Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 07 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:7973876.3                     924 PI      76         26      737                (no blast hit)
     2   0.0    0Xl3.1-XL438p03ex.5                        566 PI      90        583      732                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:6859211.5                     558 PI      89        566      732                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:8640907.5                      32 PI      85        442     1186                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012769178 Xl3.1-IMAGE:8640967.5 - 54 ESTs
                                                                       .....-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8640967.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAAACTAAGGCTTGATGGAGAGTTAAGAAATATGCAAGACTTGGTCGATGACTTCAAAAACAAATATGAAGATGAAATTAATAAGAGAACATCAGCAGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGCGGATGCTTTGACAGATGAACTCAACTTCCTGAGGACCTTCTTTGAAGCAGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGACATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTAGGAGGAGGAGGAGGAGGTGGATCTGGAGCAGGCTTCGGCTTTGGAAGTGGTGGTGGAGGCTTCGGTGGAAGTGGTGGTGGAGCCTTCAGTGGAAGTGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTAAATGTGCACTGAGCTTAAGCATTGTGGCACAATAA
                                                  Xl3.1-CHK-1012686530                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGGCTTGATGGAGAGTTAAGAAATATGCAAGACTTGGTCGATGACTTCAAAAACAAATATGAAGATGAAATTAATAAGAGAACATCAGCAGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGCGGATGCTTTGACAGATGAACTCAACTTCCTGAGGACCTTCTTTGAAGCAGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGATATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTAGGAGGAGGAGGAGGAGGTGGATCTGGAGCAGGCTTCGGCTTTGGAAGTGGTGGTGGAGGCTTCGGTGGAAGTGGTGGTGGAGCCTTCAGTGGAAGTGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTAAATGTGCACTGAGCTTAAGCATTGTGGCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     4     7     6     7     6     7     6     7     6     7     6     7     6     7     8     9     8     9     8     9     6     9     8     8    12    12    12    12    10    12    12    12    12    12    13    13    13    13    13    13    15    17    16    18    17    20    22    22    22    22    17    22    22    22    22    22    22    22    21    23    22    24    20    25    20    25    23    25    23    25    23    25    23    25    22    26    23    27    23    27    21    27    21    27    21    27    21    28    21    28    21    28    22    29    21    29    23    30    21    28    20    28    20    30    19    32    22    36    24    38    25    40    28    41    31    42    36    46    36    46    37    46    37    46    38    46    40    46    38    46    39    46    38    46    37    45    36    45    35    45    35    45    36    45    35    44    34    44    34    43    34    43    34    43    34    41    34    41    32    41    32    40    26    40    26    40    25    40    26    39    26    38    25    35    26    35    25    35    24    33    24    32    24    31    27    32    25    30    25    30    25    30    25    29    25    28    25    28    25    28    26    28    25    28    24    28    24    28    22    27    22    27    22    27    21    27    21    27    20    26    18    26    16    26    12    24     9    23     5    23     3    23
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTCATTCATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------C---A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------TG----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------A-G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------C----A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ---GT-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ----C----C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --CG--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ----------GA
  5   1   2       add Tail                            IMAGE:8546252.5p TAATNNTNCCCTACGTNNNNGGGAGTACCTAATTATATCGTCCCGTTTTGGTGGCGGAGTAGGTGGGggagcctttggaggagctggtggtgcctttggaggagctggtggtgcttttggaggagctggtggtggaggctttggaggttctggatttggaggctttggaggtgctggatttggaggctttggAGGCGCTGGCTTTCCTGGTGGACCATCAGCTGGTATACAAGAAGTTACTGTCAATCAAAGTCTTTTGGCACCACTGAACCTGGAAATTGATCCAACCATCCAGAAAGTTCGATTGGAGGAGAGAGAACAAATTAAAACTCTGAATAACAAATTTGCTTCTTTTATTGACAAGGTCCGCTTCCTTGAACAACAGAATAAGGTACTTGAAACTAAATGGACCTTATTGCAAGAACAAGGAGGCCAAGTTAAGGGGTCAAGAAGAGACAACATTGGGCCTCTTTTTGATGCCTATATCAACAGCCTCAAGAGGCAGCAGGATGCTTTGCAAAATGATAAACTAAGGCTTGATGGAGAGTTAAGAAATATGCAAGACTTGGTCGATGACTTCAAAAACAAATATGAAGATGAAATTAATAAGAGAACATCAGCAGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGCGGATGCTTTGACAGATGAAACTCACTTCCCTGAGACCTCTTTTGAGCGAATNGGTGAGTTGCNGCTCAGTCTCTGACACTCTGTTGTCCTGTCATGACATACCGAGCTTTGATCTGAAGCTATTCTGAGTGAGCTCGTTGAGATTACAAGAGACAACTGACTGATCTGTACAGCAGTCAGATCA
  5   1   2       add Skin                            IMAGE:8644916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCAGCAGGATGCTTTGCAAATGATAAACTAAGGCTTGATGGAGAGTTAAGAAATATGCAAGACTTGGTCGATGACTTCAAAAACAAATATGAAGATGAAATTAATAAGAGAACATCAGCAGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCGAAAGCGGATGCTTTGACAGATGAACTCAACTTCTTGAGGACCTTCTTTGAAGCAGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATTTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGATATAGCGAAGAAAAGCAGAGCTGAAGCTGATGCTGTTTACCAAGGCAAGTTTCAAGAGTTGCAAGCATCTGCAGGTGAACAAGGAGATGTCCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGCATCTATTACTGAAGCAGAGGAGCGTGGGGATCTTGTACTNGAAGATGCTCAGTCCCAACTTGCTGAACTGGAGGCCGCTCTGCAGAAGGCCAACAGGACATGGCTCTCAGCTGCGCGAATACCAGGACTGATGATGTGAACTGGCTCTGGATGTGAATGCTACTACAGAAACTGCTGGAGGCGAGAAATCAGCTATCAGAGTCATATGTCGCATTCGTCATACTCCGTGCAAGTCCTagagagagagagaCAGCTCGCTTNGATGTGTGGCTCGTGATGTGG
  5   1   2       add Tail                            IMAGE:8545680.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTAAGGCTTGATGGAGAGTTAAGAAATATGCAAGACTTGGTCGATGACTTCAAAAACAAATATGAAGATGAAATTAATAAGAGAACATCAGCAGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGCGGATGCTTTGACAGATGAACTCAACTTCCTGAGGACCTTCTTTGAAGCCGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGATATAGCAAAGAAGAGCAGAGCTGAAGCTGATGCTGTTTACCAAGGCAAGGTTCAAGAGTTGCAAGCATCTGCAGGTGAACAAGGAGATGTCCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAAATGTGAACTGGCTCTGGATGTTGAAATGCTACTTACAGAAACTGCTGGAAGCGAAGAATCANNGCTAATCAGATGTCATATGTCACATTCTGCATAGCTCGGTGCAAAGTCCCCTagagagagagagaCAGCTCGCTTGAATGTGTG
  5   1   2       bld Tail      in                    IMAGE:8542752.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAAATATGCAAGACTTGGTCGATGACTTCAAAAATAAATACGAAGATGAAATTAACAAGAGAACATCAGCAGAAAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTTCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGTAGATGCTCTGACAGATGAACTCAACTTCCTGAGGACCTTCTTTGAAGCTGAACTGGGTGAGTTGCAGGCTCAGAACTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATCATCACTGAGGTGAAGGCTCAGTATGAAGACATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATT
  5   1   2       add Skin                            IMAGE:8644391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGAGAATGAGTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCCAAAGCGGATGCTTTGACAGATGAACTCAACTTCCTGAGGACCTTCTTTGAAGCCGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGATATAGCAAAGAAGAGCAGAGCTGAAGCTGATGCTGTTTACCAAGGCAAGGTTCAAGAGTTGCAAGCATCTGCAGGTGAACAAGGAGATGTCCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGTATCTATTACTGAAGCAGAGGAACGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGACCTGGAAGCCGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGAAAACTGCTGGAAGGCGAAGAATTCANGGCTTATTCAGATGTNCATAATGTCAGCATTTCTGTCATTAGCTCCGGTGGCAAAGTTTCCTANGANGGNAGAGAGGAGGAGCAGGCTTCNGCTTTGNAAGTGTGTGGTGCCTTCGTGGAANGTGTGCGTGCCTTCGTGAA
  5   1   2       add Skin                            IMAGE:8642675.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTTGTTGTTATTAAGAAGGATGTGGATGCTGCTTACATGGGCAAGGTGGAACTGGAAGCGAAAGCGGATGCTTTGACAGATGAACTCAACTTCTTGAGGACCTTCTTTGAAGCAGAACGGGGTGAGTTGCAGGCTCAGATCTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATTTGGAAAGCATAATTTCTGAGGTGAAGGCTCAGTATGAAGATATAGCGAAGAAAAGCAGAGCTGAAGCTGATGCTGTTTACCAAGGCAAGTTTCAAGAGTTGCAAGCATCTGCAGGTGAACAAGGAGATGTCCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAACCGTAAATCCCAGAGACTAAAAGCTGAAATTGAAAATGTGAAGAAACAGATCGCCAAGCTGCAAGCATCTATTACTGAAGCAGAGGAGCGTGGGGATCTTGTACTGAAAGATGCTCAGTCCAAACTTGCTGAACTGGAGGCCGCTCTGCAGAAGGCCAAACAGGACATGGCTCTCCAGCTGCGCGAATACCAGGAACTGATGAATGTGAAACTGGCTCTGGATGTTGAAATTGCTACTTACAGANACTGCTGGAAGGCGAAGATTCAGGCTTATTCAGATGTCAAATGTCAGCTTTCTGTCATAGCTCGGTGGCAAGTCCCCTagagagagagagaCAGCTCGGCTTGAGTGTGTGTGCTTCGTGAATGTGCGTGCTCGTGAATATGCGGCTACGGATGTGGCACGTGATGTGGCTCGGATGGGGTCCTGGGGGGTTCCTGCCGGGAGAC
  5   1   2       add Skin                            IMAGE:8644100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCAACTTCCTGAGGACCTTCTTTGAAGCTGAACTGGGTGAGTTGCAGGCTCAGAACTCTGACACCTCTGTTGTCCTGTCCATGGACAATAACCGAGCTTTGGATCTGGAAAGCATCATCACTGAGGTGAAGGCTCAGTATGAAGACATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggangtggatctggancaggcttcggctttggagtggtggtggaggctcngtggaanntgtgtggagcttcnatggagtggtgtgggagctttgtggaGTGGTGCATGCTTTGGTGCAGTGGCTTCTTTGTCAGAGTGGCGATCACTCTCAGCTCCATTGGTGTGCTCGCGCGGGGAGATTCTCACAGTCGCTACGATATCAGTCTGAAGAGAA
  5   1   2       bld Tail      in                    IMAGE:8543251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGAAGCATCATCACTGAGGTGAAGGCTCAGTATGAAGACATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAAGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcngtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggCAGTGCCTTTGGTGGCAGTGGCCTTTCCNNTTGCTCANGANGTGGCGGATTCAGCTCCTCAGCTCCTCATTTGGTGGTGCGTCAGCAGCGGTGTGAGATTTTCTTCAGCAAGTCAGCTCAGGAGTTAATCAGTCTGAATGAGCAATATCATGCAGACACATAATCATGCTGTATACGATACTGCCTCAGTGC
  5   1   2       bld Skin      in                    IMAGE:8641696.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAAGCATCATCACTGAGGTGAAGGCTCAGTATGAAGACATAGCAAAGAAGAGCAGAGCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTNCAGCTCCCTCATTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTCTTCCCAGCAGTCAGCTACAGGAGTTAATCAGTC
  5   1   2       bld Skin                            IMAGE:8643446.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAAATCAGTCATGAAATGAGGCAAATATCAGTGCC
  5   1   2       bld Skin                            IMAGE:8644263.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGTGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAAGTGGCGGATTCAGCTCCTCAAGCTCCTCATTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTCTTCCGCAAGTCCGCTCCGGAGTAATCAATCATGAATGAGGCAAATCCGTGCCCGAAAAATAATTATTGCTGTTAATCAATCGCGTTTAGTGGGAAAATCCGTCTGCAACCTCTAGACTCTTTTAACAACTGTTCCTAGTTTCCAAGGGGGTGTCAG
  5   1   2       chi Skin                            IMAGE:8642806.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCACAGGTCAATAATTTCGGCATCTCTGTCTTCATCTCTGGAGAGGAAAGTTCCTTTGAAGGAGGAAGATGAAGTGCTATATATACTCACTTTTGGTTCATTATTCCGGTTGGCAAATGTTTGCTTTGTAGCTCTCTACTCTGTCATGTGGTATAATCAttttttttCTGATAGTACTGATTTTGATTCTCTTGTGACGATTTGGCTAAAGGGTTATTTCATGTTTTGTCTTGCTTCTTATTTTTTGTCTTCGTAGATGTTTGATATTTAGCTTTTCTGTTTCATGTGCTGCCCCTCTGCTTTTAGGTATTTTATCTACTTTGGGTTAGTATTCGTCTTTCTGAGTTGTTGTTTGTCCATTGTTACTTTTTCTTTCTATATTACTGTTTCTTTCTCTTCGCTGAT
  5   1   2       bld Skin                            IMAGE:8644385.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGAAGCTGAATCTGTTTACCAGGACAAGGTTCAAGCATTGCAAGCATCTGCAGGCGAACAAGGAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGTGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTTCAGCAGTCAGCTACAGGAGTTAATCAGTCATGAAATGAGCAATATCAGTGCCAGAACACATATTCATTTGCTGTATACGATCTGCGCTTCAGTGCGTAACATCTGTCTGCGATCCAC
  5   1   2       bld Skin                            IMAGE:8641361.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAGATGTTCTGCGCAATACAAAGAATGAGATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAAACACATATTCATTGCCTGTNATACAGATACTGCGCTTCAGTGCTGTAACATCTGTCTGCGATCCATCTCTGACTTCTCTTTAGCAACACTGTTCACTAGGCTTTCGCATANGGCTGCTTCAACTGTCCTCAGCTGTCGTCNGAAAAAGATTATTTGACATGTAA
  5   1   2       bld Skin                            IMAGE:8644216.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTGCATGTTCTGGCNGTCCATCGATTGAATTCGTCCCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCCTTGCCTGTTATACAGATACTGCGCTTCAGTTGCTGTAACATTCTGTTCGCAATCCATCTTCAGACTTTTCTTAAGCAACCATGTTCCATAAAGCTTTCCGAAACGTGCGTCTCCATATGTCTTACTATGTCGTCCGAAAAAGGTTCAATTGCCATTGTAAATACTATAATTACTGCTGCCTCTTTATCTCATTAT
  5   1   2       chi Skin                            IMAGE:8642295.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATCTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggcagtggcctttcctttggcTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGAAGCGGTGTGAGATTTTTCTCCCNCAAGTCCAGCTACCGGAGTTATTTTGTCCTGAAATGACGCAATGACCTTGCCTGAACACATAAATCATGCCTGCTTTTTTCATACGCGCTTTCATTGAGTTTAATTTTTCCGCTATGCCTCTCTGATTTCTTATTAGCACTATTTTCCCTATGATTTTCAAAAGGCTATTTCCTGCTGTTTCCCTTTTGTCAGCTAAGTATACTTTTCATGTATACCATT
  5   1   2       bld Skin      in                    IMAGE:8640827.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTCCTTATGGGGGGTCACAACGATTCGATTCGTCCCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTAGGAGGAGGAGGTGGATCTGGAGCAGGCTTCGGCTTTGgaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtgGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGACATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAACGCTTTTCCGCAATAAGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTCTGCAGAGAAAAAGATTTACATTTTTTGACAACTGataaaaataaacatataaaaatataCATGCATGCACATTCTGTACATGCCTCCGATGTATCCTATGGCAGTTTGGGTTATCTCATATGTGCCAATACTGCCCCAAT
  5   1   2       bld Skin                            IMAGE:8644303.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCAGAGCTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGCTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTAGGAGGAGGAGGTGGATCTGGAGCAGGCTTCGGCTTTGGaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGACATGAAATGAGGCAAATATCAGTGCCCAGAACACTATTATTCATTGCTTGGTTATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCTCATGACTTTCTCTTTTAAGCAAACCATGTTTCACTAAGGCTTTTCCCAATAGGTGCTGTATTCCTA
  5   1   2       bld Skin                            IMAGE:8642603.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTCAATCGTACAGCCCAGAGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAAACACATAATTCATTGCCCTGTTATACAGATACTGCGCTTTCAGTTGCTGTAACATTTCTGTCTGCAGATCCNATCTCATGACTTCTCTTTTAGCAACACATGTTTCACTAGGCTTTNCGCATANGTGCTGCATCATACTGTCCTCAGCATGCTGTCAGAGAAAAGATTAATTTTGACAATGTAAATACTATAATATCATGA
  5   1   2       bld Skin                            IMAGE:8644972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGACTGAAAGCTGAAATTGGAAATGTGAAGAAACAGATCGTCAAGCTACAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGTGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAACACATGTTTCCACTAAGGCTTTTCCCGCATAAGTGCTGTCATCCATACTGTCTCTCAG
  5   1   2       bld Skin      in                    IMAGE:8640967.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAGCTGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAACACATGTTTCCACTAGGCTTTCCCGCATAGGTGCTGTCATTCATACTGTCTCTCA
  5   1   2       bld Skin                            IMAGE:8644924.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAACACATGTTTCCACTAGGCTTTTTCGCATAGGTGCTGTCATTCATACTGTCTCTCAGCATGTCTGTGCAGAGAAAAAGATTAAATTTTGACAAATGTAAA
  5   1   2       bld Skin      in                    IMAGE:8641916.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATTGGAAATGTGAAGAAACAGATCGCCAAGCTGCAGGCATCTATTACTGAAGCAGAGGAGCGAGGGGATCTTGTTCTGAAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAACACATGTTTCACTANGGCTTTTTCGCATANGTGCTGTCATTCATACTGTCTCTCAGCATGTCTGTGCAGAGAAAAAGATTNNAATTTTGACAATGGTAAAATACTATAAATATCATGCATGC
  5   1   2       bld Skin                            IMAGE:8642160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTTCTGAAGATGCTCAAACCAAACTCGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAACTGCTGGAAGGGGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAACACATGTTTCCACTAAAGTTTTCCGCATAAGGTGCTGTCTTCCATACTTGCTCTAAGCATGTCGGTGCAgaaaaaaggattaaaatttttcaaatggtaaaaataactttaaaaaTACATGGAGCCATCCTGTAATGCTCCATGTATCTATG
  5   1   2       chi Skin                            IMAGE:8645029.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCGCCATCCTAATAAAGATCTGATCTTTTTATAACATGGCAGGGGGTTTGCCATGTGCAAATTTTGCTCCAATTCGAGTAAAGCAAAACAGCAGATATATTTTTGTTATCTTTCAGCTGAATGCAAATATCTGATTGCTATGATTTACTTTACCTTGAGCAAACTTTGAGACCGTTCTTTTCTGTTTGTTTCATAGCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAACACATGTTTCCACTAAGGCTTTTCCGCATAAGTGCTGTCATTCATACTGTCTCTCAGCATGTCTGTGCAGAGAAAAAGGGATTAATTTTGACAAATGTAAAAATAAACTATAAATATACATGCATGCCATCTGTACATGCTCCATGTATCTATGCCGTTGGGTATCCAAGTGCATCTGCCA
  5   1   2       bld Skin                            IMAGE:8644646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAACCAACTTGCTGAGCTGGAGGTTGCTCTGCAGAAGGCCAAGCAGGACATGGCTCTCCAGTTGAGGGAATACCAGGAACTGATGAATGTGAAACTGGCCCTGGATGTTGAAATTGCTACTTACAGGAAGCTGCTGGAAGGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGNCATAAGGTGCTGTCATTCCATACTTGTCTCTNCAGCATTGTCTGTGCAGGAGAAAAAGGATTTAAATTTTTGACAAATGGTAAAAATANNACTATAAAATATACATGCATGCA
  3   1   2       bld Tail      in                    IMAGE:8543251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTTGAGAGGAAATAATCCCAGACCTGAATGAATTGGACTGCCGTGAGTGAATGGCTACTACAAGGAAACTGCTGGAAGGAGAAAGAGAAGCCAGGATATCCAGATGTCAATAATTCAGCATCTCGTCATCAGCTCTGAGCAAAAGTCCCTAGGAGAGGAGAGGAGTGATCTGGAGCAGGCTCGGCTTTGGAAGTGTGGTGAGGCTTCGGTGGAAGTGGTGGTGGAGCTTCAGTGGAAGTGGTGGTGGAGCCTTTTGGTGGAAGTGGTGGCAGTGCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAGAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCATGTACAATGTGCACGGAGCATAAGCATGGCGGAAAAAATATAACAAATAG
  5   1   2       bld Skin      in                    IMAGE:8640486.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTGCCGTATTGAATTTGGTTTTTTCTAGTTTTTCGAATTCGTCCCCTAGGAAGAGAGAAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGTAAAACGATCGACGCAGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATGTAAGCATTTGACACTTTTTTCTCTCGATTTGTAATTCCACCCACTAGGGGATACTGTATGTTTCTATAATGTGCACTGAACTTAGCAATTGTGGCCAAAATTAACATATCTGCTGCCA
  5   1   2       bld Skin      in                    IMAGE:8641259.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAGAGCAGGATTAATTCAGATGTCAATAATTTCAGCATCTCTGTCATCAGCTCTGGAGGCAAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggctttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTTCCGCATAAGGTGCTGTCATTCCATACTTGTCTCTCNAGCATTGTCTGTGCAGGAgaaaaaaggatttaaatttttgacaaatggtaaaaataacatattaaaataatCATGCATGCCATCCTGTACATGCTTCCATGTAATCTATGCAATTGGGTATTCCTAGTGCATCTGCCATTTCGCTCTAAGTAACATCACCCGTCTGCTGGGCAACAACACTGACACTTGTACATGACCTTTCCCCATGAATCCC
  3   1   2       bld Skin      in                    IMAGE:8640827.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAACTTAACAGAACTGCTGAAGAGAAGAGAGGCAAGATATCAGATGTCATAATTCAGCATCTCGTCATCAGCTCTGAGCAAAGTCCTAGAGAGAGTGGATCTGAGCAGGCTCGGCTTTGGAAGTGTGTGGAGGCTTCGGTGGAAGTGGTGGTGGAGCTTCAGTGGAAGTGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGACATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTCTGCAGGAGAAAAAAGGATTTACAATTTTTGACAAACTGATAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATACTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGCCACCTTTTTTCCTCCACGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTGTAAATGTGCACTGAGCTTAAGCATTGGACAACAAAGTTTTAAGCCCACC
  3   1   2       bld Skin                            IMAGE:8640620.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCATTTCGTCATCAGGCTCGAAGCAAAAGTTCCCTAGAGAGAAGAGAGTGGATCTGTAGCAAGCTTCGGCTTTGGAAGTGGTGTGAAGGCTTCGGTGGAAAGTGTGGTGGAGCTTCAGTGGAAGTGGTTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGT
  5   1   2       bld Skin      in                    IMAGE:8640895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGCAAAGTTCCCTaggaggaggaggaggaggtggatctggagcaggcttcggctttggaagtggtggtggaggcttcggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataatACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATGTGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAACAGAACAAACATGAGCATCATTGTTAGCTTTGACACTTTTTCCTCTCGATTGT
  5   1   2       chi Tad2                            IMAGE:6876252.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTATTAAGAAGGATGTGGATGCTTCTTACATAGGCTTCGGtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggcagtggcctttcctttggCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGACATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCTCGTGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTCTGCAGGAGAAAAAAGGATTTACAATTTTTGACAAACTgataaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCCATTGTAATCCTAATTGCAAATTTGGGGGTTATTCCTCATATGTGGCAAATACTGGCCCCATTTTCTGCTTCCTAAAAGGGAAAAAACGATCCACCCCAGGGTCCCTGCAAGTGGGCCCCAAACAGGAAGCCAAACATTGAGCAAATCATTTGGTTAAGCCATTTTGCCAACCCTTTTTTTCCCTCCACCAAATTTGGTAAAATTcccccccccccTCAGGGGGGAATACCCGGGCTATGGGCTTCCCGGGAAAATGGGGGCCCCTTGAGGTTTTATAAGCCAGTCC
  3   1   2       bld Skin      in                    IMAGE:8640967.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCAGCTTCGGCTTGAAGTGTGGGTGGAGGCTTGTGGNAAGTGTGTGGGAGCCTTCAGTGGAAGTGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTAAATGTGCACGAGCTAAGCATGGCCCAAAACACCTTNNNNNNAAAGAA
  3   1   2       bld Skin      in                    IMAGE:8640486.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCGGGAGCAAGCTTCGGACTTGAAGTGGTGGTGGAGGCTCGTTGATTGTGGTGGAGCTCAGTGAAAGTGGTTGGTGGAGCTTGTGGAGTTGTGGCAGTGCCTTTGTGGCAGTGCTTCTTTGGCTCAGGAGGTGGCGGATCAGCTCCTCAGCTCCTCATTTGGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTATAAAATGCCT
  3   1   2       bld Skin      in                    IMAGE:8640895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGCTCGGCTTTGAAGTGTGTGGGAGGCTCGGTGGAAGTGGTGTGGAGCCTTCAGTGAAGTGGTGTGGGAGCCTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATGTGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTATAAATGTGCACGAGCTAAGCATGTGCAAAAAACAATCCCATTNNNNNNNTTTGG
  3   1   2       bld Skin      in                    IMAGE:8641259.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATGTGGTGGAGGCTTTGTGGAAGTGGTGGGGAGCTTTCAGTGAAGGGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTGGTGGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTAAATGTGCACTGAGCTAAGCATGCGCACATNCCATCCCGATTNNNTAAAGG
  5   1   2      seed Skin                            IMAGE:8643293.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTGGAGGCTTCGGTGGaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataatACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATG
  3   1   2       add Tail      in                    IMAGE:8542752.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAACCGTTCGCTTGATGTGTGAAGCTCGTGAATGGTGTGTGACTCATGGATGGTGTGTGGACTATGATGGTGGCAGGCTTTGTGGCATGGCATTCTCGTCAGAAGGTGGGCGGATCAGCCCTCCAAAGCTCCCTCCATTTGGGGGGTGGGCGTCAGCAGCGGTGTGAGGATTTTCTTCCAGCAGTCCAGCTACAGGAGTTAATCAGTCATGAAATGAGGCAAATATTCAGTGCCCAGAAACACAATAATTCATTGCCTGTTAATACAGCTACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATACTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGCCACCTTTTTTCCTCCACGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTGTAAATGTGCACTGAGCTTAAGCTTTGGGCAAAAAAAAAACATTTTTTAAGTA
  5   1   2       bld Skin                            IMAGE:8644093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGCTttggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggcagtggCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAACAGAAGCAACATGAGCATCATTGTTAGCATTTGACACTTTTTCACTCGATTGTAATTCCACACTANGGGATATGTATGTTCGTAATGGCATGACTAGCATGTGCAAATAACTATCTGCTCATTaaaaaaaaaaaaaaaaaGGCGCCAGCTGATTCAACGGTCGCTTGCTATGATCATCTACGACGAGACTGTATGAACACA
  3   1   2       bld Skin      in                    IMAGE:8641696.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTTGGTGGAAGTGGTGGTGAGCCCTTCAGTGGAAGTGGTGGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTAGGTTCTGTAAATGTGCACGAGCTTAGCATGTGCCCANNNNCCCCCGnnnnnnnnnnnAAATTAA
  5   1   2       bld Skin      in                    IMAGE:8641980.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCggtggaagtggtggtggagccttcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtggcagtggCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTATAAATGTGCACTGAGCTTAAGCATTGTGGCAAAATAANNCATATCCTGCTGNCATATAAAAA
  3   1   2       bld Skin      in                    IMAGE:8641980.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCTTCGGGGAAGGGGGGTGGAGCTTCCAGTGGAAGTGGTGTGGACCCTTTGGTGGAAGTGGTGGCAGTGCCTTGGTGGCAGTGCCATTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTATAAATGGCACTGAGCTCAGCATGCGCCNNNNNNCNCCCCnnnnnnnnnnnAATCATT
  3   1   2       add Skin      in                    IMAGE:8641916.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGAAGTGGTGGTGGAGCTTTCAGTGAAGTGTGGTGGAGCTTTGGTGGAAGTGGTGGCCGTGCCTTGGTGGCAGTGCCTTTCTCTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTTTCCAGCAAGTCNATCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACAATTTTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATTCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGAAGGATAATGTTATGTTTCTGAAATGGCACGAGCTTAGCATGGCCnnnnnnCACCCGATTnnnnnnnCTGG
  3   1   2       bld Skin                            IMAGE:8641917.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTGGAGCTTCAGTTGAAAGTGTTGTGGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGCCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGAGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGAAATGGCACGAGCTAAGCCCGGCACANNNNCACCCCNATTTTTT
  5   1   2       bld Skin                            IMAGE:8643990.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTcagtggaagtggtggtggagcctttggtggaagtggtggcagtgcctttggtgGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACTCGATTTGTAATTCACCCACTANGGGGAAATGTTATGTTCTGTAATGTGCACTGAGCTAGCATGTGCACAATAACATATCCTGCGCATATaaaaaaaaaaaaaaaaaaaGGCGGCGCAGCTGAACTCAACGCGTCAGCTCTGCCAATGACGATACTAACGATGAAGAAG
  5   1   2       bld Skin                            IMAGE:8644152.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAGCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCACCCACTAGGGGGAATAATGTATGTTTCTGTAATGTGCACTGAGCTAAGCATTGTGCACAATAAACATAATCTGCTGCNTNTnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnGGGGCCGAGGG
  5   1   2       bld Skin                            IMAGE:8640189.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTAAATGTGCACTGAGCTTAAGCATTGTGGCACAATAAACATAATCCTGCTGCATATaaaaaaaaaaaaaaaaaaaaaGGGCGGCCGCAGGCTGATTCTCAGACGCGCTCGAGCTCTCGCTATATGAGCTATACTAATCAACTGAAGATCTGATATTGACA
  5   1   2       bld Skin                            IMAGE:8640213.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGATAATGTTATGTTTCTGTNAATGTGCACTGAGCTTAAGCATTGTGGCACAATAAACATATCCTGCTGCATATaaaaaaaaaaaaaaaaaaaaaaGGCGGCGCAGGCTGATTCTCAGACGCGCTCGAGCTCTCGCTATATGATCTATACTAATCAACTGAAGATCTGATGATGACACC
  5   1   2       bld Skin      in                    IMAGE:8640395.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCCTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAATTCCACCCACTAGGGGGATACTGTTATGTTCTATAATGTGCACTGAGCTTAGCATGTGGGCAAATAACATAATCTGCTGCATATaaaaaaaaaaaaaaaaaaaaGGGCGCGCAGGCTGAATCTCTAACGCGCTCACTCTCGCTAATGATCTATACTAATCGACTGAAATCTGTGATTGACACCATGATGAGAAATGCTATG
  5   1   2       bld Skin                            IMAGE:8643534.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTTGGTGGAAGTGGTGGCAGTGCCTTTGGTGGCAGTGGCCTTTCCTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTAAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGaaaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataataCAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCACCTCGATTTGTAAATTCCACCCACTAGGGGGAATATGTTATGTTTCTGTAAATGTGCACTGAGCTTAGCATTGTGGCACAAATAACATAATCCTGCTGCATATaaaaaaaaaaaaaaaaaaaaaaaaGGCGGCCGCAGGCTGATACTCTGACGCGCTCAGCTCTCGCTATATA
  3   1   2       bld Skin      in                    IMAGE:8640395.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTTGTGGAGTGGTGGCAGTGCCTTGGTGGCAGTGGCCTTTCNTTTGGCTCAGGAGGTGGCGGATTCAGCTCCTCAAGCTCCTCATTTGGTGGTGGCGTCAGCAGCGGTGTGAGATTTTCTTCCAGCAAGTCCAGCTACAGGAGTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAAAAAGGATTTAAAATTTTTGACAAAATGGTAAAAAATAAACATAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTATAAATGTGCACGAGCTTAAGCATGGGCANANNNNCCCCCCAATTnnnnnnnnTGGG
  5   1   2       bld Skin                            IMAGE:8644447.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTAATCAAGTCATGAAATGAGGCAAATATCAGTGCCCAGAACACAATAATTCATTGCCTGTTAATACAGATACTGCGCTTTCAGTTGCTGTAAACATTCTGTTCTGCAGATCCCATCCTCATGACTTTCTCTTTTAAGCAAACACATGTTTCCACTAAGGCTTTTCCGCAATAAGGTGCTGTCATTCCATACTTGTCTCTCAAGCATTGTCTGTGCAGGAGAAaaaaggatttaaaatttttgacaaaatggtaaaaaataaacataataaaaataatACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCACGTTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCATTTGACACCTTTTTTCCTCCTCGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTATAAATGTGCACTGAGCTTAAGCATTGTGGCAAAAATAAACATAATCCTGCTGCAATATAAATCCACTGTTCTGTCTTTTTTTAATTGTGAAATTGTTTTGGAAATATGTATAANAGAGTTAAAAGCTGCTGCAACAAAATCATATTTAATCAATNNCATCAATAAACATTCTACACAGTGCCACATTTCAGGGGTGTCCTCACCTTCCTCAAGCCAGTAACAACACATACTAATAGGAGTATATATAAAATAAGTGCAAAATCGGGTCACTT
  5   1   2       add Tad2                            IMAGE:6935896.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGGAATAAAAATAATACAATGCAATGCACATCCTTGTTACAATGCCTCCCAATTGTAATCCTAATTGCAAATTTGGGGTTATTCTCATATGTGGCAATCCTGCCCCATTTCTGCTTCATAAAGGTAAAACGATCGACGCAGGTCCCTGCAGTGGCACAAACAGAAGCAAACATGAGCAATCATTGTTAAGCACCTTTTTTCCTCCACGATTTGTAAATTCCACCCACTAGGGGGATACTGTTATGTTTCTGTAGATGTGCACTGAGCTTAAGCATTGTGGCACAAATAAACATAATCCTGCTGCAATATaaaaaaaaaaaaaaaaaaaaaaaaaaaCCTTGTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)