Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 09 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:5079772.5.5                    83 PI      91         27     2289                (no blast hit)
     2   0.0    0Xl3.1-IMAGE:8548520.5                       4 PI      77        925     1457                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6958705.5                       4 PI      76        148     1457                guanosine diphosphate (GDP) dissociation inhibitor 3 [Xenopus tropicalis]
     4   0.0    0Xl3.1-IMAGE:6957406.5                       2 PI      77        148      851                MGC84311 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 97%

 1012769147 Xl3.1-xl274l09.5 - 74 ESTs
                                                                       .....-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl274l09.5                                    CTGGACGTGCCTCTAGCGTGTTCGGCCTGTCAGTGCGTGCGCACGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGG
                                                  Xl3.1-CHK-1012685972                                          GTGCCTCTAGCGTGTTCGGCCTGTCAGTGCGTGCGCGCGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAA
                                                      consensus depths                                         2     2     2     2     2     2     3     3     4     5     6     7     8    11    12    14    14    16    14    16    16    17    17    21    18    22    20    23    23    25    23    25    23    25    23    25    23    25    23    25    23    25    23    25    22    24    22    24    23    25    23    25    24    26    24    26    24    26    24    26    24    26    24    26    24    26    24    27    25    26    26    26    26    26    26    26    26    26    26    26    27    27    27    27    27    27    25    27    26    27    25    27    23    26    23    26    24    26    23    25    23    25    21    24    20    24    17    24    20    24    19    24    16    23    17    23    16    23    15    23    18    24    14    23    13    22    14    22    12    23    12    23    13    24    12    24    10    22    10    20     8    18    10    17     9    17     9    17    10    19    11    19    11    17    11    17    11    17    11    16    11    14    11    14    11    14    11    13    11    13    10    14    11    14    11    13    12    14    12    13    13    14    13    14    13    14    13    14    14    14    14    14    12    14    12    16    13    16    14    16    14    16    14    16    14    15    14    15    14    15    14    16    14    16    14    16    14    16    15    17    15    18    13    18    14    18    14    19    15    20    14    21    14    21    15    22    16    24    16    24    16    24    16    24    15    25    14    25    14    25    13    26    12    25    12    25    12    25    12    25    12    26    12    25    13    25    14    26    17    28    17    27    17    26    18    26    14    26    17    25    17    25    18    25    19    27    18    26    18    25    18    25    19    24    20    25    20    24    21    25    21    25    21    26    22    25    23    26    23    26    23    25    22    25    24    26    21    28    25    28    23    28    23    28    24    28    24    28    25    28    23    28    24    29    24    29    24    29    23    29    25    29    23    29    20    29    17    29    17    29    13    28    11    25    12    25    12    24    12    24    12    22    12    22    12    22    12    20    12    20    12    20    10    19     8    13     6    10     6    10     5     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----G-------
                                               BLH ATG     147    1921                                    
                                               BLH MIN     147     319                                    
                                               BLH MPR     147     319                                    
                                               BLH OVR     147     230                                    
                                               CDS MIN     147       5                                    
                                               EST CLI      52       5                                    
                                               ORF LNG     147      21                                    
  5   1   2       bld Oo1  5g                         IMAGE:5079174.5p CAGCGGAGACTGTCGATGTTAGGCAATTTGATTGGCTGGACGTGCCTCTAGCGTGTTCGGCCTGTCAGTGCGTGCGCGCGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCCAAGAAAACCACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAAGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCCGGATTTAAATTGTATAGGGGAAATCTCTTTGGCTCGAACGGGCAAAAAGCCCCATACCCTTTATTCCCCTCTATTGGCCCTTTGGC
  5   1   2       bld Emb1 5g                         IMAGE:6862850.5p                        TAATTTGATTGGCTGGACGTGCCTCTAGCGTGTTCGGCTTGTCAGTGCGTGCGCACGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGGTGTTGACCCAAAGAAAAACGACAATGGCGAGATGTCTACAAAGAAGTTTGAATTGGGGCCAGGATTGTTGTTTGACTTTACAGGGTCATGGCTCTTGGCACTCCTATAGGAACTGATGGAAAATTTTGGACCAACCCCTGTTCTTGGAGACCGGTAAACCGGGATTAAAATTTGAATAAGTGAAATCTTCTTTGCTTCCAAAACGGGGAAAAAAAGCCCCCATAACCTCTTTTATTCCCCCCTCTCTATGGGGCCCTGTGGGAAGAAAACATGGCCCCCAAAAGGGGTGTC
  5   1   2       bld Emb1 5g                         IMAGE:6866660.5p                                                                  CAGTGCGTGCGCACGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAAGTCATGCTCTGGCACTCTATAAGACTGATGAATATTTGGGACCAGCCCCTGTCTTTGAAACGGGTAAACCGGGATTTAAATTGGTTATAGGGGAAATCTTCTTTGGCTCGGATACCGGGCAAAAAAGCCCCCATAACCTTTTTATTCCACCTTCCTATTGGGCCCTTGGGGAAGAAAACTGGGCCCACAAAGGGGGTTTTTTGGCACAGGAAACTTGGAAATTGGCCCAATTTTTAATTTggggtgggggggAACACAT
  5   1   2       bld Panc 5g                         IMAGE:8738278.5p                                                                             CGCGCCACCTCCCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGACGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAGCCCTTGCATCTAGTTTATGGGGATTGTTTGAAAAGGCGTCGATTTAAGGAAATTTCTGGAGCTACGTTGCAGCTTTGATGGAGAATTGACAGGCAGAAACCAAGGAGGGTGTGACCCTAAAGAAAAACGAAAATGCCGGAATGGTCTACAAAAGTTTGATTTGGCCAGAGTGTGTGTGGACTTACAGTCATGTCTCTGCCACCTCTTAGACTGAGTGAATTGAACCCTGTTCTGGAGCGTACGGAATAATTGTATGGATCTTGTCGAAGCGAAGCATACTTTCCATCTTTAGGCCTTGA
  5   1   2       bld Eye1 5g                         IMAGE:6948926.5p                                                                              ATTCTCCGGATCTGTCAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGACGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACTACAATGCGAGATGTCTACAAGAAGTTTGATTTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGGAGAATATTTGGACCCAGCCCTGTCTTGGAAACGTAAACCCGGATTAAATTGTACAGGGAATCTCTTTGCTCGATACGGGCAAAAGCCCATACCCTTTAACCCCCTCTATGGGGCTTTGGAAAAAATGGCCACAAAGGTTTTTCCCAAGAACTGAAGTGGCCATTTTATTgggggggggAAAATTATTTTGTTTGAAAACCAAACCTCATTATaaaaaaaaccttgggtggatttggcaaaaataggggccaaaaaatttggtttgggggggggggaaaaatctcctcaaaaagaggggggaaagtgggggCCC
  5   1   2       bld Ga17 5g                              DN828625.5p                                                                                        ATTCCCCGGACTGCACGATCCGCTACCCGTATTCCGNGAGCGCATCCCTGATTCTTCCTCNNGTTTCTTCTGATTCACTCGGTGCCGGCNGGGNNATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCG
  5   1   2      seed DMZ  5g3  in                         xl253e08.5p                                                                                             CAGCGCTTCCGCATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGAT
  5   1   2       bld Sp1  5g3  in                    IMAGE:4968535.5p                                                                                                   ccacgcgtccgcccacgcgtccgcccacgcgtccgccTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAGTAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGA
  5   1   2       bld Emb4 5g                         IMAGE:5440243.5p                                                                                                       CCCACGCGTCCGCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAAATATTGGACCAGCCCCTGTCTGAGACGGTAAACCGGATTAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCNTTATCACTCTATGGCCTTGAGAACTGCCACAGGTTTGCAGA
  5   1   2       bld Emb1 5g                         IMAGE:6863861.5p                                                                                                         GTTCCCCTACAGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACCAGCAAGACACAAGAAGGTGTTGACCCACACAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCCGGATGTTATTGACTTTACAGGTCATGGTCTGGCACTCTATAGGACTGATTGAAAATTTGGACCAAACCCCTGTCCTTGAGACGGGTAAACCGGGATTAAATTGGAATAACGGAATTCTCTTGCCTCGATTACGGCCAAAAGCCCCAATCACCTTTAATCCCCCTCCTAATGGGCCTTTGGGAAAAAACTTGCCATCAAGGGATTTTTTCCAAGACATCTAAGCGCCCCATTTATATggggggggACCCTCATCTTGTCTGTAAAACAACCCT
  5   1   2       bld DMZ  5g3  in                         xl321g01.5p                                                                                                         ATCCGCTACCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGACGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACTACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCC
  5   1   2       bld Neu7 5g3  in                         XL048i24.5p                                                                                                                 GCCGTATTCCGTGAGCGCATCCCTGNTTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGG
  5   1   2       bld FaBN 5g                         IMAGE:8076536.5p                                                                                                                 CCCGTATTCCGTGAGCGCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTA
  5   1   2       bld Eye1 5g                         IMAGE:6958542.5p                                                                                                                    TCGAATAAGTGAGCGATCCCTGATTCTTCCCCGAGTTTCGTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAACACGACAATGCGATATGTCTACAAAAAGTTTGATTTGGGCCCGGAAGTTGTTGAATTTACAGGTAATGCTCTGGCCCTCTATAGGACTGATGAAAATTTGGACCAACCCCTGTTCTTGAGAATGGTAAACCGGATTAAAATTGTATTATGGAATCCCCCTTGCCTCAATATGGCCAAAACCCCCTACACTTTTTCCTAACTCCTAAGGGCCCTTGGGAGAAACTGTCCAACAAGGTTTTTTCCAAGGACTGTAGTGGCCCCTTTTATGGTTGGGGGACAATCTTATGTTGGAACAAAACCCCCATACATAAAAATCTTGCGTGAATGGACAGAAATGTCCACAAATTCGCGGCGGGAGCGA
  5   1   2       bld FaB  5g                         IMAGE:8072779.5p                                                                                                                                CGTCCGGATTCCCGGGATCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAATACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTTCTGCTCGATACGGCAAAAGCCCATACCTTTACCACTTCATGGCCTTGGAAGACTGCCACA
  5   1   2       bld Te2N 5g                         IMAGE:7767505.5p                                                                                                                                 GCATCCCTGATTCTTCCTCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGC
  5   1   2       bld Tail 5g                         IMAGE:8545653.5p                                                                                                                                                  TCGCGTTTCTTCTGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGACGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACTACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACNGTAAACCGGATTAATTGTACATGAATCTCTTGCTCGATCGGCAAAGCCATACTTTATCACTCTATGGCTTGGAGACTGCCACAGTTTTGCAAACGAGTGCANTATGGGGGACTTATGTTGACAACATTGAAACCTGGATGGAAAGCAATTTTG
  5   1   2       bld Spl                             IMAGE:8460357.5p                                                                                                                                                              CCATTTTCNTTNGCGGATCCATCGATTCGAATTCGTCCCCGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGACGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACTACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAAGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGCATCTCTTGCTCGATACNGCAAAAGCCCATACCTTTATGCACTCTATGGCCATGGAGCACTGCCACAAGGTTTGCTAGACTGAGTGCATTTATGGTGGACATATTGTTGAACAACCCATAGAGAGCTGTGATGAGATGGCAAATGNTGTGTGAGTCTGACGGGAGTGCCGATGCACACTA
  5   1   2       bld Ga18      in                       xlk57e08ex.5p                                                                                                                                                                TGATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGNCTGNNNNNTGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCNGNTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGNTTGATTTGGNNCAGGATGTTGNTGACTTTACAGGTCATGCTCTGNNACTCTATAGGACTGATGAATANTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAANCCCATACCTTTNNNCACTCTAT
  5   1   2       bld DMZ  5g3  in                         xl284p15.5p                                                                                                                                                                ATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTG
  5   1   2       bld Ga18      in                      xlk104g08ex.5p                                                                                                                                                                 ATTCACTCGGTGCCGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGNCTGACGNAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGACGATTTAAGAAANTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACTACAATGCGAGATGTCTACAAGAAGNTTGATTTGGGCCAGGATGTTGNTGACTTTACAGGTCATGCTCTGGNACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAANTGTACAGTGAATCTCTTGCTCGATACGGCAAAAGNNNTANNTTTATCCAC
  5   1   2       bld DMZ  5g3  in                         xl274l09.5p                                                                                                                                                                             CGGCAACATCATGAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATATGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTT
  5   1   2       add Eye1      in                    IMAGE:4743398.5p                                                                                                                                                                                         GAATGAGGAGTACGACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATTCTCTCTGGAATAATGTCTGTTAATGGCAAAAAGGCCTTACACATGGATAGAAACTCTTACTATGGAGGT
  5   1   2       bld Emb1                            IMAGE:6636726.5p                                                                                                                                                                                                    ACCACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACCGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACCAACAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTCGGGCCCGCGATGTTCGTGACTTTACCGGTCATGCTCTGGCACTCTATAGGACCTGATGAATATTTGGACCACCCCTGTCTTGACACCGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCCGATCGGAAAAAGCCCATACCTTTATCCCCTCCTATGGGCTTGGAGAAACTGCCCCAACGGCTTTGCAAGACTGAGCGCCCCTTCACGGGGGGGACTTATATGTCGTACCCCCCCATTTACAATAAGCTGGTGTATGGCCAAAATCGCCACAAATTGCTGGGCGCCGAAAATCTTGAACGGGGAGACGGTGGTCCCCTCATGCCTAAACCCGCTTCGAACATTGTGCCAACCCCCAAATTAACCGCCCTCCTCACAAAACCCGGTGCGTGTTCCTTACACCCGCCCCTGGAACATCGGGGTTTCATCTCCCCCCGCGCCCACTTTTTTGTC
  3  -1   2       bld Egg3      in                    IMAGE:3379186.3p                                                                                                                                                                                                       ACGTAATCGTGTTAGGCACCGGCCTGACGGAATGCATCCTCTCTGGAATAATGTCTGTGAATGGCAAAAAGGTCTTACACATGGATAGAAACTCTTACTATGGAGGAGAGAGTGCATCAATAACACCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAATCCCTTGCATCTAGTTTAATGGGGATGTTGGATAAGCGTCGATGTAAGATATTCTTGAGCTACGTTAGCAGCTCTGATGAGAATGACAGCAGA
  5   1   2       bld Emb3      in                    IMAGE:3399365.5p                                                                                                                                                                                                                                                                                                                                    CCTTTGGAAGATCTGTACAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAAT
  5   1   2       bld Ga15      in                       XL429i06ex.5p                                                                                                                                                                                                                                                                                                                                                     CAAAAGGTTTAATATACCTGGAAGCCCTCCGGAGTCTATGGGACGAGGAAGAGACTGGAATGTGGACCTCATTCCCAAATTTCTTATGGCCAATGGCCAGTTAGTGAAGATGTTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATATGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAANCAGCTGATATGTGATCCTANTTACGTTCCANATCGGGTGACTAAAGTANGACAGGNTTATCCGTGTAATTTGTATTCTGANCCCATCCAATAAA
  5   1   2       bld Emb1                            IMAGE:5155852.5p                                                                                                                                                                                                                                                                                                                                                                                                                                               GGACGCGTGGGCGGACGCGTGGGTGCTTTTCACAGAAGTTACCCGTTATCTGGACTTTAAAGTTATTGAGGGGAGCTTTGTCTACAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTANAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATANAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATNGATTTCATATGCCCCACAATGTGGGCTGCACAAAGGAAAATATATTTTGCAATAATCAGGCACTACTGTNTGGAAACCAA
  5   1   2       bld Tail                            IMAGE:8544167.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTTTGTCTAAAAGGAGGCAAAATCTATAAGGTCCCTTCAACTGAAACAGAAGCCCTTGCATCTAGTTTAATGGGGATGTTTGAAAAGCGTCGATTTAAGAAATTTCTGAGCTACGTTGCCAGCTTTGATGAGAATGACAGCAAGACACAAGAAGGTGTTGACCCAAAGAAAACGACAATGCGAGATGTCTACAAGAAGTTTGATTTGGGCCAGGATGTTGTTGACTTTACAGGTCATGCTCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATATGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTCATATGCCCACAATGTGGCTGCACAAGGAAATATATTGGCATATCAGCACTCTGTGAAACAACGACCGGAGAGAGAATCAGCCGCTCTGGACTCTGGAACCATGACAGAGTTGTA
  5   1   2       bld Ov1                             IMAGE:6319323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCTGGCACTCTATAGGACTGATGAATATTTGGACCAGCCCTGTCTTGAGACGGTAAACCGGATTAAATTGTATAGTGAATCTCTTGCTCGATATGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCCTCCGAATTTGACTTTGAAGAGATGAAACCGCAAGAAGAGCGACATTTTTGGTTGAAGACCAATAAGCTCCCAGTATAAGGAAAAAGTTTTTGAACTTGCTTCAAATATGTATTTTCAGGAACTTAGGAAACACTGGATGAATCCCCATA
  5   1   2       bld Tad1                            IMAGE:6938244.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGATTAAATTGTATAGTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTCTCTGGTGGAAA
  5   1   2       bld Egg1                               PBX0137B08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAATCTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGCTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCGGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCGCAAGGAAAATATATTGCCATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTACTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTATATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCT
  5   1   2       bld Tad2                            IMAGE:6936250.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGTCTTGCTCGATACGGCAAAAGCCCATACCTTTATCCACTCTATGGCCTTGGAGAACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGGCTCAGAATTTTGACTTTGAAAGAGATGAAAACGCAAGAAAGAAGCGACATTTTTTGGGTGGAAGAACCAATAAGCCTTCCCAGTTATTAA
  5   1   2       bld Ov1                             IMAGE:8332496.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AACTGCCACAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGATCTGCTTCAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCCTGCTTTGTGTAAA
  5   1   2       bld Tad1      in                    IMAGE:6878226.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAAGGTTTTGCAAGACTGAGTGCCATTTATGGTGGGACATATATGTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATTAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTNTGAATCTGCTTCAAATATGTATTTCANGAAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCCTGCTTTTGTTGTAAAGACCCTCATGACATAGAAGTATTGCACTGC
  3   1   2       bld DMZ  5g3  in                         xl253e08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGACATATATGTTGAACAAACCNATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTCCCT
  5   1   2       bld Tad2      in                    IMAGE:6873596.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          gggcgggggggTTGAACAAACCAATAGAAGAGCTGGTGATGGAGAATGGCAAAATTGTTGGTGTGAAGTCTGAAGGGGAGGTGGCCCGATGCAAGCAGCTGATATGTGATCCTAGTTACGTTCCAGATCGGGTGACTAAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTTATAGGGAGAGTTTTTGAATCTGCTTCCAATATGTATTTTCAGGAACTTAGGAAACACTGTATGAATCTTCAATATTGGTATGGCCCTGCCTTTGTTGTAAAGGAACTCCTTGACCTTAAAGAGTATTTGGCACCTGGTAAATTG
  5   1   2       bld Lmb1                            IMAGE:8534094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACTAAGTAGGACAGGTTATCCGTGTAATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCTTCCCTTTTTTCTATNCAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCATANGTTTTTTGAAGCATCTAANTGTCTGGTGAATCNAAGTGTAAC
  5   1   2       bld Tad1                            IMAGE:6937590.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGATTTGTATTCTGAGCCATCCAATAAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGATCTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCACCTACTGATATGGGAACCGAAAGCCAGATATTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGCGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCCGTTTCATGATGGCTTTcccccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGGTTAAAAATAAGTCCTATTTTGTGCCGGGTCTTTTTTCC
  5   1   2       bld DMZ       in                         xl326i20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAGAACACAAATGATGCCAATTCCTGCCAGATCATCATTCCACAGAATCAAGTCAACAGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCNAA
  5   1   2       bld Thy                             IMAGE:8548012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGAAAATCTGACATCTATGTGTGCATGATTTCATATGCCCACAATGTGGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGAACTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTAAAATTCACCATGGTATTTTGCTTTGGAA
  5   1   2       bld Ga18      in                       xlk64e14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATTTCNTATGCCCACAATGTGCTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGATCTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCACCTACTGATATGGGAACCGAAAGCCAGATATTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGCGNNNNNNATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTcccccccccccTTCCCTTTTTTCTATCAAAGAGGNTGCTGTTAAAAATAAGTCCTATTTGTGCNNNTCTTTTTTCTGTTACCTCCAATAGGNTTTTTGNAGGCATCTNAATGTTCTGGGTTGAANCCNAAGTGTAAACNNTGTATCGATNNNCATATNANATTGCCATTTTAAG
  5   1   2       bld Ga18      in                       xlk64i15ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGATTTCATATGCCCACAATNNNNTGCACAAGGAAAATATATTGCAATAATCAGCACTACTGTTGAAACAAACGACCCGGAGAGAGAGATCAAGCCCGCTCTGGATCTCCTGGAACCCATTGAGCAGAAGTTTGTTAGCATTAGTGACATGTTTGCACCTACTGATATGGGAACCGAAAGCCAGATATTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGCGNNNNNNATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTcccccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGNCCTATTTGTGCGGNTCTTTTTTCTNTTACCTCCNATANGNNTTTTGAAG
  3   1   2       chi Ga18      in                       xlk64i15ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCTGNTCNCNNNNNCNTNGNGCAGAAGTTTNNTNGCATNAGTGACATNNTTNNNNCTACTGATATGGGAACCGAAANCNAGANNNTTNTTTCTCGNNCTTATGANCCTNCNNCCCNNTTNNNANCCNCCTGCAATGNNNTTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGNCTTTGAAGAGATGAANCGCAAGAAGAGCGACNTTTTTGGNGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGANTCTGCTTCAAATATGTNTTTCAGGNACTTAGGAACNCTGTATGAATCTCAATATTGTATGNCCTGCTTTGTTGTAAAGNCCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGNCTTTCCCCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCNCCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATNNCNCCGGCTAGGGAAAAAAAAAAAGTTGGGCTGTAGACCNCCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTNTTACGCAGGTAAGGCTTGGNCGCATTTTTCNAANNNCTGTNGCAACTCTTTGAAAGGCCANCTGANNNTTNTCTGNTNNNTTGCNCCATAGNNT
  3   1   2       bld Ga18      in                       xlk64e14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTGNNNCNATNGNNNAGAAGTTTNNTAGCATTANNNNCATGNNNNNCCTACTGATANGGNNANCNGAAAGCCAGNNNNTTNTTTCTCGNNCTTANGATCCTNCCNCCCNCTTTGAAACCACCTGCAATGACNTTAAGGANNTCTNCAAAAGGATGATGGGCTCAGAATTTGNCTTTGAAGAGATGAANCGCAAGAAGAGCGACATTTTTGGCGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGANTCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGANTCTCAATATTGTATGNNCTGCTTTGTTGTAAAGNCCTCATGACATCAAAGAGTATTGCACTGGTAATTNCTCCCTTCTGTTTCATGATGGCTTTCCCCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTANNNNNNCGGCTAGGGAAAAAAAAAAAGTTGGGCTGTAGACCACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTTGAAAGGACCAAACTGAGAATTGTCTGGTGTGTTNCTCCATAGAATTGAAA
  5   1   2       bld Egg1                               PBX0011H10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTTTGCGCCTACTGATATGGGAACCGAAAGCCAGATTTTTATTTCTCGCACTTATGATCCTACCACCCACTTTGAAACCACCTGCAATGACATTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAAGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTG
  3   1   2       bld Ga18      in                      xlk104g08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTNNTGATANGGGNNCGAAAGCCANNNNNNTTNNTTNCTNGNNCTNATGATCNNNCCNCCCNNNTTTGAANCCNCCTGCAATGNCNTTANGGATNNCTACAAAAAGGATGATGGGCTCAGANTTGNNTTNNAAGAGATGNANCGCAAGAAGAGCGACNTTTTTGNCNNAGNCNAANAAGCTCCCAGTATAGGAGAAGTTTTGANTCTNCTTNAAATATGTATTTCAGGANCTTAGGAACACTGTATGANTCTCAATATTGTATGNCCTGCTTTGTNGTAAAGNCCTCATGACATCAAAGAGTNTTGCNCTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCCCCCCCCCTTCCCTTTTNTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTNCCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTANNNNNNCGGCTAGGGAAAAAAAAAAAGTTGGGCTGTAGACCACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTTGAAAGGACCAAACTGAGAATTGTCTGGTGTGTTNCTCCATAGAATTTGAAATGNNTTC
  3   1   2       chi Tad1                            IMAGE:6880635.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGGAGGGGGCTCTCGAGAAATTTTTGAACTTTGTGAAAGGGGGATGGAAAACCGCACAGGAAGAGAGGCGACCATTTTTTGGGGGAAAGGACCAAATAAGGTTCCCCAGTATTAGGAGAAAGTTTTTGATTTGGCTTCAAAATATGTATTTCAGGGAATTAGGGAACACTGTATGAATCTCCAATATTGTATGGCCTGCTTTGTGTAAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCTTTCTGTTTCATGATGGCTTTTCCCTCCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAACTCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTGCAC
  3   1   2       bld Ga15      in                       XL429i06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCTACCACCCACTTGGAAACCACCTGCAATGACATTAAGGATATNTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACT
  3   1   2       bld Tad1      in                    IMAGE:6878226.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTGAAAACCACCTTGCAATGACATTAAGGGATATCTACAAAAGGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAATGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGTATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCAATAG
  3   1   2       bld DMZ  5g3  in                         xl284p15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTGGAACCACCTGCAANGCCNTAAGGATATCTACAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCTNTTCCCTTTTTTCTATCAAAGAGGNTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCNTGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTNTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACNTTATTTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGNGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAATGGGCTGAGACTA
  3   1   2       bld DMZ       in                         xl326i20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TNTACAAAAGGATGATGGGCTCAGAATTTGACTTNGAAGAGATGAAACGCAAGAAGAGCGACATTTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCTTCCCTTTTTTCTATCAAAGAGGNTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATNTAAATGTTCTGGTTGAATCCAAAGNGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTATTTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAATGGGCTGTAGACTACCT
  5   1   2       bld Brn3                            IMAGE:8539918.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTAAAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGCGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCTTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGNTTTTAACTATTGCCCACGGCTAGGGaaaaaaaaaaaGTTGGGCTGTAGANCCACTTCTGTTTTATCTATAAAGTACAAACACAAGTATACGCAGGTAGGCTGGACGCTTTTCTAACCTGTGCGATCTTGAAGACAACTG
  5   1   2       bld Te2N                            IMAGE:7204370.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGGATGATGGGCTCAGAATTTGACTTTGAAGAGATGAAACGCAAGAAGAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGctttcccttcccccccttcccttttttcTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaaTGGGCTGTAGACTACCTTTCTGTTTAATCTTAATAAAGTACAAACACAAAGTATTACGCAGGTAAAGGCTGGACGCATTTTTCTAAACCTGTTGCAACTCTG
  5   1   2       bld Skin                            IMAGE:8642953.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGCGACATTTTTGGTGAAGACCAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGAACTTAGGAACACTGTATGAATCTCAATATTGTATGGCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGTAATGATTCTCCTTTTGCCCCAGGAACCATTCTCTGCCCACCCTTTGTCACATCTATTGTACAAATCTTTTATCAATGAAGCGGCTTCCTTATAATGCCTTTTCCTTCCCTTTTTATACCGTACCCCATTCTCTCTGCCTGTGTACTCCTGAATTGCCTTTCCTTGTTAAAACAATTCCACTGCTAGAAAAATAATTTGGGTTTGTTATCATCTTATTATCTTTAAATATAAATTCAATATTCCAAACTtattatatttttaaaactgtttttgctttacttctgcctctttacgatattttattactttacCAGTCAATTCCATATTTATATATTATCTTTTTTCTTTC
  3   1   2       bld Ga18      in                       xlk57e08ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CNTTTTNGNNAGNCNAATAAGCTCCCAGTATAGGAGAAGTTTTGAATCTGCTTCAAATATGTATTTCAGGNACTTAGGAACACTGTATGANNCTCAATATTGTATGNCCTGCTTTGTTGTAAAGACCTCATGACATCAAAGAGTATNGCACTGGTAATTGCTCCCNTCTGTTTCATGATGGCTTTCCCTCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTATTTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTANNNNNCCGGCTAGGGAAAAAAAAAATGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATNTGAAAT
  3   1   2       chi Tad2      in                    IMAGE:6873596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAATATTTTTTTTCCGGGAATTAGGGAACCACGGTAGGAATCTCAATATTTTTATGCCCTGTTTTGTTGTAAAGCCCTCCTGCCATCAAAGAGGTATTGCACTGGAAATTGCTCCTTTCTGTTTCAGGAGGGCTTTCCCTCCTGTTTCAGGATGGTTTTCCCTCCCCCCCTTTCCTTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTCCCTCCAATAGGTTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTGGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTTTGTGCCCACCCTTTTGCACATTAATTGTACAACTCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTTTTTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCCCCGGCTAGGAAAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTTTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACATG
  3   1   2       bld Emb9      in                    IMAGE:7975081.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGAATCTCAATAATTATATAGCCTTGCTATGTTGTAAAGACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAACTCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTCTTACTGGCAAAAGTAAAATT
  5  -1   2       bld Emb9      in                    IMAGE:7975081.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGTATGCTTGCTTGTTGTAAGACCTCTGACATCAAAGAGTATGCCACTGTAAATGCTcccttttgtttcatgatggttttcctccccccctttcccttttttctATCAAAGAGGGTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAACTCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCGGaaaaaaaaaaaaaaaaaaaTCCCGGGAATC
  5   1   2       bld Skin                            IMAGE:8642073.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GACCTCATGACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTTCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACTGGCTAGGGaaaaaaaaaaTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAACTGAGATTGTCTGGTGTGTTGCTCCATAGATTTGAATGATTCTGTACTGCAAGTAAGCCAATCTGGaaaaaaaaaaaaaaaaaaaGGCGGCGCAAGCTGAATCCAGACGCGCTCACTCTCCCTAATGATCTATACTAATCGACTGAAGATCTGAGATTGACACCACTGAGATGAAATGTTTTGA
  5   1   2       bld Emb4                            IMAGE:4959048.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACATCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTccccccccTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTTCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACTGGCTAGGGaaaaaaaaaTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACAC
  3   1   2       bld DMZ  5g3  in                         xl274l09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAAAGAGTATTGCACTGGTAATTGCTCCCTTCTGTTTCATGATGGCTTTCCCTCCCCCCCCTTCCCTTTTTTCTATCAAAGAGGCTGCTGTTAAAAATAAGTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTGAA
  5   1   2       bld Ga15      in                       XL436k06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL436k06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCTATTTGTGCGGTTCTTTTTTCTGTTACCTCCAATAGGTTTTTTGAAGGCATCTAAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATCT
  5   1   2       bld Ga15                               XL458e14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAATGTTCTGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGAAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaaaGTTGGGCTGTAAACCACCTTTCTGTTTTAATCTAATAAAGTAACAAACNCAAAGTaaaataaaaaaaaaa
  3   1   2       bld Emb3                            IMAGE:3399364.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTTGAATCCAAAGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTCTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGGA
  3   1   2       bld Emb3      in                    IMAGE:3399365.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTGTAAACGATGTATCGATGTGCATATAATATTGCCATTTTAAGCTTGGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTCTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGGA
  3   1   2       add Neu7 5g3  in                         XL048i24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCANANAANATTGCCNTTTTAAGCTTGGTATTTTAATTTANAATTCNCCATGGTATTTTGCTTTGGAANCANCTAAAGGGGTTGTGGCCTGCAAGGAGTNTCCTTTGCCCCAGGAACAATTNTGNGCCCNCCCTTTTGCNCATTATTTGNACAAATCTTTTANCAATGAAGNGCCTNTCCANTACTGCTTTCTCCNCCCCTCGNANAGTCTGNACCCNATTCTCTNTGCCCTGTGNAACTCCTGGAGNGCCNTTNTCATGTTTTAAACTATTGCCCCCGGCTAGGAAAAAAAAAAAATGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTNCTGGTGTGTTGCTCCATAGAATT
  5  -1   2       bld Egg3      in                    IMAGE:3379186.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGTATTTTAATTTAGAATTCACCATGGTATTTTGCTTTGGAAGCAGCTAGAGGGGTTGTGGCCTGCAAGGAGTCTCCTTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAACTCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGG
  3   1   2       add Eye1      in                    IMAGE:4743398.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAGGGGTTGTGGCCTGCAAGAAGTCTCCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCCCATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCGTTAATGCTTTTTCCTCCCCTTGTATAGTTTGTACCCAATTCTCTATGCCCTGTGTAACTCCTGGAGTGCCATTTTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAAAGTTGGGCTGTAGACCACCTTTCTGTTTTAATGTAATAAAGTAACAAACACAAAGTATTACGCAAAAAAAAAAAAAAAAAA
  5   1   2       bld Emb1                   IMAGE:6636418-IMAGp.IMAGp                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAAAGGAGACTCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaGTTGGGCTGTAGACTACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGGaaaaaaaaaaaaaaa
  5   1   2       bld Emb1                            IMAGE:6636418.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACAGGAGACTCCTTGCCCCAGGAACAATTCTGTGCCCACCCTTTTGCACATTAATTGTACAAATCTTTTATCAATGAAGCGCCTCTCCATTACTGCTTTCTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGaaaaaaaaaGTTGGGCTGTAGACTACCTTTCTGCTTCAATCTAACAAAGTCACAAACCCAAAGTATTACCCAGGCAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTGCAGAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGACATCGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGGaaaaaaaaaaaaaaaaaaaaaGGGTGGCCCGCTCTACGAGTATCTCCTCGCAGGGGCCCCCCGGCTTACCGCGTACCCCAAGCTTTTCTTTGTACAAACGTGCCTCCCCTAATAGCCGACCTCCGCATTTATTAAAGCTAACGCCACCTGGGCCCGCTCGATTTTCTACAAAACGCTCCCGCGCACCTGTGCGCAAAAATCTGCCCTAAGCCCTTCGTCCCACCCTCTCTGCTTGAAAAGCGACAACTCTCTAACCCTCTCCCGGTGGGGCCCGTCGGGAACCATTATAATTTCGCGAGACCAACAGACTCTTCTAATCCCTTAAACAAGGTAAAGNGAATCTCCTTACAGAAACACCCCCCCTGCTAAAAAGGGGCGCTACACGCATTTACATTTTCTATCACACCGTGTTTTCTTTCTGAAAAAGTGACGGCATATAATCCACAATTGGTGGGGCTCTCCACCAACAAACTTATAGTGCTTTGCGCCCAATAACTGCGCCATTCTGGACTTTCGCGCCTATCGGACAACAACCCTATTCTTTGACGCTCTTTCCCCTGGCCAAAGGATATGTAACTCCTCCACCCGGATAAAAATTAATTCTCACTCACCCTCATGGGGAGACACCTTTAGTTGGCACACCCCCAACAATTTGCGCATTCGCCGCCCAACCTCTCTAAAAATTTTGCAACAGAGACCCCCAAGGGGTTTTTATTTTCACACGCGCTCCACTCACGATCCCTCCACCAGGTTCTGCGTTCCAGTGAAACCCCCTACAGCCGCGCCCATCAACACCT
  3   1   2       add Sp1  5g3  in                    IMAGE:4968535.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCCTCCCCTCGTATAGTCTGTACCCAATTCTCTCTGCCCTGTGTAACTCCTGGAGTGCCATTCTCATGTTTTAAACTATTGCCACCGGCTAGGGAAAAAAAAAAAAGTTGGGCTGTAGACCACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTTGAAAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTTGAAATGATTTCTGTACTGCAAAGTAAAGCCAAATTCTGGAAAAAAAAAAAAAAAG
  3   1   2       add DMZ  5g3  in                         xl321g01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCNTTNTCNTGTTTTAAACTATTGCCCCCGGNTAGGGAAAAAAAAAAAGTTGGGCTGTAGACCACCTTTCTGTTTTAATCTAATAAAGTAACAAACACAAAGTATTACGCAGGTAAGGCTTGGACGCATTTTTCTAAACACTGTTGCAACTCTTTGAAAGGACCAAACTGAGAATTGTCTGGTGTGTTGCTCCATAGAATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)