Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-xl291g02.5                           53 END     1           1        1                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-xl316k02.3.5                         39 PI      88          1     1190                (no blast hit)
     3   0.0    0Xl3.1-IMAGE:7980965.5                       9 PI      78        376      662                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7979206.5                       5 PI      80        377      608                (no blast hit)

 This cluster: approximate FL confidence score = 92%

 1012769227 Xl3.1-XL436h17ex.5 - 51 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL436h17ex.5                 ACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTCACATGA
                                                  Xl3.1-CHK-1012686655                       CATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTC
                                                      consensus depths                      4     7     7     9    11    13    12    14    12    14    13    15    13    15    13    15    14    16    14    16    14    16    14    16    14    16    14    16    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    17    15    19    17    19    16    19    16    21    18    23    17    23    17    23    17    23    17    23    18    23    20    24    20    24    20    24    20    24    20    24    23    24    24    24    24    24    24    24    23    23    23    23    21    24    23    24    23    24    23    24    22    23    22    23    22    25    23    25    23    25    23    25    22    24    20    23    18    21    14    20    16    19    15    19    16    20    14    21    15    21    13    21    14    20    14    19    13    19    12    19    13    19    12    17    15    18    22    22    20    22    21    22    21    22    18    22    20    22    17    24    20    23    19    23    20    23    20    23    19    22    19    22    21    22    20    21    21    22    21    21    20    20    20    20    20    20    19    20    19    19    19    21    21    21    21    21    20    20    21    21    21    21    21    21    21    21    20    21    22    22    22    22    22    22    22    22    21    22    22    22    21    22    21    22    20    22    20    22    19    21    21    23    21    23    21    23    21    23    21    23    21    23    21    23    20    23    21    23    21    23    18    23    20    23    20    23    20    23    19    21    19    21    19    21    12    16    10    13     3     7     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                               BLH ATG     101     622                 
                                               BLH MIN     101     130                 
                                               BLH OVR     101      28                 
                                               EST CLI     -12      13                 
                                               ORF LNG     101       2                 
  5   1   2       bld Gas9 5g                              BG409854.5p CCCACGCGTCCGGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGANGACATGTTTGATAATGGAAGCTTCCTTAAAAGGAGGAAA
  5   1   2       bld Ga18      in                        xlk2k10ex.5p     CNNAGNCCTTTGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTNNNNNNGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGANAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGNNNAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCANNNNNACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGNAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGANGGACTCATGATGTACAACTCTCTGCCTTNCTACAGACCCTACAGTGCCCTNNNACCACAGNCA
  5   1   2       bld Em10 5g                         IMAGE:7979662.5p      GCCCTTTGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAGGTTTAGAGGCACCACAGGAGTTCTTTAGGATGACTCATGATGTACACTCTCTGCCTACTACAGACCTACATGCCCTCACACAGCATGCTCACAAACACTGCTGCTGCATCAGAACTGTCAGCACTACTAACTACAACTAGAGAGTCTACAACAGGCCAG
  5   1   2       add Ga18      in                      xlk119c24ex.5p        AGNCCTTTGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTNNNNNGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGANAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGNNNAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCNNNNNNACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGNAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGNTTAAGAGGNANCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCNAACCACAGCCAATGNTCCAGCAGACANCACTGGCATGCATGNNAATCCCAGAGANCTTGTCTATGCCAACTAANCTTACACCCTACCCAGACATAAAGAGGANGNTCATTACCCAGACCAGGGGGNANNCAGGGGTTTTGAGGNCAGGNTGCTAATAACNATCCAAATAAG
  5   1   2       bld Em10 5g3  in                    IMAGE:7980514.5p          TTTGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGACGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAG
  5   1   2       bld Gas3 5g3  in                      xlnga002l13.5p           TTGGAGACTACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCCAGCTTAGCTGCACTGGAAGGGAAAACCAATTCTTCGGAGAAAGTGAAGGAGGTACTTTAAGACTCCAAGCTACCTACCTGGTGGAAAGCCAAAAGGCCCTGTAAAGCCTCCTTATCT
  5   1   2       bld Em10 5g                         IMAGE:8318951.5p           TTTGGAGACTACCATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAAATCCAGGAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTTAGAAGGAGGAAAAGGTTTAAGAGCACCTACAGGA
  5   1   2       bld Em10 5g                         IMAGE:7979973.5p                   TACACATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGACCCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAGGAGGAAAAGGTTAAGAAGCACAACAGGAGTTCTTTAGGATGGACTCTGATGTACAACTTCTGCCTTCACGACCTACAGTGCCTCAACACAGCATGCTCAGCAACCCATGCTGCATGGCATCCGAACTTGCATGCACTACTTACCTCCAACAAGAGAAGTCTCCGACG
  5   1   2       bld Emb9 5g                         IMAGE:7974269.5p                      CCATTCACAGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTAAACTCTCTGCTTACTACAGACCTACAGGGCCTTCCACACAGCCATGCTCAGCAA
  5   1   2       bld Ga12 5g3  in                         XL217e11.5p                              AGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCANGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACC
  5   1   2       bld Ga12 5g3  in                         XL217f11.5p                              AGAGAGCAGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGA
  5   1   2       bld Ga12 5g3  in                         XL170e01.5p                                     AGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCAC
  5   1   2       bld Ga12 5g3  in                         XL170g05.5p                                     AGTGGGGAAGCACAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACA
  5   1   2       bld Em10 5g                         IMAGE:7979034.5p                                          GGGAAGCCAACTCTCACTGGAGATCCTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGATATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAGGTTTAAGAGGCACCACAGGAGTCTTTAGGGTGGACTCTGATGTAAACTCTCTGCTTACTACGACCTACAGTGCCTCCAACACATCAATCTCCGCAGACCC
  5   1   2       bld Ga15 5g3  in                       XL436h17ex.5p                                                                   CTGCTGTCTACTACCTACTGCCAACCCAGCATCAGTGCTAGCAATGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGAC
  5   1   2       bld EggS      in                    IMAGE:4785330.5p                                                                                                               TGAGCTTTAGCCAGGAGTCTGGAACCCACCATAATTCCCTGGATTATGCAGGAGTCTCTGATGAGGAGGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGATGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGACTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAAT
  5   1   2       bld Unk4                                726_21A14.5p                                                                                                                                                                                  GGATGAAATTGATATTCTTGGAGAAGATGACCCCTGCAGCCTGAAGTCACACTTTTACCTACAGCCTACACATTCAGACATGGGAGACAGTGGGATGCTGAGTCCTTCCAAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCC
  5   1   2       bld Ga12      in                         XL216o03.5p                                                                                                                                                                                                                                                                                GAGGCTGAGTCCTTCCAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAG
  5   1   2       bld Ga12      in                         XL168n14.5p                                                                                                                                                                                                                                                                                   GCTGAGTCCTTCCAGCTAAGCTGCACTGAAAGTGAGAGCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCC
  5   1   2       bld DMZ       out                        xl338k21.5p                                                                                                                                                                                                                                                                                                                  CCTCGTGCCGATTCCTCGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGG
  5   1   2       bld Ga18      in                      xlk108g23ex.5p                                                                                                                                                                                                                                                                                                                          AGCGATTCCTCGGNNGNNNTGAAGGAGGNACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCNAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGACNNACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGNNNAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACGCCACTNNNATGCATGGNAATCCCAGAGACCTTGTCCATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGNNCAGGATGCTAATAACCATNNNAATAATTCTCAGAGCAAGTGTTCANNCAGTATTGAGAACATCATGAAGAAACNCAAGGAANCAGAGCCAAGTTTNCNAGCTTCNACTCACACTGNAACTATNATAATCACTTATTNCAGAG
  5   1   2       bld Ga12      in                         XL169n14.5p                                                                                                                                                                                                                                                                                                                                 CGGGAGAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCANCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAA
  5   1   2       bld Egg5      in                    IMAGE:3431684.5p                                                                                                                                                                                                                                                                                                                                       GAGAGTGAAGGAGGTACTTCTAAAGACTCCCCAGCTACCTCACCTGGTGGCAAAGCCAAAAGGGCCCTGGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGGATATGGAGGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTT
  5   1   2       bld DMZ       in                         xl242b11.5p                                                                                                                                                                                                                                                                                                                                                                                                          GGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGG
  5   1   2       bld DMZ       in                         xl249j12.5p                                                                                                                                                                                                                                                                                                                                                                                                          GGTAAAGCCTCCTTACTCTTACATTGCTCTGATCACCATGGCTATCCTGCAGAGCCCACACAAGAAACTGACTCTTAGTGGCATCTGTGATTTTATCAGCAGCAAGTTCCCTTACTACAAGGACAAGTTCCCTGCTTGGCAGAACTCTATCAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGNCCTCTGCTAGCTAA
  5   1   2       bld Tbd7      in                         XL105l07.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTTGGCAGAACTCTATNAGGCACAACCTGTCCCTTAATGACTGCTTCATTAAAATACCACGGGAACCAGGAAATCCAGGAAAAGGCAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACGCCACTGGCATGCATGGCAATCCCAGAGACCTTGTCCATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCAAAATAATTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTT
  3   1   2       bld Ga18      in                      xlk157n19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATNCAGGNAAAGGCAATTANTNGACACTGNANCCTGCTTCTGAGGACNTGTTTGATAATGGAAGCTNCCTTAGAAGGAGGAAAAGGTTTAAGAGGNACCAACAGGAGTTCTTTAAGGATGNNCTCATGATGTACAACTCTCTGNCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATNNATGGCAATNCCAGAGACCTTGTCTATGCCANCTANCCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTNCAACNNNNNNCNACNCA
  5   1   2       bld Ga18      in                      xlk157n19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAANCCAGGAAAAGGNAATTATTGGACACTGGATCCTGCTTCTGAGGACATGTTTGATAATGGAAGCTTCCTTAGAAGGAGGAAAAGGTTTAAGAGGCACCAACAGGAGTTCTTTAAGGATGGACTCATGATGTACAACTCTCTGCCTTACTACAGACCCTACAGTGCCCTCCAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGNAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGNNTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTNGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTNNTGCTGGNTGCTTGAATCACTATGGATTTCCATTCTTTGTTTGNCTTATTTTTCTGTNANATATAATGNAAATAGNAATGTAATC
  3   1   2       bld Ga18      in                      xlk108g23ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNTGATNNANAACTNTCTGNNTNCTANAAGNCCCTACAGNNNCCTCCAANNNCAGNNAATNNNNCANNAGACNNNCTNGCATGCATGNNAATCCCAGAGNCCTTNNCCATGCCAACTAACCNTTACNCCCTACCCAGACATAAAGANGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGNTTTTGAGGNCCAGGATGCTAATANCCATCCAAATAATTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCANCTGTGCTTAACCTATCCACTGNCCCTCTGCTAGCTAATGTCCAGGNCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGACAGTCATATGTATTTGTATGACAACCCCATGTGGNACATGTGCTGCTGGATGCTTGAATCATTATGGATTGCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTNNA
  3   1   2       bld Ga18      in                      xlk119c24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTNTCTGCNTTNCTACAGNCCNNNNAGTNNCCNCCNNNCACAGCNAATGCTCCAGCAGACACCACTGGCATGCATGGNAATNCCAGAGACCTTGTCTATGCCAACTANNCTTACNCCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGNACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTT
  3   1   2       bld Ga18      in                        xlk2k10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNCTACAGNNCCTACAGNNNCCNCNAACCACAGCCAATGNNCCAGCAGANNNNCTGGCATNNATGGNAATCCCAGAGNCCTTNTCTATNCCAACTAACCTTNCACCNTACCCAGACATAAAGAGGNAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATANCCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGNCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTNCANCNTNNNNNCNAC
  3   1   2       bld DMZ       in                         xl249j12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAACCACAGCCAATGCTCCAGCAGACACCACTGGCATGCATGGCAATCCCAGAGACCTTGTCTATGCCAACTAACCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAA
  3   1   2       bld Em10 5g3  in                    IMAGE:7980514.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATGCCAGGCAATCCCAGAGACCTTGTTTATGCCAACTAACCCTTACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTCTTGCAACTTTCAGTCTACTCAGCAAAAAAAAAAAC
  3   1   2       bld DMZ       in                         xl242b11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACCTTACACCCNACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTT
  3   1   2       bld Ga15 5g3  in                       XL436h17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACACCCTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTAT
  3   1   2       bld Ga12      in                         XL168n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CNTACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATG
  3   1   2      seed Ga12      in                         XL216o03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCAT
  3   1   2       bld Ga12 5g3  in                         XL170g05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCAGGATGCTAATAACCATCCAAATAAGTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATG
  3   1   2       bld Ga12 5g3  in                         XL217e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCAGACATAAAGAGGAAGGCTCATTACCCAGACCAGGGGGCACACAGGGGTTTTGAGGGCCGGGATGCTAATAACCATCCAAATAATTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGACAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCATTATGGATTGCTATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATG
  3   1   2       bld DMZ       out                        xl291g02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACACAGGGGTTTTGAGGGCCAGGATGCTAATAANCATCCAAATAAGTNTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCNTGAAGAAACCCAAGGAACCAGAGCCAAGTTNTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTC
  3   1   2       bld Neu2                            IMAGE:2942863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGCTAATAACCATCCTAATCAGTCTCAGAGCAGTTGCTCATCCAGTATCGAGACATCCATGAACAAACCCAAGGAACCAGAGCCAAGTTTCCCAGCTTCATCTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTTCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTAAAGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTCACATGAA
  3   1   2       bld Tbd7      in                         XL105l07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATAACCATCAAAATAATTCTCAGAGCAAGTGTTCATTCAGTATTGAGAACATCATGAAGAAACCCAAGGAACCAGAGCCAAGTTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGACAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCATTATGGATTGCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCAGCTAAATAAAAT
  3   1   2       bld Gas3 5g3  in                      xlnga002l13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAACATCAAATAGTCTCAGAGCAGTGTCTTCAGTATGAGACATCATAAGAACCCAAGGAACCAGAGCCAAGTTTCCAAGCTTCAACTCACACTGGAACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTACTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTATGAAAGGTCCATTTCCCAGCCCTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTCACATGAA
  3   1   2       bld Ga12 5g3  in                         XL217f11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACTATAATAATCACTTATTGCAGAGACCAAGTTCCTGCTTTCTCCCAGCTGTGCTTAACCTATCCACTGGCCCTCTGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGACAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCATTATGGATTGCTATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGC
  3   1   2       bld EggS      in                    IMAGE:4785330.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGACAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCATTATGGATTGCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATAGATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTGAGTCTACTCATGCTAAATAAAATAATTCACGAGAAA
  3   1   2       bld Egg5      in                    IMAGE:3431684.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTAGCTAATGTCCAGGGCACCAGGCAATACAACCTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCGCTTTGGGTCTCACATAGCCCCAGTACACAGTATGTATTCTGCTGCTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTCACATGAAAA
  3   1   2       bld Ga12 5g3  in                         XL170e01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAATGTCCNGGGGCACCAGGCAATACNACGTAATCAAATTCCCTGGGAGTTATTAAAGTAAGTCACTTTGGGTCTCACATAGCCCCAGTACACAGTANGTATTCTGCTACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTCCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAAAAAA
  3   1   2       bld Ga12                                 XL173p13.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGAGTTATTAAAGTAAGTCACTTTGGGTNTCACATAGCCCCAGTACACAGTATGTATTCTGATACTAGGACCTTTTTTGTCCAACCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTANACAATCTGTGTCCCTCCAGTNTGTACTGAAGTAACATTTCCAGCACTCCNTAAATNCCATGGTTGTCA
  3   1   2       bld Ga12      in                         XL169n14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTAGGACCTTTTTTGTCCANCCCCAAAGACTTTATTTATTGTCAAAGACAAGGTTATACAATCTGTGTCCCTNCAGTTTGTACTGAAGTAACATTTCCAGCACTCCCTAAATTCCATGGTTGTCAGGGGAAGATGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGNTAATATATAATGTAAATAGAAATGTAAT
  5   1   2       bld Ga15      in                       XL451d11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGCTCCGGGAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTATTGCAACTTTTCAGTCTACTCATGCTAAATAAAATAATTCACATGaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL451d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGTTGCAGTTGAATAACAACTAGAGGGCTGCTGGTTGTACATACCTGGATAGTCATATGTATTTGTATGACAACCCCATGTGGCACATGTGCTGCTGGATGCTTGAATCACTATGGATTTCCATTCTTTTGTTTTGTCTTATTTTTCTGTTAATATATAATGTAAATAGAAATGTAATCTATTGAACTATTTATTATCAAAGTTAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)