Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7393809.5                      75 PI      91         26     1442                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012769166 Xl3.1-IMAGE:6951084.5 - 45 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                     2     4     5     8     8    10    13    15    15    18    16    18    20    22    20    22    20    22    20    22    22    25    23    25    23    25    22    25    25    25    25    25    25    25    25    25    25    25    25    25    25    25    26    26    26    26    26    26    26    26    26    26    26    26    26    26    24    27    28    29    28    29    27    30    29    31    27    31    29    30    29    30    29    30    29    30    29    30    28    31    28    31    25    31    26    31    25    30    26    30    24    32    25    32    25    32    25    33    21    33    22    32    23    32    21    31    20    31    18    31    19    30    17    29    17    30    17    30    16    28    18    29    17    27    13    27    13    25    12    24    11    24     9    23     9    22     9    21     9    19     9    18     9    18     9    17    10    17    10    16    10    17    13    17    12    18    13    18    13    18    13    18    11    18    13    18    12    19    14    19    12    15    12    14    12    14    10    14    14    15    14    15    14    15    14    15    13    14    13    14    13    14    13    14    11    14    13    14    13    14    13    14    13    14    13    13    13    13    13    13    12    13     9    12     9    12     9    12     9    12     8    12     9    12     9    12     9    12     9    12     9    12     9    12     8    12     6    11     7     9     4     6     3     5
                                                                   SNP                                                                                                                                        ----------G-
                                                                   SNP                                                                                                                                                    -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -G----------
                                               BLH ATG     101    1915                
                                               BLH MIN      80     319                
                                               BLH MPR      71     319                
                                               BLH OVR     101      20                
                                               EST CLI      13      10                
                                               ORF LNG     101       1                
  5   1   2       bld Ga12      in                         XL192c20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGAGGAAGCGGNCGACCTCTTCCTGGACACGGTCTCCACATTCACATCGTATGAACTGATGGACTACAAAACCTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGC
  3   1   2       bld Ga12      in                         XL192c20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCACATTCACATCGTATGAACTGATGGACTACAAANCNTTCGTCACTTACACCGTGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGA
  3   1   2       bld Tbd7      in                         XL092e02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTATGTCAGTATGATTGCCCTCGACCGGCCAGACCTCAGAGAGAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGATTTTACAGAACGTAAACAATCCAGCGATGCTAAAAGAAGACAAAAAATAAAAAAA
  3   1   2       bld Tbd2 5g3  in                    IMAGE:3199866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGCCTCCGACCGGCAGACCTCAGAGATAAGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTTTGCCCACAGTCNGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCTCGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGAC
  3   1   2       bld Tbd7      in                         XL064o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAGAGAAGGGTTATTAAAGGAGCAGAGATCCTAGAGGTGCTACACAGTNTTGCCCACAGTCCGGCAGTATCTGTTCTCACTGTACGAGTGTCGCTACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTNTACGATTTTACAGAACGTAAACAATNCCAGCGNATGCTAAA
  3   1   2       bld Egg6      in                    IMAGE:4435158.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTCCGTCTTCTTCCAGTCCCTGGCTGCTGTGGAACAGGAACTGAAGAAGGACTGGCTGTTTGCCTCTCACTATCGCTACTACGTGAGGGAGATGCGGATCCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTGAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAG
  3   1   2       bld Egg6 5g3  in                    IMAGE:4434444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTTCCAGTCCCTGGTGCTGGGGACCAGGAATTAGGAAGGACTGCGTTTCCCTCCACTATCGCTACTACTGGGGGAGATGCGGATCCAGGCGTCCGGTCAGCTGCTCGAGTCCTACCCTTCACTAACACTGGGGTACATGGCCGAGGCTTTTGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGC
  5   1   2       bld Emb1                            IMAGE:5155144.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGACGCGTGGGCAGGCGTACGGTCAGCTGCTCGAGTCCTACCGCTCACTAACACTGGGGTACATGGCCGAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAATCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACTTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTGAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGACaaaaaaaaaaaaaaaGG
  5   1   2       bld Emb1                            IMAGE:6632756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGCTTTTGGTGTCGGAGTGGAGTTCATAGACCAGGAACTCTCCAGGTTTATAGCGGCGGGACGGTTACACTGCAAGATCGACAAAGTCAACGAGATCGTAGAGACCAACCGACCCGACAGCAAGAACTGGCAGTACCAAGAGACGATAAAGAAGGGCGACCTGTTACTGAACCGAGTACAGAAGCTCTCCCGGGTCATCAACATGTAGCTCCTCGCGGCGTCGCTTCGATTTCCTTTTTTTATTATTGCGGGAGAATTGGATTAAGGTGTAGAAACCCGACTGGAGCCGTGTATAATATCCCGTCTTATTACTCCCTGTTGTGTGACGTGTACCAAGGCCTGTAGTTAGGGGGTTTTTACGGTTTTACAGAACGTAAACAATCCAGCGATTGCTAAAAGAAGACaaaaaataaaaaaaacaaaaaaaaaaaaaaaaG

In case of problems mail me! (