                    35 PI      86          6     2148                (no blast hit)

 This cluster: approximate FL confidence score = 81%

 1012769132 Xl3.1-IMAGE:6956389.5 - 58 ESTs
                                                                       ...-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6956389.5                                            GCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGATAAAAAAAAAAAA
                                                  Xl3.1-CHK-1012686382                                                  TGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGATAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                 9    12    13    17    19    22    22    24    23    25    26    27    26    27    26    27    26    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    27    26    27    26    27    26    28    27    27    25    27    26    27    24    26    25    26    23    25    24    26    24    26    23    26    23    26    22    26    23    26    23    26    22    26    21    26    22    27    21    26    21    26    20    25    18    24    17    25    17    25    19    25    18    25    17    24    19    24    17    24    17    24    15    24    14    23    13    23    12    22    12    20    10    19    10    18    10    17     9    19     9    19     9    19     9    18    10    18     8    17     7    17     7    17     7    15     7    14     7    14     7    13     7    11     7    11     7    10     7    10     7    10     7     9     7     9     7    10     7    10     7    10     7    10     7    10     7    10     7     9     7     9     7     9     7     9     7     9     6     8     6     8     7     9     7     9     7     9     6     9     6    10     6    10     6    10     7    11     7    11     7    12     7    13     7    13     8    15     8    15     9    15     9    15     9    16     9    16     8    16    12    17    12    17    12    17    12    17    11    17    11    17    11    16    11    16    12    17    11    17    11    17    14    17    14    17    13    17    13    17    13    17    14    18    15    18    15    19    15    19    16    18    16    18    16    18    16    18    16    18    16    18    15    18    16    18    17    19    18    20    18    20    18    19    17    19    17    19    17    19    17    20    18    21    17    21    18    21    17    21    18    21    19    21    19    21    18    21    17    20    19    20    18    20    18    20    18    19    18    19    18    19    18    19    17    19    17    19    18    19    18    19    17    19    17    19    16    18    16    18    13    18    12    18     7    14     4    10     4     8     4     5     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                        ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------G-
                                               BLH ATG      46     252                                            
  5   1   2       bld Int2 5g                         IMAGE:8822041.5p CCCGCCTTTCCCAACCACCCCACCACAAAAACACGAATTCGTCCCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCAACTGACATTTGACCCCAATTTATGGCACAATGGAGCAATTTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAGGCTGAAGGGAAACATATTTTTCTTTGAGAAAGTAAGGAAGCAGTTAATGTTGCTGGGAACATGTTGTGAGGATATACTTTGGAGAACGCGAAATTTTCCATGCAACAGTTTATTTTATGATTGGGGGAACATGACTGCCAATACGACCAAGAATGTAACTCACGATTCCTGTGGTAATCAAGTATGCTTCAAACATCCTTATCTGGGTGGTCTTCTAAGTGAG
  5   1   2       bld Kid  5g                         IMAGE:7009212.5p                    CCCACGCGTCCGCGGACGCGTGGGGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCTTGCTAGCATGAGCTGTGGTCATCATCGTACTAGCTCCTCGTTGCCGGCCTTTGCCAGCAAAG
  5   1   2       bld Emb9 5g3  in                    IMAGE:7976523.5p                        CGGATTCCCGGGATCTGACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCTACCTTTTCAAGAAGATGGAGCTGGAAATATTCATAGTATAGAGAAGCGTCTTGAGTCACTTACCATTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGATAGATCATATTGGTGGAACTGAACTCACTGACATTGACCCCATTTATGGTCACAATGGAGTCATTCACCAGTTTGCCTGGAGCTGCACCCTAAAAGAGTATTCTGATCATCTTGGACCTTATTCCTAATTATCGCATAGAAAACTGCTGGTTTTAATAAGCTGTATGGTAAAATATTTTTT
  5   1   2       bld Int2 5g                         IMAGE:8822702.5p                          ACCCAGTGATTACGACAGGACCCCCCCGATACAAATTCGTCCCACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAACAATATTTTCTTTGAGAAAGTAAAGGAGCAGTTAATGTTTGGCTGGACATGTGTTGGAGGATATACTTTGGAGACAGCGAATTTTCCCATGCAAACAGTTTTATTTATGAATGGGGAACTGACTGCAATTACGCAAGAGAACCAGAGTTCTGGTTGTTTATCCACAGTATCCTCA
  5   1   2       bld Lu1  5g                         IMAGE:4633310.5p                            CCCACGCGTCCGCTGACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAATCCCAAGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTA
  5   1   2       bld Int2 5g                         IMAGE:8527412.5p                              AAAATANNNCCCTATGCTNCNNNGNAGATCCATCAAATGNATTCGTCCCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGGTTTGAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAAGAAGTAAAGGAANGCAGTTATGTTTG
  5   1   2       bld Lu1  5g3  in                    IMAGE:4633901.5p                                    TACTGACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAA
  5   1   2       bld Eye1 5g                         IMAGE:6959188.5p                                    TACTGACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGNAACATGGTGTTTGGAGGAATATACTTTTGGAGACAAGCGAAAATTTTTCCCCAATGGCAAACAGTTTTTATTT
  5   1   2       bld Em10 5g                         IMAGE:7980943.5p                                       TGACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAAGAGCTGTGGTCATCATCGTACAATCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCGCAGTATAGATAAGCGTCTTGAGTCACTTACCAGTCTGACAGTAAAACGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCCATTCACCAGTTTGCTGGCAGCTGCACATCCCAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGACAACAGCTGGTTTGAAAGGCTGAAACGGAAAAAATATTTTCTTTGAGAAATAATCGATCACTTATGTTGGCTGTAACTGC
  5   1   2       chi Kid                             IMAGE:7011091.5p                                         ACAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCTTTGAACATTGACCCCAAATATGGTACAATGGATCGATTCGCCGATTGCTGGAAGCTGCTTGCGTGAGATTATTGGATCTTTTGGGATGTTGTACTAATATCTAAGTAAAGATTTGTTTGATATGGTGAGGATAGATAATGTTTGTTGAGAGGT
  5   1   2       bld Emb4 5g                         IMAGE:5536723.5p                                          CAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAGGCTGAAAGGGAAAACATATTTTCTTTGAAA
  5   1   2       chi Kid                             IMAGE:7008232.5p                                          CAGCTGACTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCCAGCATGGATTGGTGAAACAAGGGACCCCTTCTCCAAAGTGGGTGATCCCCCAACCTTTTCAAAAAAAGGGAGCTGGGAAATATTCAAAGTTATAAAAAGCCTCTTTGGTCCCCTTCCCATCCGGAAATAAAAAGGTTTGATTTTGGGCCCAAACCTTGCCCaaaaaaaataaaaattggggaaaccgtaacccccgggcttttgccccctttttgggccaagggggcacattcccccttttttggggagaccccccccaaaaaaaatttccaaattttttgggcccttcccccATTTCCCCGGGGAAAAACGGGGGTGAAAAGGGGGAAGGaaaaaattttttttttaaaaaaaaaaaaaCAATTTGTTTGGGGAGAG
  5   1   2       bld Sp1  5g3  in                    IMAGE:4173997.5p                                                 CTGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTNTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCATAAAGAGTATTCAGATCATCTTTGACCTTACTCCTTATTACCGCTATGAAAACTGCTGGTTT
  5   1   2       bld Eye1 5g                         IMAGE:6946916.5p                                                  TGGAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCCATTATGGCACAATGGAACCATTCACCAGTTTGCTGGAAACTGCACGCCAAAAGAATATTCAGATCATCTTTGGACCTTACTCCTAATTACCGCCGTGAAAAACACTGGTTTGAAAAGGCCTGAAGGGAAAAAAATAATTTTTTCTTTGAGCAAAATAAAGGGGAAGCCCTTTAATGGTTTGGCTGGGAACATGGGTGTTTTGGAAGGAATAATACTTTTTGGAGACCCGCCCAAAAATTTTTCCCCACGGCCAAACCCGttttttatttttttGAAATTGGGGGGGAAACAATTAGATTGGCCCAATTTTTACCCCCCGCAAAGAGAGA
  5   1   2       bld Brn1 5g3  in                    IMAGE:6956389.5p                                                    GAGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCNATGCAAACAGTTTTATTTATGAATGGGGGGAACATGACTGCCAATTACAGCAAAAGAAGGAAAACCAAT
  5   1   2       bld Neu7 5g3  in                         XL050o23.5p                                                     GTGGGCACAAGNACACCAGGNACTCCGACATGACCCAAGNATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACAT
  5   1   2      seed Kid  5g                         IMAGE:7008238.5p                                                     AGCGTGGGCACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACATATTT
  5   1   2       bld Emb4 5g                         IMAGE:4930721.5p                                                              ACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGGAGGAATATACTTTGGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTTATTTATGAATGGGGGGAACATGGACTGGCCATTTACGGCAAAGAAAGGAAAACCCAAGAAGTCCCTGGTTGGTTATCCCCACAATTAAAGGGCTCCAAAAA
  5   1   2       chi Emb4                            IMAGE:5570513.5p                                                              ACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCACAGTATAGAGAACCGCCTTGAGTCACTTACCACCCTGAACCTAACAGGCCTGACTATTTGGTCCATTACCTTGTTCGACGAACGCACCCGATTGGTGAAACTCGCCCTCCTTGAccccgcccccccattattgcccccttggcccattttctccccctctcttgccccacctgccccccataaagcctctttcccacccctccttggatccttgcccccctaattccccgcccccctaaccccgcccgccccTCCTAGCAAGCTTGAACACGGGCCCACCCACCCCTGTCCTTTTTGGCATCGTCAGcccccccccATTTTCTCTGCCGCTGTCGGCGCCCCCTTAAGTCTTTGCCCCCGGCTAATTTATCGCTTTCCGCGGCCGCCTCCCAGACTTTTGCCCCCAATACATTATCGACGGTTGCTGTNGTGAAAGCCCGGGCCCCGTTATGATGCCCTGCCGCCTTCTGCAGCATCCATTATCTTATCCCGCGCCCCTCTTCTCTCGCGTTCCA
  5   1   2       bld Kid  5g                         IMAGE:4033093.5p                                                              ACAAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGGTTTGAAAGGCTGANAGGGGAAAACAATATTTTCTTTGAGAAAGTANAGGGAAGCAGTTTAATGGTTGGGCTGGGAACATGGGTGTTGGGAGGGAATATACCTTTGGGAGACAGCCGAAAAATTTTTCCCCAATGGCAAAACAGGTTTTTATTTTAATGAATGTGGGGGGAAACCATGGAACG
  5   1   2       bld Lmb1 5g3  in                    IMAGE:8532967.5p                                                              CACAGACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCACTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCTAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCCTGGACCTTACTCCCTATTACCGCAGTNGAAACAGCTGGTTTGAAAGGCTGAAAGGGAAAACATATTTTCTTGAGCATGTAAGGAAGCAGTAATGTTTGCTGGACATGTGTTTGAGATATCTTNGAACAGCGAATTTCCATGCAACGTTTATATGATGGGAACT
  5   1   2       bld Eye1 5g3  in                    IMAGE:4757634.5p                                                                  GACACCAGGACTCCGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGT
  5   1   2       bld Neu7 5g3  in                         XL041g12.5p                                                                             TCCGACATGACCCAAGNTACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCATCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAA
  5   1   2       bld Kid  5g                         IMAGE:4031736.5p                                                                               CGACATGACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGGAAAGTAAGGGAAGCAGNTAATGTTTGGCTGGAACATGGTGTTGGGAGGAATATACTTTGGAGACAGCGAAAATTTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGGAACATGACTGCCCATTTACGCCAAGGAAGGAAAACCAGGAAGCCTGTTGGTATCCACAAGGTATGGCTCAAACAACCCTTACTGGGGGCTTCCAAGGAAA
  5   1   2       bld Emb4                            IMAGE:4202043.5p                                                                                     GACCCAAGATACTGCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGGCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGACATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGGTTTTGGGTTAGGCTGGGCTGGCAATGCTAGCAGGAGGC
  5   1   2       bld Lu1                    IMAGE:4633263-IMAGp.IMAGp                                                                                                  GCCCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGC
  5   1   2       bld Lu1       in                    IMAGE:4633263.5p                                                                                                    CCTAGACATGAAAGATGTTGAACTGAATGAACTGGAACAAGAAAAAGTCCCAATGGCAGATGGGGCCGGGGACAGCCCAACCGGAGGGGGAGAGAAGAATGGAGTTGTTAAGGTGAAGCTTGACGATGATGATGACATGCCAGCCAAAAGTCAGAAATTTACAGGGTTGTCTAAAGAAGAATTACTGCGAGTGGCTGGTACCCCGGCATGGGTGAGAGTCCGATGGGCATTGCTGATCCTGTTTTGGTTAGGCTGGGCTGGCATGCTAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTG
  5   1   2       bld Brn1                            IMAGE:6955580.5p                                                                                                                                                                                                                                                                                                                                                                              TAGCAGGAGCTGTGGTCATCATCGTACAAGCACCTCGTTGCCGGCCTTTGCCAGCAATGGAATGGTGGAACAAGGGACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAAACATGACTGCCAATTACAGCAAAGAAAGAAAACCAAGAGTCCCTGTTGTTATCCCACAAAGTAGTGGCTCAAAAACAAACCTTTACTGGTGGGCCTTTCAATGAGGACAATTAGATGGGCACGGCTTCTTTCTACCGGCTTTTCCTGGGGTGGCTGGAaaaacaaggaaaaaggcttttgggttttctttttgggggggaaaaagcccttaaaaaCCCATTAATGGTTGGGGAAAGAAAAACT
  5   1   2       bld Int2      in                    IMAGE:8822860.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACCCCTCTACCAAGTTGGTGATCCAGCAACCTTTCAAGAAGATGGAGCTGGAAATATTCAGAGTATAGAGAAGCGTCTTGAGTCACTTACCAGTCTGAAAGTAAAAGGTTTGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCAATATCTTTAATATGGGGATGAAATTGGACTTAAAGACCTTCTGGACAGCCTGCTCAGTCTCAGACTACATGCAGTGGGAAAAGTTCAGTGTCATTATCTCTCAAATGCATCTGATGTATGCAATATCAAATGAAGCCAGAATGCCTGACAGGGCTTCATCTAACGTGTTACACGA
  5   1   2       bld Tad2                            IMAGE:6931635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGGATTATTGGTCCAATACATGTCACGAAGAAAGATCAGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCCAATATCTTTTATATGGGGGATGAANATTTGGACTTTAAAAGACCCTTCCTGGGACAAGCCTGGCTCAGGTCCCTCCAAGACCCTTAACATGCCCAGTGGGGAAAGGAAGTTTTTCAGTTG
  5   1   2       bld Tbd7      in                         XL067j23.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGATTGGTGAAACTGAACTCACTGACATTGACCCCAATTATGGCACAATGGAGCAATTCACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTTGTGTGTACCAACTCCTCCTCTTCA
  5   1   2       bld Spl       in                    IMAGE:8463762.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGATACATCAAATAAATTCGTCCCTGGAGCAATTACCAGTTTGCTGGAAGCTGCACGCAAAAAGAGTATTCAGATCATCTTGGACCTTACTCCTAATTACCGCAGTGAAAACAGCTGGTTTGAAAAGGCTGAAAGGGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTNAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGG
  5   1   2       bld Int2                            IMAGE:8824635.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAAAACAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAGAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAAGAATGGGA
  5   1   2       bld Kid                             IMAGE:7011645.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAATATTTTCTTTGAGAAAGTAAAGGAAGCAGTTAATGTTTGGCTGGAACATGGTGTTGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAGAAGCTGGGACAGAATGAGCGATAG
  5   1   2       bld Tad2                            IMAGE:6934191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAGGAATATACTTTGGAGACAGCGAAAATTTTCCCAATGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACCACATGCGTCCATATGGCTTCTTTGGTCAACGAGAAGCCTCTTCGTGTGTACCAACTCCTCCTCCTCACACTGCCAGGCCCCCCAATATCTTTATATGGGGATGGAAATTGGGACTTAAAGACCTTCCTGGGAAAGCCTTGCTCAGTCCCTCAAGGACCTTAACTTCCACCGGGGAAGAAAGTTTCCGCGGCCCAAAAATTTCCTCCCCCCCTTTCCCCTTTGAAGCGCAAATGGCAACATATTACCATTTTAATGGCACCACAGACGGCCTGGAGAAAGGGATTCCTTTCCCCAGAGGGTGGTGCCCGCGAACATTTCAACCTGATCTTTGAAGGGGGGGaaaaaaaaCCGATCTCCCTCCCTCGGCAATGGGAGAAATTCTTACACTCTACTGGCCTTTGACCGCCGGTAGAGAAGGCCCCCCTATTCATATATCCACACAGAAATCCCTGGGGCACCCCACCAACTAATAGCCCCACTAGTGGGGGAAAAACCCCTCTGTGGACCCCATTTGGCGCCCTCCAGCCCGGTCGGAATAATCCCTCAAGCCCTTCGTCTCT
  5   1   2       bld Int2      in                    IMAGE:8820754.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGCGGTCAGGAGGGGGGATTATGACTCGAATTCGTCCCGCAAACAGTTTTATTTATGAATGGGGGAACATGACTGCCAATTACAGCAAAGAAGGAAAACCAAGAGTCCTGTTGTTATCCACAAGTAGTGCTCAAAACAACCTTACTGGTGGCTTCAATGAGACAATAGATGGCACGCTCTTCTACCGCTTCCTGGGTGCTGAAAACAAGAAAAGCTTTGGTTCTTTGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGAGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGAAGTAGAACTCTTCCTGAAAAAGATGGAGAGAAGAGCTGCCAGAGCAGGCACAGTGTGTTGAGTTCCACCCACAACGAAAGATGGGGAAACGTTTCCCTAAAAGCTTCAGTTAGAGCGAAAGCTTTACTCCTAAATACCCTTATATTGATACACTACATCTGTGAAGACAAACCTACCCATCCACTGCTGACCCTTCCTTCCAGGTGCCAGAACGCCACAAGGGTGG
  5   1   2       bld Tad1      in                    IMAGE:6879302.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGTGAAAGCATAAAACAATATGTGGAAGAGACTGGCATCCAGGGAAACAGTTGGATGATTGGGCACCACAAATGCGTCATATGGCTTCTTTGGTCAACGAGAAGCTACTTCGTGTGTACCAACTCCTCCTCTTCACACTGCCAGGCACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAANAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGGACAACACTTACACATTCCACTTTGCTGACCCTTTCTTTCCAGTGCCAAGGACGCACAGGTTTGGTTACCCTTTCCCCTTTAN
  5   1   2       chi Tad2      in                    IMAGE:6875771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACCCCAATATCTTTATATGGGGATGAAATTGGACTTAAAGACCTTCCTGGACAGCCTGCTCAGTCCTCAAGACCTAACATGCAGTGGGAAGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCCTACCCTCCTGTGGCAGTGAGATATACTGTAAACCTGTCATTTATATATTCCCAAGCCGGTCATATTTTTTCCTGGTTCAAGAGGAATaaaaaacctttaaaaaaaCCAGTTTCCCTGGAAAACGCCGTTTAAGAAGCAAC
  3   1   2       bld Int2      in                    IMAGE:8820754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACTTAAAGACTTCCTGAACAGCCTGGTCCAGTCTCAGACCTACATTGCAGTGGAGAGTTTCAGGTTCATATTCTCCTCAATGCATCGATGTAAATGCAATATCACATTTAGCACAGATGCTGACAAGGGTCGTCTAAACGTGTACAGAGTGAGTGACTTGAGGGGAAAGAACGATCCCTCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTTTGCTTAGTTTTGTCATACACGTGCTTTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTTTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGCTTGACTCCCCATAACATACTATTGCAGAAAATATGACATAACACACATCAA
  5   1   2       bld Kid                             IMAGE:7008424.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAGTTTCAGTGTCCAATAATTCTCCTCAAATTGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTTAGTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGC
  3   1   2       bld Tad1      in                    IMAGE:6879302.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCTTCAAATGGCATCTGATGTAAATGCAAATATCACATTTAAGGCACAGGATGCTGACAAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCTTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGG
  3   1   2       bld Brn1 5g3  in                    IMAGE:6956389.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCAAAATGGCATCTGATGTAAATGCAAATATCCCATTTAAGGCACCAGGATGCTGACAAGGGTTCCTTTCCTAAACGTGTACAGGAAGTTGAGTGACTGAGGGGGGGAAAGAACGATCCCTCCNTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGAGTACAGTTTAGCAACATGGTGCTGGTCAGGATAAAATTCC
  3   1   2       bld Tad2      in                    IMAGE:6875771.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGAGGTAAAATGCAAATATCACATTTTAAGGCCACAGGGATGCTGACAAGGGTCCCTCCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCTTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTGCCAAAATGGTGCNGGTCAGCATAA
  3   1   2       bld Emb9 5g3  in                    IMAGE:7976523.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGTACTTTACCTCTCTAACAAACAGGATTCAGTCAATTCTCATGTTGGAACAATTCCCTTAGCACGTCTGCAAGTCTTCTAAGTTACAGAGTAGTACTGAGGGAAGAAGTCCTCTGCAGGTGAATTCATCGTATACAGGAAGGGCCAATTTTCTTAGAAGTGGACCCGATGAGCGTATGGACAGCTTTAACTTTAATACGAGGGGAAGTAGAACTTTCCTGAAAAAGATGGAGAGAAGAGCTGCCAGAGCAGGGCACAGTAGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGC
  5   1   2       bld Te2N                            IMAGE:7765271.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACATTTAAGGCACAGGATGCTGACAAGGGTTCCTTCCTAAACGTGTACAGGAAGTTGAGTGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGATAAAAGATGGAGGAGAAGAGCTGCCAGAGGAGGGTCACATCGGTGTTGAGCTCCGAGCCTCTACTGAAACAGGGTGAACCAGTTTCCTTGCGCATGCTGAATTTTCGAGACTGAAAGGGCTATCTCCGCTGATATCCTTGAAAGGGATTTCCGCCTACAACCCTGTAAGGGAGGTACTGTATGACCTTATAATGTACTGATCTCATTTTTCTTTTCCCTTTCTCAAAAGGCAGTTTGCTTTGCGATAACGAAATCTTAGTTGTTATGTCATATGAACCTTCTATATTCTCTTTACTATTAGAGGCAAATTATTGTTTATCTGATACTTAATCTCTATTTTGGCACGATATACTTTATTTACACTTCACTTCTAATCTCAGCTCCTTCCATGAAGCGATTATTGTTGTTGGTTGTTCCGTCTGGGTCTTCTATAACTCTTCAATTTCTTCAGTAAATATGTTGAGTCTTGTCTTTGATTTCTCCtttttttttctgtctctttatctttactcttccctttttgtacttttttcacatttctctCCATCTTCTCTATTTTCCAATAATCACTTCAACTTTAATTATTTCTATCTGATTTATCATTCTCTATACTATTCTCTCTCT
  3   1   2       bld Int2      in                    IMAGE:8822860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAGGCACAGGATGGCTGACAAGGGTTCCTCCTAAACGTGTACAGGAGTTGAGTGACTGAGGGGAAGAACGATCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAATAGGCCATATCTTTCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTGAACTTAACTACGAGGGGGAAGTAGAACTCTTCTTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACATACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTTAGCGAAACCC
  3   1   2       bld Spl       in                    IMAGE:8463762.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CATTCTATGCTGAGAAGCATTCCTTAGCCGTGTGCAGGTCTCTAACGTACGAGTGATACTGAGGGAGGACGTCTTCTGCAGTGAATACATACGTATACAGGAAGGGCATATCTTCTTAGAAGTTGGACAGAATGAGCGATATGTGACAGCTTGAACTTTAATACGAGGGGGAAGTAGAATCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAAAATGGTGCTGTCAGCATAAATCACATCACGAGTAGGT
  3   1   2       bld Lmb1 5g3  in                    IMAGE:8532967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGTACAGGAAGTTGAGCGACTTGAGGGGGAAAGAACGATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACAAGGGGGAGGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTAAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGATCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACACGTGTCCCTACCCTCTGTGGCGGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTTTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGAATACAGTTTAGCAAAATGGTGCTGGTCAGCTAAGACTTCCCCCTCACATCCCACGC
  5   1   2       bld Skin                            IMAGE:8643792.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCCCTCCTGCATGGTGAATTTACACTACTGTATAACAGTGAAGAGGCCATATCTTTCCTAAGAAGCTGGGACCAGAATGAGCGATATGTGACAGCTTTGAACTTTAACTACGAGGGGGAAGTAGAACTCTTCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGNCATAGGAATATGAATGCCTGTGGATCTTGTGTATTGGGGGAGGGAAAGTTGACTACGTTNAGCACATGGTGCTGTCAGCATAAATTCTATTCATAAGTAGTGTTGTGACAA
  3   1   2       bld Neu7 5g3  in                         XL041g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAACTACGAGGGGGAAGTAGAACTCTTCCCTGAAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGNNAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTG
  3   1   2       bld Tbd7      in                         XL067j23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAAAAGATGGAGGAGAAGAGCTGCCAGAGCAGGGCACAGTGGTGTTGAGTTCCAACCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCGGTCAGCATAAAATTCCTATTCAATAAAGTTAGT
  5   1   2       bld Lmb2                            IMAGE:8639925.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCACAACGAAAAGATGGGGAAACGGTTTCCCTAAAAAGCTTCAAGTTAGGAGCCGGAGAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGATaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  3   1   2       bld Neu7 5g3  in                         XL050o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGTTTCCNTAAAAAGNTTCAAGTTAGGANCCGNANAGGCTTTACTCCTTAAATACCCTTATAGTGGATAACCACCTACATCCCTGTGAGGGACAAACACTTACACATTCCACTTGCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGGCGGTCAGCATAAAATTNC
  3   1   2       bld Eye1 5g3  in                    IMAGE:4757634.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTGACCCTTTCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGATAAAAAAAAAAAAA
  3   1   2       bld Sp1  5g3  in                    IMAGE:4173997.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTTTCCAGTGCCAAGACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGATCAA
  3   1   2       bld Lu1  5g3  in                    IMAGE:4633901.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACGCACAGGTTGTTAACCTTCCCTTTAAACCTTTTAACAAGTGTCCCTACCCTCTGTGGCAGTGAGATATACTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAAAAAACAGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCACTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGATCTTGTGTATTTGGGGAGGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATAAAATTCCTATTCAATAAAGTTAGTGTTTGTGAAAAAAA
  3   1   2       add Tbd7                                 XL108a07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TNCTGTAACCTGTCATTTATATATTCCAAGCGGTCATATTTTTCATGTTCAGAGGATAAAAACTTAANCCCNCNGTTCCTGAAACGCGTTAAGAGCAATAAGTGGAGTAANAAAATNTGCTTNGTTTTGTCATACACGTGCTCTGATGTGTGTTTTTGTCAATATTTTCTGCAATAATATATCATGGAGTATATCGTCATTTCATGTTTTAAAGGCTGTGGCGCTTTTAGCCCTCTGAGCATGGAGAGTTGGGCCGAGCAATAGGAATATGAATGCCTGTGGA
  3   1   2       bld Lu1       in                    IMAGE:4633263.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGTCATTTATATATTCCAAGCGGTCNTNTTTTTCATGTTCAGAGGATAANANCTTAAAAANCAGTTCTTGAANCGCGTTAAGAGCAATAAGTGGAGTGTTGTTTTCTGCTTAGTTTTGTCAAACACGTGTTTTTTTGTGTGTTTnTGCCAATTTTTTCTCCAATAATATATCTTGGAGTATATCGTCGTTTCATGTTTTAACGGCTCCCGCATTTTTAGCCCTCTGAGCATGGAGAGTTGGGACGAAACAATAGGACTCCTCCCCCCAAGTGGATCTTGTGTATTTGGGAAAAGGAAAGTTTGACTACAGTTTAGCAACATGGTGCTGGTCAGCATACCTTTTCCTATTCAATAAAAGTTAGTGTTTGTGATCATAAAAAAAAAAANAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)