Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 70%

 1012769234 Xl3.1-IMAGE:8635844.5 - 46 ESTs
                                                                       .....-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:8635844.5                                                                                                                                                                                                              ATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGAAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAGATCCCTTAGATACCTAT
                                                  Xl3.1-CHK-1012686843                                                                                                                                                                                                                    TTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAxxxxxGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCxxxAGxAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAGATCCCTTAGAT
                                                      consensus depths                                                                                                                                                                                                                   8    23    12    25    16    29    17    29    19    31    19    32    19    33    19    35    19    37    22    37    23    37    26    39    29    41    29    40    29    40    22    40    30    40    33    41    33    42    33    42    35    42    36    43    38    44    39    44    41    44    42    44    41    44    41    44    42    44    42    44    41    44    41    43    41    44    41    43    41    44    42    44    40    43    40    44    41    44    42    44    42    44    41    44    42    44    42    44    43    45    41    43    40    43    37    43    35    43    35    43    32    43    32    43    30    43    29    43    25    43    18    43    18    43    16    42    13    41    12    41    11    41    10    39     7    38     7    35     6    35     5    31     4    28     4    28     4    27     3    23     3    21     3    19     3    16     3    15     3    13     3    12     2    12     2    10
                                                                   VAR                                                                                                                                                                                                                                                                                                  AAAACGAGATGCAGAAGCAGTAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                          -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                      ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                  -T-A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                      ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                          ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                      ---T--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------C--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---C--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      --------C---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ------T----A
                                               BLH ATG      94     112                                                                                                                                                                                                              
                                               BLH MIN      94      15                                                                                                                                                                                                              
                                               BLH MPR      94      15                                                                                                                                                                                                              
                                               BLH OVR      94       7                                                                                                                                                                                                              
                                               CDS MIN      94      12                                                                                                                                                                                                              
                                               EST CLI      17      12                                                                                                                                                                                                              
                                               ORF LNG      94       1                                                                                                                                                                                                              
  3   1   2       add Tad2      in                    IMAGE:6874726.3p TGGGGGGAAGGAGCTATAAGGTGAGGTTTTCAAGCAACCTGTCTGATAGCCCCGAACAGCCTGATTAGGTTACCCAGGAGCGTCCCCTTTTTCTAATTATTGAAGAAGTATTTTATGAGGTAAAGGGGAAGGTTCCCCGGGGAAAATTCGGGGCTACAATGTTTGGAGCGATTCAACCCAAAAAAAACATTTTGGAACAACGCTTTTTTTGTGGGGAGGTACTCAAGTGTAATTCCAAAAAGCGAAGAGTGCCGAAAGGTCAGGTAGGGACCCCGGAGGCCCTTTTGCCAAGGAATGAAAGATTTTAGAATGAAAAGAAGAGGGTTCCGGGGGGAAATTTGGTAAAATTTTTTCCATTCAAGCCAAAAGAAATTTGGCAAAAGCTTTTTTTTGGGGGAGGAAAATAAATGAATTTCAAAAACGGAGATGCAGAAGCCAGTAAGGACCAGAGGCCCTTTGCGGATGAAGATTTAGATGAAAAGAGAGGTCCGGGGAAATTTGGAAAATTTTTGCACTCAGCAAAAAAAATTTTGGAAAAGCTTTTGGGGGAGAGATAATGAATTCAAACCGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGACAACCCCTGTTTGGGAACACCACTGTATATTATNCATCAATACACTCNCCAAAGGAACGAACATTGAAAAAACACACAAAGCACAAAAC
  3   1   2       bld Tad2      in                    IMAGE:6871940.3p  AAAAAGACATTTTTTTTTGTGGGAGGGAGATTTATAATAGGAGTGTTCCCAAAAACGAATGATTGGCCGGAAAGGCAGGTTAGGGGACTCCGAGAAGGTTCCCTCTCGCCAGGTAATGTAAAAGATTTTTAGGCTGAAAAAGGAAGAGGGTTCCCGGGGGGAAATTCTGGTAAAAAATTTTTTGCCACCTTCCAGCCAAAAAAAAATTTTTTGGAAAAAAGGCTTTTTTGGGGGGAGGAGATTTAATGGAAATTTCAAAAAACGAGATGGCCAGAAAGCCGTTAGGACCCCAGGAGGGCCCTTTGCCAGATAAAAGGATTTTAGATGGAAAGAAGAGGGTTCCGGGGGGAATTTGGTAAATTTTTTGCAATCCAGCAAAAAAATTTTGGAAAAAAGCTTTTTTGTGGGAAAAATAAGGAATTCAAAACGAGATGCAGAAAGCAGTAGGACCAGAGGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAGGATCCCTTTCNTCCTCCNCCCCTTTTTTGAAAAACCNNNNNNNGGCGGNGGGNCGTTTATCCTGTGAGATTAGGGGGGGGGAGAGGGGAGGG
  3   1   2       bld Tad2      in                    IMAGE:6873610.3p                                                 ATTTTTGTTAAGTTGAGTGGATACGTCCCCTAATTTATAGGGCGGCGGTTAAGGTTTAAGGGCCTGTAAGGTCTGTTATTCGGTCCCTCAGGTGTCCAAGCCGGAGGTTTCCGTTTGACGCTGTATGGAAAGGCTGTCCCCCGCCATAAAATTTTTTGTTTTTAGGCATTTACCATTTATTACCGAAAGTTTTTTTCCATGTTCGAACGGGTTACCCGGGGCACATTATTCCCCCCGGGGAAATTTTCCGGCCCAATTAACGGGCCGGGGGGAAAAAGAGGAGGGTTCCCCGGAGGAATTTTGGTTAAATTTTTTTTGCACTTCAGGCAAAAAAAATTTTGGAAAAAGGTTTTTTGTGGGGAGAAATTAATGAATTCAAAAACGAGATGCAGAAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGATAACCTATACTTTCTGAATATATTCTTTTCTTTGGGCAGCTAAACAAAACACCCTCTTTTTTCTCTTTGAGTTNGGGTGGNNGGGG
  3   1   2       bld Lmb2      in                    IMAGE:8638074.3p                                                      ATATAGTGTAACATATAGGAATACCAAGTATCTGTTCTTTGCAGGATCCATTCGATCGGAATTGTCCGAAAGGCTTTGTGGAGGAGATAATGAAAGTCAACGAGAATGCAGAAGCAGTAGGACCAGAAGGCTTTGCAAGAATGAAGATAGATGAAAGAGAAGGTCGGGAAATTGGTAAATTTTGCAATCAGCAAAATAAATTTGGAAAAGCTTTGTGGGAGAGGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGAATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGAG
  3   1   2       chi Tad2      in                    IMAGE:6876583.3p                                                                               AATAAAGGAATGTCCAAAACGGGGGTGTGCGGGGAGGCCGGTAGGGGTCCCAGGGGCCCTTTTGCCCGGTGGAGGATTTTTTGATGGAAGGGGAGGTTCCCGGGGAAAATTGGGTAAAGTTTTTTGCCATTCCGGCAAAAAAAATTTGGGAAAAAGCTTTTTGGGGGGGGAGGTTTAATTGAATTTCAAAAACGGAGATGCAGGAAGCCAGTAGGGACCAAGAGGCCTTTTGCAAGATGAAGATTTTAGATGAAAGGAGAGGTTCCCGGGGAAAATTGGTAAAATTTTTTCAACTCAAGCAAAAAAAATTTGGAAAAGGTTTTGTGGGAGAAAATAATGAATTCAAAACTGAGATGCAGAAGCCAGTAGGGACCCAGAGGCCTTTGCAGATGAAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCTAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACTCATGAAGAACAATGATTTCTTGAAAAGAGTAAACGGAGAAAGAACTTGCTTTTTACCTGCACAAAAAACTCCCTATATACATCCCAG
  3   1   2       add Tad2                            IMAGE:6873891.3p                                                                                                                      TAAACGCCCCTGTTGTTGCGTTATGTATCCCAATTTGTCCCCCCTTTTTTTTAGGACCCAGAGGTCTTTTCCAGAATCACGATTTCCCTGTTTTGTGTCCGTCCCGGGGCAACGGTTTACCCTTTGCATTTCCCCTACAATTTTTTTTTCAGCCCTTGCCGCCGTTATTCGACTTCCATACGCGATGCAGAGTTGTAGGACCTTTGGCCTTTCAGTGGAAGATTTAGCCGTTCGAGATGTCCGGTTTTTTGCAATTTGTCGCATTCAGCAAAAAAATTTGGAAATTCTCTTGTGGGCGATTTATCGAATTTCAAATGAGATTCAGAAGTAGTAGGATTTGAGGTTTTTTTAGATGAATATTCAGTTCCAATATACGTCCGGGGAATCGGTTGTTTTTTGCACTCATCATAAAAATTTTGAAATGTTTTCGTTTTATAACTACGATTTCAAATTGAGTTGCAGTGTCAGTAGGACCAGAGTCTTCTTTAGACGATGACTTTGTTGAAAGAGTGGTCCGGTCAATCGGTAACTTTTTGCATTCAGCATACAAATTTGGCAAAGTTTTTGTGGGAGAAATAATGAATTCAATTCGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGACGAAGATTTTGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGCGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCTTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGATAA
  3   1   2       add Tad2      in                    IMAGE:6875344.3p                                                                                                                           TTTCCGGCGTTTTGAAAAAAAGGGAGGGGGAGGGTTTCCCCGGGGGGGGAAAAATTGGGGGTAAAAAATTTTTTTTTGCCACTTTTCCAGGCAAAAAAAAAATATTTTCGGGAAAAAGGCTTTTTTTGTGGGGGAGGAGATTAATGGAAATTCCAAAATCGAGGATTGCAGAACGCCAGTAGGACCCAGAAGGCCTTTGCAAGATGAAGATTTTAGATGAAAGAGGAGGTTCCGGGGAATTTGGTAAATTTTTTGCATTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAATGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAACATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCAATGAAGAACAATGATTCCCCTGAAAATGTGTAAATGTGTTGAAATGATTATGAACATAGTAGTGCTGAATAAAAAGAAGATCCTTTATGATCACCAATACATTCGGGATCTTTCCGGGTCCCCCCTTTTCGGGGCGTGGGnCCnGGGGGTGAGGGCGGGGGAnGGGGCCGCGCCCCCCCCCCCCCCC
  3   1   2       bld Tad2      in                    IMAGE:6875847.3p                                                                                                                                TAATTCATAATCGGGATTGGCAGAAAGCCTGTGGGGCCCGGAGGGCTTTTGGCAGAATGAAAGATTTAGGAGGAAGGAGGTGTCCGGGGAAATTGGTTAATTTTTGCACTCCAGCAAAAAAATTTGGAAAAGCTTTTTGTGGGAGAGATTATGAATCCAAAACGAGTGGCGGAAGCCGTTGGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGAAATTGGTAAAAATTTTGCACTCAGCAAAAAAAATTTGGAAAAGCTTTTGTGGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTTAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCNGAATAAAAAGAAGATCCCGTTGATAA
  5   1   2       bld Thy  5g                         IMAGE:8547599.5p                                                                                                                                                                               GAGTTTTTTGATGGGGGaaaaaaaagaaaaCGAATTCGTCCCCTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCCGGGAATTGGTAAATTTTTGCACTCAGCAA
  5   1   2       bld Lmb2 5g                         IMAGE:8635983.5p                                                                                                                                                                                   GGGAGTTAAAAAACACGTTTTTCTCTTTACAAATTCGTCCCCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTATGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCAGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAGCAGTAGACCAGAGCCTTTGCAGATGAGGATTAGATGAAGAGAGTCAGGGAATGTAAATTTTGCACTCAGCAAAAATTGGAAAAGCTTTGTGGGGAGAGAATGATCAACCGAGATGCCGAGCAGTAGACGAGCTTGCATGAGATGAATGAAGAAAGTCCGGATGGTAAA
  5   1   2       bld Thy  5g                         IMAGE:8551172.5p                                                                                                                                                                                        TTCAATTNNNNGCCGAGTACCTATACAAATTGTCCCCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACAGAGGCCTTTGCAGATGAAGATTCGATGAAGAGAGGTCGGGAATTGTAATTTTTGCCTCACAAAAATTGAAAGCTTTGTGGAGAATATGATTCAACAGTGCGAGCATAGACAGAGCTTGCAATAGATAATGAGAAGTCGGGATGTAATTGCTCGCAAATTGAACTTGTGG
  5   1   2       bld Lmb2      in                    IMAGE:8636520.5p                                                                                                                                                                                           TGAGGGGCGGTgggggggggggggCGGCGGTTCGGATTCGTCCCATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAGATTTCGATGAAAGAGAGGTCCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAGCTTTTGTGGAGAGATAATGATTCGAAACGAGATGCAGAGCAGTAGACCAGAGCCTTGTACATATGAACGATTTGATGGAAT
  5   1   2       bld Tad2 5g                         IMAGE:6933891.5p                                                                                                                                                                                                   GGGATATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGGAAAAGCTTTTGTGGGAAGAGATAATGAATTTCAAACGAGGATGCCAAAAGCCAGTAGGACCAGAAAGCCCTTTTGCCGAATGAAAAGATTTCCAATGAAAAGAACAAGGCCCGGGGGGAATTTGGGTAAAATTTTTTGGCCCCTTCCCGCACAAC
  5   1   2       chi Tad2                            IMAGE:6931239.5p                                                                                                                                                                                                   GGGATATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCGCTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCCAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCCAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCCGATGAAGATTTAGATGAAAGAGAAGTCCCggggaattggtaaaatttttgcactccgccaaaaatttggaaaaagcttttgtgggaaaaaataaagcaatccaaaaCGAGATTGCCTAAACCTGTTAGGAACCAGGAAGGCCCTTGGCAGAAAGAAAGAATTTCCAATaaaaaaaaaGGTCCCCGGGGAAAATTTGGTTAAATTTGTCTGccccccccGCCACAAATTAAATTTTGGAACAAAACCTCTTTC
  5   1   2       bld Tad2 5g                         IMAGE:6875352.5p                                                                                                                                                                                                    ATATATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGGAATTGGTAAAATTTTTCGCCCTCAGCCaaaaaaaaTTTGGGAAAAGCCTTTCTGGTGGGGAGAAAATAAATGAAATTCCCAAAACGGAAGATGCCAGAAAGCCAGNTAAGGAACCAAGAGGCCCCTTNTGCCACGAATGAAAAGATTTTCGAATTGCAAAAGAAGAAAGGTCCCGCGGGGAAAATCTGGGTAACAAAttttttttgccacctctaggccaaaaaaaaaCATTTTTGGTGACAAAAAGCCTCTTTTTTTGGTGCGGCGAACAA
  5   1   2       add Tad2 5x                         IMAGE:6934523.5p                                                                                                                                                                                                    GGGATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCACGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGACGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCCGCAAAAAAATTTGGAAAAGCCTTTTGTGGGGAGAAATAATGAATTCAAAAACGAGATGCAGNAAACAGTAGGGACCCGAGGGCCTTTTGCAGATGAAGATTTTAGATGGAAAGAGAGGTCCCGGGGAAATTGGGTAAAATTTTTGGCACTCAGCCaaaaaaaaTTTTGGGAAAAAGCTTTTTGGTGGGGAGAAAATAAACGGAATTTCAAAACCAGGATGGCAGAAACCAGGTAAGGGAACCAGGAGGCCCTTTTGCCAAGATTaaaaaaatttccaatgtaaaagaagaaggtcccgggggaaaatttgggaaaattttttTGCACCTCCAC
  5   1   2       bld Tad2      in                    IMAGE:6875847.5p                                                                                                                                                                                                      ATATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGGCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAAATTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGGAATTGGGTAAATTTTTTGCACTCAGCaaaaaaaatttggaaaaagctttttgtggggaaaaaTAATGAAATTCAAAAACCGAGATGCCAGAAAGCAGGTAGGGACCCAGAAGGCCCTTTGCCAGGA
  5   1   2       bld Tad2      in                    IMAGE:6876299.5p                                                                                                                                                                                                      ATATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGGGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGANAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCaaaaaaaaTTTGGAAAAGCTTTTGTGGGGAGAGATAATGAAATTCCAAACGAGATTGCAGAAGCAGTAGGACCAGGAGGCCCTTTTGCAGATGAAAGATTTCGATGGAAAAGAAAAGGTCCGGGGGAAATTGGGTaaaattttttgccactccagccaaaaaaatttggggaaaaacttttttggggggaaaaaaa
  5   1   2       bld Tad2 5g                         IMAGE:6875239.5p                                                                                                                                                                                                       ATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTCTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTATGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGATAGAGAGGTCCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTTGTGGGAGAAATAAATGAATTCCAAAACGCAGATGCCAAAACCCAGTTAGGGACCCCAGAGGGCCTTTTTGCCAGAATGAAAGAATTTTCCGAATGGAAAAGAACAAAGGGTCCCGGGGGGGAAAATTGGGGACAAAAtttttttttG
  5   1   2       bld Tad2 5g                         IMAGE:6874668.5p                                                                                                                                                                                                        ATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAAAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAAGGCCCGGGGAAATGGGTAAATTTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTT
  5   1   2       chi Tad2      in                    IMAGE:6874726.5p                                                                                                                                                                                                        ATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGAATTGGAATTTTTGCACTCACAAAATTGAAACTTTGGGGAAATTGATTAACAAGAAACAAGCAAGCTGAATAATTATAAAGCGATATTCAATGACTGAAATACCAGCAAN
  5   1   2       bld Tad2      in                    IMAGE:6871940.5p                                                                                                                                                                                                        ATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGNTCTCGGGGN
  5   1   2       bld Tad2      in                    IMAGE:6875344.5p                                                                                                                                                                                                           ATACTGATTGCTTTCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGANAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGCGAAAAGCTTTTTGTGGGGAGAAATAATGAATTCCAAAACGAGATGCAAGAAGCAGGTAGGACCAGAGGGCCTTTTGCAGATGGAAAATTTCCCATGAAAAGAAGAGGCCCCGGGGGAAATTGGTTAAATTTTTTGGCACTTCAAGCaaaaaaaaattttggaaaaaaaGCTTTTTTGTTGGGGAAGAAAATATAATGGGAAATTTCCAAACACCGCAGAAAGTGCCC
  5   1   2       bld Lmb2 5g                         IMAGE:8638736.5p                                                                                                                                                                                                                     TCTACTTCTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATATGAATTAAAACGAGATGCAGAACAGTAGGACAGAGGCTTTGCAGATGAGATTAGATGAAGAGAGTCGGGGAAATGTAATTTGCCTCACAAAAATTGAAAGCTTGTGGAAGTATGATCAACGAATCAAACATAGACGAGCCTGCGATAGATAATGAGAAGCGGGATGTATTTGCTCCAAAATTGAACTGTGAA
  5   1   2       bld Lmb2                            IMAGE:8636022.5p                                                                                                                                                                                                                         GGGGGTCGAATGAAAGACAATCGATTCGAATTCGTCCATTTGGAAGAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGACGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAACGAGATGCAGAGCAGTACGACCAGAGCCTTTGCAGATGATGATTTAGATGAAAGAGAGTCCAGGGATTGGTAATTTTGCACTCAGCAGAAAATTTGAAAGCTTTTGTGGGGAGAGATATGATCAACGAGATGCAGAGCAGTAGATGACGGAAATGGGTGATAGTCAGCACGAAAACATCCTGAGACATGATCCCTGATGGTACGCTGATGATCGGACTGATGCTGATAAAGAGATCCTAAACGTAGCCTAGATATATTACCTCAGTACG
  5   1   2      seed Lmb2 5g                         IMAGE:8635844.5p                                                                                                                                                                                                                            CTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAATTTTTGCACTCAGCAAAAATTT
  5   1   2       bld Lmb2 5g                         IMAGE:8635746.5p                                                                                                                                                                                                                            CTGCTATTGAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGNCAAAAAATTTGGAAA
  5   1   2       bld Lmb2 5g                         IMAGE:8638292.5p                                                                                                                                                                                                                                    GAAATACAACTATATTTGGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAATTTTTGCACTCAGCAAAAAATTTGGAAAGCTTTTGTGGAAGATATGATTTCAACGAGATGCAGAGCAGTAGACAGAGGCTTGCAATGAGATTAATGAAGGAGTCCGGGGATGTAATTTGCCTCACAAATTGGAAGCTTGGG
  3   1   2       bld Lmb2      in                    IMAGE:8636142.3p                                                                                                                                                                                                                                      AGAGCGGTCCGGGGAATTGGTAATTGCATCAGCGGCAGTGATAAGCTATTGGGGAGGGATACGAGTCAATCCGAGATGCAGAGCAGTTGACCAGAGGGCTTGCAGATGAAGATTAAGATGAAAGAAGAAGTCCGGGAATGTAACTCTGCAATCAGCAAAAAAAATTTGCAAAAGCTCAGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAAAGAAGAATCCT
  5   1   2       bld Tad2 5g                         IMAGE:6873409.5p                                                                                                                                                                                                                                                     NGAAAAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCCAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGGAATTGGTAAATTTTTGCACTCAGCaaaaaaaaTTTGGAAAAAGCCTTTTGTGGGGGAAAATAATGAATTCCAAACGAAAATGCCCGAAACCAGTAGGGACCAGAAGGCCTTTTTGCAAATTGAAT
  5   1   2       bld Tad2 5g                         IMAGE:6933984.5p                                                                                                                                                                                                                                                        GGAGATGTTCAAAGGATTATTTATCTGTTCACTAATTGCTGTGATCTGTGCAAATGCACTGCCACAACCAGAGGCCTCTGCGGATGAAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCCAAACGAGATGCAGGAAGCAGTAGGGACCCAGAGGCCCTTTGCCAGAATGAC
  5   1   2       bld Lmb2      in                    IMAGE:8638074.5p                                                                                                                                                                                                                                                                   GAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGGAAAAGCTTTTGTGGGAGAGATAATGAATTTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGATAGTTTCAGCACAGAAAAAACATCACTGAGACATGATCCCTGAAATGTGTAACGCTGAATGATTCTGGACCATAGTATTGCTGATAAAGAAGATCTTAGAATAGCTATACTTACCGGTATATATATACGT
  5   1   2       bld Lmb2                            IMAGE:8638849.5p                                                                                                                                                                                                                                                                                      AGATAATGAAGTCAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGGATTGGGTAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGAAATGAATTCAAACGAGATGCNAAAGCGTGATGACAGAGATGGGTGATAGTTCAGCACAGAAAACTCCTGAAGACATGATCCCTGAATGTGTACGCTGATGATCGAA
  5   1   2       bld Tad2                            IMAGE:6873108.5p                                                                                                                                                                                                                                                                                       ATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGGGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAAGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCCGGGGAATTGGTAAATTTTTGCACTCAGCCAAAATTTGGGAAAAGCTTTTGGGGGAGAGATAATGGAATTCCAAACGAGAAGCAGAAACCAGTAAATGACCAGGAGAATGGGGTTGAATAGTTTCGCCACCAGAAAAACCTTCCTGAAGGAACAATGGATTCCCCCTGAAAATGTGGTAACCGGCCTGG
  3   1   2       bld Tad2      in                    IMAGE:6876299.3p                                                                                                                                                                                                                                                                                          ATTCAAAAACGGGATGCAGAAGCCGTAGGACCCGGAGGTCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCCGGGGAATTGGTAAATTTTTTCCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACTAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCGGAATAAAAAGAAGACT
  3   1   2       add Lmb2      in                    IMAGE:8635805.3p                                                                                                                                                                                                                                                                                                             TGTTTTTATGTTTTCCCGGCCTTTGCAGAAGAAGATTTAGATGAAGAGGAGTCCCGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGGTTTTTTGGGAGGGATAATGAATTCAAAACGAGATGCCGAAGACGCTGTGGCCCCAGGCGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTGATAACCTTACCTACAGTATATAACCCCAAAANCCCCCCnnnnnnnnATCCC
  5   1   2       bld Lmb2      in                    IMAGE:8636142.5p                                                                                                                                                                                                                                                                                                              GAGAATTATTAGAAAACCAAGGTTCGATTCGAATTCGTCCCATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGCAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAGCTTTGTGGGAGAGATATGAATTCAAACGAGATGCAGAGCAGTAGATGACAGGAGATGGGTTGATAGTTTCAGCACAGAAAACATCACTGAGACATGATCCCCTGAAATGTGTAACGCTGATGATTCTGACTAGTATGCTGAATAAAAGAAAATCCTTAGATAACCTATACCAACGTATATATACCTACAT
  5   1   2       bld Tad2                            IMAGE:6933298.5p                                                                                                                                                                                                                                                                                                                                           GGGGAGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAAGCCTTTGCAGATGAAGATTTCGATGAATAGAAAGTCCCGGGGGAATTGGTAAATTTTTTGCACTCAGCCaaaaaaatttggaaaaaGCCTTTTGTGGGGAGAAAATATGGAATTCCAAAAGAAGATGCCGAAACCCGTAAGGAACCCGAAGGCCCTTTTGCCGAAGAAAAATTTTTGAATGAAAAGAAAAGTTCCGGGGGGAAATGGGTAAAATTTTTGGCACCTCCAGCAAA
  5   1   0       add Tad2                            IMAGE:6881599.5p                                                                                                                                                                                                                                                                                                                                               AGATATGGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCGGGCAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTACGACCAGAGGCCTTTGCACATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATCTTTGCACTCAGCCAAAAAATTTGGACAAGCTTTTGTGGGAGAAATACTGACTTCAAAACGAGATGCAGAAACCGTAGGACCAGAGGCCTTTGCAGATGAAGATTTTAGATGAAAGAGAGGTCCGGGGAATTGCGCAATTTTTTGCCTCAGCCAAAAAATTTGGAAAACGTTTTGCGGGGAGAAATTATGAATTTCCCCACGAGATGGCCAAAGCCCCACGACCCGAAGGCCTTTGCCCAATGGANATTTTCCCCCAACATAGACGGCCCCGGGCAATTTGCCCAATTTTTCGGCCTCCCGCCAAAACACCGCCTGGTACACCGCTCTTTCCTGGCCGCCAACACTATTGGAATTCCCAAAAACCCCAACTgcccgaacccagccccggcaccccataacgtccctctttcccccaccaccccaccccaTAACGGCTACCACTCCTCGTCCCACGCGCAAGTTTCCGGCCACACTCTTCCGCCCCGCCTCACCCTCAATACACTCTCCCCAATATTNCCTCCTTGCCCCCGCAAACACCCCGCCCNACGCT
  5   1   2       bld Lmb2                            IMAGE:8638747.5p                                                                                                                                                                                                                                                                                                                                                      GATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGANAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGATAACTATACTACAGTATATTACCTACAATAACTGAGCATCNNCATATaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCGCGCAGGCTGATTCCTAACGCGCTCGGCTCTCGCTAAGGAGCGATACTAATCGATGAAGACATGTGATTGACACCACTGAGCTG
  5   1   2       bld Tad2      in                    IMAGE:6873610.5p                                                                                                                                                                                                                                                                                                                                                          AAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAGAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGGAACATAGTAGTGCTGAAATAAAAAGAAGATCCCCTTTAAATAACGCTATACCCTACCGGTATAATATACCCTTACCAATTAAACTGGAGGCATCCACAGCCAAAAAA
  5   1   2       bld Tad2      in                    IMAGE:6876583.5p                                                                                                                                                                                                                                                                                                                                                                                                                      CTGTGGGAGAGATAATGAAGTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGGAATTGGTAAATTTTTGCACTCAGCaaaaaaaaTTTGGGAAAAGCTTTTGGTGGGGAGAAATAATGAATTTCAAAACGGAGATGCCAAAAGCAGTAGGAACCAGAGGGCCTTTGGCCGATGAAAAATTTTACAATGAAAAGAAGAAGGTCCCGGGGGAAATTGGGTAAAATTTTTTGCGCACTCCAGCCaaaaaaaattttgcggaaaaagccctttttggggggggAGAAAATAATAGTGGATTTCTCAAAACACGAGAAAGTGGCCCAAAACCCCCGTAAATGTTGAACACGGGGACACATCGGGGGTTTCGGAAATAAAA
  3   1   2       bld Lmb2      in                    IMAGE:8636520.3p                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTGGAGAATAATGATTCAAACGAGATGCGAAGCCGTAGGACCAGAGGCCTTGCAAGAGGATGTTTAGATGAAAGAGAGTTCCGGGGAATGGTAAATTTTTTGCACTCAGCAAAAAAATTGGAAAAGTTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCATTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAACNGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGATAACCTATACCTACAGTAATTACCTCACAANCGCAACCNNNTTTNNNAAAAA
  5   1   2       bld Lmb2      in                    IMAGE:8635805.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAAGATCCCTTAGATACCTATACCTACGTATATTCCTACAAATAACTGAGCATCACATaaaaaaaaaaaaaaaaaaaaaaaGGGCGCGCAGGCTGATTCCTGACGCGCTCAGCTCTCGCTATGGAGCGATACTAATCAACTGAAGATCTGTGAGTGACACC
  5   1   2       bld Lmb2                            IMAGE:8638427.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAAATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTCGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCTGAACATAGTAGTGCTGAATAAAAAGAGATCCCTTAGATACCTATACTACAGTATATATACTACAATAACTGAGCTCACATATaaaaaaaaaaaaaaaaaaaaGGCGCGCAGGCTGATTCCTGACGCGTCAGCTCCGCTAATGGCGATACTGATCGATGAAGATCTGTGATGACACCACGATGTGAAATGT
  5   1   2       bld Tad2                            IMAGE:6935771.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGGACCAGAGGCCTTTGCAGATGAAGATTTAGATGAAAGAGAGGTCCGGGGAATTGGTAAATTTTTGCACTCAGCAAAAAAATTTGGAAAAGCTTTTGTGGGAGAGATAATGAATTCAAAACGAGATGCAGAAGCAGTAGATGACAGGAGATGGGTTGAATAGTTTCAGCAACAGAAAAACATCACTGAAGAACAATGATTCCCCTGAAAATGTGTAAACGGCTGAAATGATTCCGAACATAGTAGTGCTGAATAAAACGAACATCCCTTTCGATAACCTATCCCCCACAGTATATATACCTACTAATTAACTGTACCATCCTCCATAAACCCCTCTCTTTCTATATTCTTGGTCGGCCTCCCTCGTCCCTCTATAAACCTTCTTTAGAACATTccccttggccccccgacccccTTTTAGGTAATGTGAACCTGGCCCACTACACCTCTTCCCCAGGAAAAATCTTTGGTCTATTAATTTATGCGCCCCGGATTTCTCCCTTCaaaaaaaaaaCCCCCCGGTGTGGGCATAACAAATTGTTATCAATACCAACTTCCCCCAAGGGCATCTCTCTACAACATCACTAATTGGAACTACACTACCCGTGATACTACTCAGATCGCGCCTCTAAAATATATACAATTTCATCCCTCTTTAACCTTTCCCGTCCTCATACGACCGATATATTGTTCCTAGAAAATCTCCCCCTCTTACCCTCTACTGGTGCGCGAAATTTGATAATCCCCCTCTCCCCCATAGTGTCGCCTCGGTTCGCAACTCGTAGAATATGCCCGCGGCAAGCTCTCATAAATGATTCTCTTTGCTCGACGCCC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)