Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL044l07.3                            9 END     1           2       11                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-IMAGE:6946240.5.5                    26 PI      77        140      711                RAB3A, member RAS oncogene family [Xenopus laevis]
     3   0.0    0Xl3.1-IMAGE:7981748.5                       9 PI      93         41      763                (no blast hit)
     4   0.0    0Xl3.1-XL044l07.3                            9 PI      88        961     1584                (no blast hit)

 This cluster: approximate FL confidence score = 88%

 1012769184 Xl3.1-xl252b14.5 - 42 ESTs
                                                                       ........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xl3.1-xl252b14.5                                       AGGAGGGCAGGAAGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTTAATA
                                                  Xl3.1-CHK-1012687075                                             GCAGGAAGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTTAATAAAAGGA
                                                      consensus depths                                            2     2     5     5     5     5     5     6     6     7    12    12    13    13    14    15    15    17    17    20    18    21    18    21    21    21    21    21    21    21    21    21    21    21    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    21    21    21    21    22    22    23    23    23    23    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    24    22    24    24    24    23    23    22    23    22    23    22    23    23    24    23    24    21    22    20    22    19    23    19    23    18    23    18    23    17    21    17    22    16    21    13    21    11    20    11    20     6    19     6    20     6    19     6    21     7    20    10    21     9    19     9    19    10    19     9    17    10    16    10    15    12    15    13    16    13    15    14    15    14    14    14    14    13    14    14    14    13    14    14    15    12    14    13    14    16    17    16    17    15    17    16    17    16    18    16    18    16    18    16    17    16    18    17    18    16    18    17    18    17    18    17    18    16    17    16    16    16    16    15    16    16    16    16    16    16    16    15    16    15    16    13    16    13    16    13    15    13    15    13    15    12    15    13    15    13    15    13    15    13    15    12    15    12    15    12    14    12    14    12    14    11    13    11    13    10    12     9    12     5     8     3     6
                                                                   SNP                                                                                                                           -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                   ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                           ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -C----------
                                               BLH ATG     142     439                                       
                                               BLH MIN      55     139                                       
                                               BLH MPR      55     139                                       
                                               EST CLI       0       2                                       
  5   1   2      seed Te2N 5g                         IMAGE:7205642.5p AAGGCGCAGCcctgcagggagggagggagagagactgcaggagggcaggaaggagaCACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCAAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202373.5p                                       AGGAGGGCAGGAAGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAGAACACAGCAACTGCTCCTGGTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTTCTGATAGACTGCTTCTGGTTAGATGCTCTAGCATGGGCCCCCAGTGAACCTGCT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202915.5p                                               AGGAAGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCAAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGNAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCAAAAGACACAGGCACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATACCCACCCAATTCTGATAGACTGCCTCCTGTTAGATGCTCCAACAGGCCAACAAATGGAACTGCTGCTTCTAAAACGGGAACCAA
  5   1   2       bld Em10 5g                         IMAGE:7979369.5p                                                GGAAGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACACATCAATGTGAAGCAGTATTTGACGTTTAGTGGAATCATCTGTGAGAGATGACGAGAGCTGGAGATGGACTGTCCAGGAGTGCATGCCNACTCATGATCTGCCCAAGACACACACTGCTCTGTAACGCACGTCATAATACCACCATCGAGACGCTCGTAAGCTACAGCACATGATGTGCTAAGACACCTCTTTG
  5   1   2       bld DMZ  5g3  in                         xl261f15.5p                                                   AGGAGACACACCTCACTCCACTCAGGGAGAGACACCTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAA
  5   1   2       bld Em10 5x3                        IMAGE:7983573.5p                                                                      TCGGTCCGGATTCCCGGGATCAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAATCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCAT
  5   1   2       bld DMZ  5g3  in                         xl252b14.5p                                                                                      CTGCAAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAG
  5   1   2       bld Emb4 5x3                        IMAGE:4930786.5p                                                                                          AAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGATTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAAGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGGCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGAGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGCTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTATAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGGAGTGTCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGAGCACAGCCACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCNATTCTGATAGACTGCTTCCTGGTAAAATGCTCAGCATGGGCCAACCAGTGGAACTGCCTGCCTCTAAGAACGGGAGCCAACAGGCATTCCCTTTTAATTGGACCTTCCAACAAGCCAAATGGAAGGGGGGCATGGTG
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202945.5p                                                                                          AAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTNGCCAGCTCACTGAGTCTGCCCCCAAGACACAGCAACTGCTCCTGTTAGAACGCACCGTCAGTAAATTAACCCACCCATTCTGATAGACTGCTTCTGTTAGATGCTCAGCATGGCAACCAGTGAACTGCTGCTTCTAAAAAGGAGCCAACAGCATCCCCTTTATTGACCTTCCAACACCCCAATTAAGGGGGAA
  5   1   2       bld Te2N 5x3                        IMAGE:7768522.5p                                                                                          CAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCAAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCAGGGAGTGGCACTGCCAGCTCACTGAGTCTGCCCCCAAGACACAGCACTGCTCCTGTAGAACGCACGTCATAAATACCNACCCATCTGATGAT
  5   1   2       bld Em10 5g                         IMAGE:7983660.5p                                                                                          CAACACACAGATCCGGGACAGGCAGGAGACACCCGAGCAAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACACATCAATGTGAAGCAAGTATTTGAACGTTAGTGGAATCATCTGTGAGAGATGACGAGACCTGGAGATGGACTGTCCAGGAGTGGCCTGCCACTCACTGATCTGCCCCAAGACAACACACTGCTCTGTAGACGCACGTCGTAAATAC
  5   1   2       bld Brn3 5x3                        IMAGE:8538727.5p                                                                                           CAACCACAGATCCGGGACAGGCAGGAGACACCCGAGCAAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGNAGTGGCACTGCCAGCTCACTGAGTCTCCCCCCAAGACACAGCACTGCTCCTGTAGAACGCACGTCAGTAATACCCACCNATCTGATAACGCTCTGTAGAGCTCACATGCACATGACTGTGTTAACGAGCACACTCCTATGCTCACACATGAGGAGTGACGCT
  5   1   2       bld Em10 5x3                        IMAGE:8319965.5p                                                                                                      CCGGGACAGGCAGGAGACACCCGAGCTAGAGACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCAGGNAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAGACACAGAACTGCTCCTGTAGACGCCACGTCAGTAAATAACCACCAATCTGATAACGCTCTGTAGAGCTCACATGGCACA
  5   1   2       bld Em10 5x3                        IMAGE:8320625.5p                                                                                                                CTGGGGTGGTGGGTGCAGTCTCTAGCTCGGGTGTCTCCTGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAGACACAGCACTGCTCCTGTAGACGCCACGTCGTAAATAACCCACCATCTGATAACGCTCTGTAGAGCTCACATGCACATGACTGTGTCTAACGAGCACACTCCTATGACTCACACATGAGGCAGTGCGTCTGAACTAACTACAA
  5   1   2       bld Em10 5g                         IMAGE:7980123.5p                                                                                                                          CCGAGCTAGAGACTGCACCCACCACCCCATCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAAGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATTCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCCAGGCCGGCGCTAATGACAACATCATGTGAAGCAAGTATTTGAACTTTTATGGACATCATCTGTGAAAAGATGAACAAAACCTGGAAAATGACCTGTCTAGGGATGGGACTGCCAACTCATGAGTCTCTCCCAAGACAAACAACTGCTCTGTTAGACGCCACCTCAGTAAAAACCCACCAATTGAAAGATGCTCCGTAGATCTAACTGGCACCATGATGCGGTTTAAAGGAGCATCTCCCTTATTGCCCAATCCATGG
  5   1   2       bld Ga15 5g3  in                       XL473e03ex.5p                                                                                                                                     ACTGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGA
  5   1   2       bld Tbd7 5g3  in                         XL076f10.5p                                                                                                                                      TGCACCCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGNATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGA
  5   1   2       bld Tbd7 5g3  in                         XL077n15.5p                                                                                                                                            CCACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTAC
  5   1   2       bld Neu7 5g3  in                         XL019o20.5p                                                                                                                                             CACCACCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTCCTTTTCCGATATGCAGACGATTCCTTCACTTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGC
  5   1   2       bld Neu7 5g3  in                         XL034p07.5p                                                                                                                                                GCCCCAGCCTCCCCTGCTGCACCCCAACACTCCAAGNATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGA
  5   1   2       bld Neu7 5g3  in                         XL041o02.5p                                                                                                                                                        CTCCCCTGCTGCACCCCAACACTCCAAGNATGGCATCTGCCAGCGACACCCGCCAGCCCCAAAAAGATGCTGCTGACCAAAGTTTTGACTACATGTTCAAACTCCTGATCATCGGCAACAGCAGCGTAGGAAAAACCTCCTTTCTTTTCCGATATGCAGACGATTCCTTCACCTCGGCTTTTGTCAGTACAGTGGGGATCGACTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATG
  5   1   2       bld DMZ       in                         xl288k07.5p                                                                                                                                                                                                                                                                                                                                                                  CTTCAAGGTCAAGACGGTGTACAGGAACGAAAAGAGGGTCAAGTTGCAGATCTGGGACACAGCTGGTCAAGAGAGGTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATACCCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGG
  5   1   2       bld DMZ                                  xl261h19.5p                                                                                                                                                                                                                                                                                                                                                                                                                                             GTACCGCACAATCACAACAGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCANTGCTGTGCAGGACTGGGCAACCCANATTAAGACNTATTCCTGGGACAATGCGCAGGTTCTGTTANTAGGAAACAAGTGTGACCTCNA
  5   1   2       bld Tad1                            IMAGE:6937974.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                              GGGCATATTACCGTGGCGCCATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACTAAACCGTTCTATAGATATAACAAGATTTCCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAAAGAAGAAGAAGCGACGAGAAGTCCAGTTTTTTTGGGAGACCAAAATGGTCCATCCCTAATACAGATTTA
  5   1   2       bld Ga15      in                       XL436d20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGGTTTCTTGCTCATGTATGACATCTCAAACCTGGAATCCTTCAATGCTGTGCAGGACTGGGCAACCCAAATTAAGACATATTCCTGGGACAATGCGCAGGTTCTGTTAGTAGGAAACAAGTGTGACCTCGAAGATGATCGAGTGATCGCTGCTGAGGATGGGCGGAAACTTTCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATACCCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGG
  5   1   2       bld FaBN                            IMAGE:8075893.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGAACTTGCTGAGGAACTAGGATTTGAGTTTTTCGAGGCCAGCGCTAAAGACAACATCAATGTGAAGCAAGTATTTGAACGTTTAGTGGACATCATCTGTGAGAAGATGAACGAGAGCCTGGAGAATGGACCTGTCCCAGGGAGTGGCACTGCCCAGCTCACTGAGTCTGCCCCCAAAGACAACAGCAACTGCTCCTGTTAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAAACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACAAATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGNCACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACAGGGGAGTCTGTTTATACACTAAGTGCCAAGATGAACCCACGTGACCTAAA
  5   1   2       bld Neu7      out                        XL044l07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAACGTGNAAGCAAGTATTTGAACGTCTAGTGGNACATAATCTGTGAGNAAGNATGAATGAGAGCCTGGAGAATGGACCTGTTCCAAGGAGTGGCACTGCCCAGCTCACAGNAGTCTTCCCCCAAGGNAAAACAGTAACTGCTCCTGTTAAAACACCAACATCAGTAAAATAAACCATCCGATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTATAAGACAGAGCCGCCCACATCCCTTTTATTTACCTGCAACTGCCAATGCGGGGCATTGTGACTGCTCTTGTAGAACTGACAGCTGAGCACAAATGCTCCAACCAAACCATTCCATAGATACAAAAAGAATTCCTTTATGTAGGCCCTACATACACTGGCACTAGGCTGCAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCAACAAGAAGTCCAGTTTTTATGGCAACCAAAACGCCCATCCCCAATACAGATGATGAGCATTTAGGTGAAACCATGGATGCCCCAAAGTGGAGNAAATGTTACAGACTCCATCTTACATGAAAGATCTCTAGGTCGGGGAAACCCTTTCTCA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202945.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTCATGAGCAGATGAGTAGGACTCTCTGGAGAGAGAGACTGAGATGACTTCCAGGAGTGCATGCCAGTCATGAGTCGCCCCAAGACACAGCACTGCTCTGTAGACGCCACGTCAGTAAATACCCACCCCATTCTGATAGACTGCTCCTGTAGATGCTCAGCATGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAACAATGAGATGTTACATTTTAAAAAGATCT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGATGCATGCAGTCATGATTGCCCAAGCACACACTGTCTGTAGACGCACGTCATAAATACCCACCCATTCCGAAGCTGTCTGTTGATGTCAGCAGGCCACCAGGAACTGTGCTCTAAAAGGAGCCAACAGCATCCCTTTATTGCCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACAAATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTACATTTTTAAAAAAGATTCT
  3   1   2       bld DMZ  5g3  in                         xl261f15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGAACGCCACCGTCAGTAAAATAACCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGAGTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACTAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGT
  3   1   2       bld DMZ  5g3  in                         xl252b14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCCACCGTCAGTAAAATACCCCACCCAATTTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTNTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATGAGATG
  3   1   2       bld DMZ       in                         xl288k07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCACCGTCAGTAAATACCCCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTNTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAANTGAGATGT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202373.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCACCCAATTCTGATAGACTGCTCCTGTTAGATGCTCAGCATGGCCACCAGTGAACTGCTGCTCTAAGACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCGTGCAGCTGTCTATAATGCATGTGTAACTTCTACGTTCTCGTCTAAAAACGATTGAGATGTTTCCTTTTTTATAAAGAATTCCTTAGTCCTT
  3   1   2       bld Ga15      in                       XL436d20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGGAGCCAACAGCATCCCTTTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGNGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTT
  3   1   2       bld Neu7 5g3  in                         XL041o02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTATTGACCTCCAACAGCCAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTTAATAAAAGGAATTTT
  3   1   2       bld Tbd7 5g3  in                         XL076f10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAACAGCCAAATGAGGGGCATGGTGACTGCTCTTGTAGAACTGACAGCTGAGCAGAACTGCTCCTACCAAACCGTTCTATAGATATAACAAGATTTCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTNCTATAATGCCTGTGTAACT
  3   1   2       bld Tbd7 5g3  in                         XL077n15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TCCTTTATGTAGGCCCTACATATACTGGCACTAGGCTATAGGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCNATAATGCCTGTGTAACTTCTACTGAAANGTCTAAAAACAATTGA
  3   1   2       bld Neu7 5g3  in                         XL019o20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTATAGGGACACTGCCAAACAGATTGAGAAATGAANAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTTCTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTATAAGTGCCAAAGATGAACCCACCGTGACCTTNNATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTNCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTT
  3   1   2       bld Tbd7                                 XL057f04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTTAATAAAAGGAATTT
  3   1   2       bld Neu7 5g3  in                         XL034p07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACACTGCCAAACAGATTGAGAAATGAAGAGGAAGCGACGAGAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGGATTCCCCAAAGAGGAGAAATGTTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTACTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTCTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGCTTTGAACCCCTGTGAATATCATGCAGCTGTCTATAATGCCTGTGTAACTTCTACTGTCTCGTCTAAAAACAATTGAGATGTTTACATTTTTTTAATAAAAGGAATTTTCCTTTTATT
  3   1   2       bld Neu7                                 XL025o01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGTCCAGTTTTTTGGAGACCAAAATGTACATCCCTAATACAGATTATAAGCATTTAGGTGAAACCTTGNATTCCCCAAAGAGGAGAAATGTTNCAGACTCCCATNTGATCAGAAAGATCTNTAGGTGGGGAAACCCTTANTCGGCCACCAAAACAGCTCTATGCATGGTACTGCAACACTCCTATACTGGCAGGGTTGGGGTTGAGGGAACCAGGGGAGTCTGTTTTATACACTAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTANCACATNACAGATGCTCTGCATGTATTTTAATCNCTCCACTTTCTAAAGGGGGTTCTACAAATGACTGGGGTCTTAANCATTGTGGGT
  3   1   2       bld Ga15 5g3  in                       XL473e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATAAGCATTTAGGTGAAACCTTGGGATTCCCCAAAGAGGAGAAANGNTACAGACTCCCATCTGATCAGAAAGATCTCTAGGTGGGGAAACCCTTTNTCGGCCACCAAAACAGCTNTATGCATGGTACTGCNACACTCCTATACTGGCAGGGTTGGGGTTGAGNGAACCAGGGGAGTCTGTTTTATACACTATAAGTGCCAAAGATGAACCCACCGTGACCTTAAATTCTTAATTCGTTGATGCTTCTGAAGTAACACATTACAGATGCTCTGCATGTATTTTAATCACTCCACTTTNTAAAGGGGGTTCTACAGAAATGACTGGGGTCTTAATCATTGTGGGTGAAGGCTTTGAAGCCCCTGTGAATATCATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)