Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL463d10ex.3                         32 END     11         29       34                (no blast hit)
     2   2.0    0Xl3.1-IMAGE:7207718.5                      14 END     1           2        7                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-IMAGE:7208048.5.5                    23 PI      88         25     1565                Serine/threonine-protein phosphatase 4 regulatory subunit 2

 This cluster: approximate FL confidence score = 98%

 1012769321 Xl3.1-IMAGE:6326223.5 - 37 ESTs
                                                                       .-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6326223.5                                                    CGAGCGCCATATTGCGCGGCGACGGCGGCGGCTTCTGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATAAAAAAAAATTTTATGTACAAAAAAAGTGGACTTTTTAGTTTTTTTTCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTTTGTATAGATTTCTTTTGT
                                                  Xl3.1-CHK-1012687407                                                          CCATATTGCGCGGCGACGGCGGCGGCTTCTGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATAAAAAAAAATTTTATGTACAAAAAAAGTGGACxTTTTxGTTTTTTTTCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTTTGTATAGATTTCTTTTGTTTGTGT
                                                      consensus depths                                                         4     6     5     6     6     6     6     8     6     9     8    11    13    15    16    19    18    19    19    19    19    19    19    19    19    19    19    19    19    19    21    21    21    21    21    21    21    21    21    21    21    21    21    22    22    22    22    22    22    22    22    22    22    22    22    22    23    23    23    23    22    23    24    24    22    23    23    23    23    23    23    23    23    23    23    23    23    23    22    23    21    23    22    23    22    23    22    23    22    23    19    23    21    22    19    21    20    21    20    23    22    23    20    24    20    23    20    23    18    23    18    23    19    23    17    22    17    22    16    20    17    20    17    21    14    20    16    20    17    20    14    20    16    21    15    21    14    21    14    20    14    19    13    19    13    20    15    20    11    19     9    18    10    17    10    17     9    14     9    13     9    13    10    13    10    12     8     9     8     9     7     9     6     9     7     9     7     9     7     9     7     9     7     8     7     8     7     8     7     8     6     8     7     8     7     8     8     8     7     7     7     7     7     7     7     7     8     9     7     9     8     9     8    10     9    10     9    10    10    10    10    10    10    10     9     9     9     9     8     9     9    10     9    10     9    10     8    10     8    10     8    10     7     9     7     9     9     9     7     9     4     9     3     8     3     8     3     7     3     7     3     7     3     7     3     7     3     7     3     6     2     6     2     6     2     6     2     6     2     6
                                                                   SNP                                                                                                                            T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -C----------
                                               BLH ATG     228    1480                                                    
                                               BLH MIN     228     154                                                    
                                               BLH MPR      93     154                                                    
                                               BLH OVR     228    1192                                                    
                                               CDS MIN     228     154                                                    
                                               EST CLI      58       7                                                    
                                               ORF LNG     228      94                                                    
                                                                                                                                                                                                                       PROTEIN --- Ce ---- 9e-010     NP_491907.1 protein phosphatase 4 regulatory like (42.2 kD) (1H202) [Caenorhabditis elegans] --------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- ?? ---- 5e-014     XP_644996.1 protein phosphatase 4 regulatory subunit 2 [Dictyostelium discoideum AX4] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ag ---- 2e-029     XP_001688384.1 AGAP002501-PA [Anopheles gambiae str. PEST] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-034     NP_996400.1 CG2890-PC, isoform C [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PREDICTED - Sp ---- 4e-040     XP_001184313.1 PREDICTED: similar to Wu:fe11b04 protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - ?? ---- 4e-083     XP_581095.4 PREDICTED: protein phosphatase 4, regulatory subunit 2 [Bos taurus] ---------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Dr ==== 1e-106     NP_001108612.1 protein phosphatase 4, regulatory subunit 2a [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 2e-132     NP_891984.1 RIKEN cDNA C230060M08 [Mus musculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Hs ==== 1e-137     NP_777567.1 hypothetical protein LOC151987 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Cf ==== 9e-141     XP_863179.1 PREDICTED: similar to protein phosphatase 4, regulatory subunit 2 isoform 6 [Canis familiaris] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Gg ==== 3e-143     NP_001006142.1 similar to protein phosphatase 4, regulatory subunit 2 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 0          Q28IG6.1 Serine/threonine-protein phosphatase 4 regulatory subunit 2 [Xenopus tropicalis]  ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xl ==== 0          NP_001087055.1 protein phosphatase 4, regulatory subunit 2 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xl3.1-IMAGE:6326223.5                                                                                                                                                                                           TGA------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------TAA------------------------------------------------------TAA------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Oo1  5g                         IMAGE:5079234.5p TGTAGCCGCTGCTTACTCCCGCCCTCCTTTTGCGCGCTCCTCGTGACGTCACGAGCGCCATATTGCGCGGCGACGGCGGCGGCTTCTGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCGTGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAAGCACTCCCAGAGTTACACAGACAGGTCAAATGTTTATGGGTCCTGGAANCCCNAAGACGGACCAATCGGGCCAAATTTCACCTTGTCGAGTCCAATGAACCACAAATGGTTTGCCCTGACAGTATGGAAAAATAAAGAAATC
  5   1   2       bld Emb4 5g                         IMAGE:5571581.5p                CTGGACCAGGCCGGCTCTGCGGAATAATGTCGACCCCCGCGTCCGTATTGCGCGGCGACGGCGGCGGCTTCTGGGATCTCTGTTCGCTCACAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCCAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGGTCGAGTCCCATTGACCACAAATGGGTTTGCCTGGACCGTATGGAAAAATAACGGAATCCCCACTTGCCGCCATAAAAGAAAAAGAGTCTTGAATGGACTTCTGCCGCGGGTTTGAATGATG
  5   1   2       bld DMZ  5g3  out                        xl319m21.5p                                             GACGTCACGAGCGCCATATTGCGCGGCGACGGCGGCGGCTTCTGGGGTCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGTTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGT
  5   1   2      seed DMZ  5g3  out                        xl310l05.5p                                             GACGTCACGAGCGCCATATTGCGCGGCGACGGCGGCGGCTTCTGGGGTCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGTTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGA
  5   1   2       bld Emb9 5g                         IMAGE:7976463.5p                                               CGTCACGAGCGCCATATTGCGCGGCGACGGCGGCGGCTTCTGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTATTGACTGACCCACGTAGGAATTACACTGGCACTGACAAGTTTCTGAGTAGAGTAGATAAGATATCATGGTTGTGAGCTGTGTATACCCTTCCTTTGAGAATACACTTCTCCCGTCTTCACCGCATGATATGCGTTTGTTTCTAGTTATTCCCTTAGTTACTATACTG
  5   1   2       bld Ooc3 5g3  out                   IMAGE:3472808.5p                                                  GAGCGCCATATTGCGCGGCGACAGAGGCGGCGGCTTCTGGGATCTCGGTTCGATCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCACAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGCTACTGACTGACCCA
  5   1   2       bld Ga18 5g3  in                      xlk125p21ex.5p                                                                                   GCTTCTGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGNGTGGAGAGCGGNGNNGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGNGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGANTGTCGCTAGNTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTNNGAGTTACTGACTGACCCACGANGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGNNTGTGAGCTGNGTA
  5   1   2       bld Te2N 5g                         IMAGE:7205817.5p                                                                                       TGGGATCTCGGTTCGCTCAGAGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAAGTCAAATGTTAATGGTCCTGGGACCCCCAGACCGACAAATCCGGCAAAATTCCCCCTTGTCAAGTCCCATGAACACCAATGGTTTTCCCTGACATTTGGGAAAATAAGAAATCCGACTTGCAGCCaaaaaaaaaGAATCTTGATTGACTCTGCCATGTTTTGATGATGGGATCCCAAGCAACCTCCTCCCAAAAAATAAGCCTTTCCGCCTTAGAAAACCC
  5   1   2       bld Egg3 5g                         IMAGE:6326223.5p                                                                                                    TTCCCGGGGGTGTTTCCGTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAAATAAGCATTTCAGCTTGAGGAACTCTGTAGAAGCTG
  5   1   2       bld Ga15 5g3  out                      XL463d10ex.5p                                                                                                            GTGTTTCCGTCGCTTGTTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCANAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAG
  5   1   2       bld Ga18 5g3  in                      xlk121h03ex.5p                                                                                                              GTGTTTCCGTCGTTGTTCAGCGTGGAGAGCGGNGNNGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTNNGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGNTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGNCCAATGAACACAAATGGTTTGCCTGACAGNNTNGNAAAATAANGNA
  5   1   2       bld Oo1  5g                         IMAGE:6642771.5p                                                                                                                     GTCGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGNGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGANAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCANAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCANAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCANAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTTCAAGCAACTCCCAGAGTTACACAGACAGGGTCAAATGTTAATGGTCCTGGNAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTTGTCGAGTCCAATGAACCACAAATGGTTTGCCTGAACGTATGGAAAATTAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTTGCAGTGTTTTGATGAATGGATCCACAAGCAATTAACTCCAAAAAAATAAGCATTTCCGCTTGAAGGGACTCTGGGTAAAAANCTTGAAGGAACCCCGAAAGCCCAGGAAAGACTAAAAATTTGGATTACC
  5   1   2       bld Oo1  5g3  out                   IMAGE:3405411.5p                                                                                                                      TTGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGGGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGG
  5   1   2       bld Emb1 5g                         IMAGE:6864837.5p                                                                                                                       CGTTGCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAAATTCACCTTGGTCGAGTCCAATGTACACAAATGGTTTTGCCTGACAGTATGGAAAAATAAAGAATCCCGACATTGCAGCCAGAAGGAAAAAGAGTCTGAAGTGAACTCTGCAATTGTTTTGAATGATGGGATCAACAAGGCAACTTCCTCCaaaaaaaaTAAACCATTTTCCGCCTTGAGGGAACTCTTGTTAGAAAGCCTTGAAGGGAACACCCGAAAG
  5   1   2       bld Oo1  5g                         IMAGE:6639398.5p                                                                                                                           GCTCAGCGTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAAACCNCCAGACGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAANAGAAAAGAGTCTGAGTGACTCTGGCAGGGTTTTGATGATGGGATCACAAGNCAACTACTCCCAAAAAATAAGCAATTCAGGCTGAGGNACTCCTGTANAAGCTGGAAGGAACCACGAAGGTCCAGGAGAACTTAAAATTTTGGATAACCAAAAGC
  5   1   2       bld Oo1  5g                         IMAGE:5079406.5p                                                                                                                                  GTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAAATAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTTCCAAAAAATAAGCATTCCAGCTTGAGGACTCCTGTAAAAACTGAAGA
  5   1   2       bld Emb1 5g                         IMAGE:5156062.5p                                                                                                                                  GTGGAGAGCGGAGGCAGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGGACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGGTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTTTGATGGATGGGATCACCAAGCAAACTACCTCCaaaaaaaa
  5   1   2       bld Ga15 5x3  out                      XL409d03ex.5p                                                                                                                                   GAGAGCGGAGGCAGGGTAACAGGCCCTCGTTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCNACCGGCTCCAGGAGGCTTTGAAAGATTTTNAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCANTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCANAGAGTACTTTTTATTTAAACTGGANAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCGAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCG
  5   1   2       bld Ga12 5g3  out                        XL168n24.5p                                                                                                                                        GGCGGAGGCNGGGAACAGGCCCTCGTTTCCTCCTGTGGGGTTCGTTTTCTGTGAAGGAGGAAGCGATTACGGACGGGGCTGGGAGCGAGGGGTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGA
  5   1   2       bld Oo1  5g                         IMAGE:6639228.5p                                                                                                                                                                                                                                   GTAACGGGAGGCAGCCGGTGTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCCAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTANNATTTGATACAGAAGAGGATGAGGAAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGGAGGTCTCCACTGNAAATGGGCCGAGNAAGCTGAAATGTGCATTCCTACAGTGCGGGATAAAAGGGGAA
  5   1   2       bld Emb4 5g                         IMAGE:5516112.5p                                                                                                                                                                                                                                     AATGGGAGGCAGCCCGTTTCTGTGTGTGCGCGACACCCTCCTCTTCCGGCAATGGACGTCGACCGGCTCCAGGAGGCTTTGAAAGATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACNNAGCACTACTCCAAAAATAAGCATTCAGCTGAAGACTCTGTAGAAGCTGAAGAACACGAAA
  5   1   2       bld Te2N                            IMAGE:7768293.5p                                                                                                                                                                                                                                                                                                     GGAGATCTTGCAGAAGGAATAATTTTGAAAAAAGAGGAAAGAAGGACGTTTCTCCTGAACTCGACCAGTTTCTGTGTCATGTTGCAAAGACTGGAGAGACTGTGGTCCAGTGGCCACAATTCAAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGA
  5   1   2       bld Em10                            IMAGE:7979969.5p                                                                                                                                                                                                                                                                                                                                                                                                    GAGACTGTGGTCCAGTGGCCACAATTCCAAGAGTACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAACTAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCCCACTTGAATGGCCGGGAAGCTGAAGTGCATCTACAGTGNCGATAAGGAAAGAAGCTGTAAACAGCCAACTGCAATGAGAGTCTTATGAAGCGATGATCCCTGAGTAAGTCACGAAGGAATTAACTTGATGGATGAGATCTCAAGAA
  5   1   2       bld Tbd7      out                        XL106a05.5p                                                                                                                                                                                                                                                                                                                                                                                                                                     TACTTTTTATTTAAACTGGAGAAGGTGATGGATGATTTTCGCACTTCTGCTCCTGAACAAAGAGGACCCCCAAATCCAAATGTGGAATATATTCCTTTTGATGAGATGAAGCAAAGAATACTAAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAA
  5   1   2       bld Tbd7      out                        XL061m20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAGATTGTCGCTAGTTTTAATGGCACTCCTTTTACTATTCAGCGGCTCTGCGAGTTACTGACTGACCCACGAAGGAATTACACAGGCACAGACAAGTTTNTGANAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCA
  5   1   2       bld Oo1                             IMAGE:6641898.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACAGACAAGTTTCTGAGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAAGCCACGAATGCGGCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTTCTGTTTTACACGGTATaaaaaaaaaaTTTTATGTACNAAAAAAGTGGNACCTTTTTT
  5   1   2       bld Ov1       out                   IMAGE:5073966.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCACGCGTCCGGAGGAGTAGAAAAGAATATCATGGTTGTGAGCTGTGTATACCCTTCTTCTGAGAAAAACACTTCTCCCAGTCTGAACCGCATGAATGGCGTTATGTTTCCAAGCAACTCCCAGAGTTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGACCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGA
  3   1   2       bld Ga18 5g3  in                      xlk121h03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TNNAAANANNTCATGNTNTGAGCTGNNNNNNCCCTTCTTCNGAGAAAAACNCTTCNNCAGTCTGAACCGCATGAATGNCGTTATGTTTCCAAGCAACNCCNAGANNTACACAGACAGGTCAAATGTTAATGGTCCTGGAACCCCAAGNCCGACAAATCGGCCAAAATTCACCTTGTCGAGTCCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTANCCAATTNCCNCCGACNCNCCAGTNNTNCAG
  3   1   2       bld Ga18 5g3  in                      xlk125p21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGGTCAANTGTTAATGNNCCTGNANCCCAANNCNNCNAATCGNNNAAATTCNCNTNNNCGAGNCCAANGAACACAAATGGTTTGCNTGACAGTATNNAAANTAANGNATCCGNNNTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGNNNCTACTCCAAAAAATAAGCATNCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGNCTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGNTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTNNGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTCCAGACACTTCTGTTTTTACACTGTATAAAAAAAAATTTTATGTACAAAAAAAGTGGNCCTTTTTTANNNNNNNTTCAAAAGGC
  5   1   2       bld Ooc3      out                   IMAGE:3437287.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAATGAACACAAATGGTTTGCCTGACAGTATGGAAAATAAAGAATCCGACTTGCAGCAGAAAGAAAAGAGTCTGAGTGACTCTGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCACTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATC
  5   1   2       bld Ga15      out                      XL520m11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCACGACGTCCGGCAGTGTTTGATGATGGATCACAAGCAACTACTCCAAAAAATAAGCATTCAGCTGAGGACTCTGTAGAAGCTGAGGAACACGAAGTCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCAGCGTGTGCTAATCCAGACGCATCTAGTGAGGTCTCCNCTGAAATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAANGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCACTGAGGTAGAGTGCAACGAGAGGGACAATGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaaagtggacctttttagttttttttCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACT
  5   1   2       bld Ga15      out                      XL493m12ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAACACGAAGATCAAGAGACTAAAATTTGATACAGAAGAGGATGAGGAAGCANCGTGTGCTAATCCNGACGCATCTAGTGAGGTCTCCACTGANATGGCCGAGGAAGCTGAATGTGCATCTACAAGTGCGGATAAAGGGAAAGAAAGCTGTCAAACAGCACAGACTGCAGATGAAGAGTCTTTAATGACAGCGAGTGAATCCNCTGANGTANAGTGCAACGAGAGGGACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCANATGGAGGAATCTGAACAGTCTGAATCNNCCTGTTCTCTGAACAGTGAANAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaaagtggacctttttagtttttttttCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTCTGTATAAATTTCTTTTGTTTGGGttttttttttAT
  5   1   2       bld Egg1                               PBX0065E01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GACAGTGAAACTGTGAGTGTGAGTGAAGAGTCCTCAGAGGAGAGTCATCAGATGGAGGAATCTGAACAGTCTGAATCAGCCTGTTCTCTGAACAGTGAAGAGCCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAATCAATTGCCGCCGACACACCAGTATTTTCCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaagtggacctttttagttttttttCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCACGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTTTGTATAGATTTCTTTTGTGtttttttttttttttt
  3   1   2       bld Ga18      in                       xlk51g22ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAATCTGAACAGTCTGAATCAGCCTGTTCTCGGAACAGTGAAGAGCCGAACTCTGCTGCTGNAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATAAAAAAAAATTTTATGTACAAAAAAGTGGACCTTTTTAGTTTTTTTTCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGNNNNGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTCTGTATAGATTTCTTTTGTTTGTGTTTTTTTTTTATTCTTGTTTAGAAAGTTTTTAAACTGGATGGCTNTTCCTTTCCCCTCGAGGTTTCAACATTGG
  5   1   2       add Ga18      in                       xlk51g22ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAATCTGAACAGTCTGAATCAGCCTGTTCTCGGAACAGTGAAGAGCCGAACTCTGCTGCTGCNGCGGNNNNNNTNNNNTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTTCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaagtggacctttttagttttttttCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTNTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTCTGTATAGATTTCTTTTGTTTGTGttttttttttATTCTTGTTTAGAAAGNTTTTAAACTGGATGGCTATTCCTTTCCCCTCGAGGNTTCAACATTGGNTACGTTATTAGAAGGAGAAAAATAAAGNTCTGTTGTCCTTTNNNNNANAAAAAA
  5   1   2       bld Egg1                               PBX0016A04.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CACGAGGCGAACTCTGCTGCTGCAGCGGCGAGCACTGCGGGTACCGACTCCAGCGAGGGAAACATTGGTATCAAATCCACTGAAATCCTTTCATTGTCTCCTATGGAAAACAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAATTAATTGCCGCCGACACACCAGTATTTTCCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaagtggacctttttagttttttttCAAAAGGCAAGTAAACCACAGACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTTTGTATAGATTTCTTTTGTGTTCTCATCATTGTCTTATTCTTGCTTAGAAAGTTTTTAAACTGGATGGCTATTCCTTTCCCCTCGAGGTTTCAACATTGGTTACGTTATTTAGAAGGAGAAAAAGAAAGTTCTGTTGTCCTTTCAGTTGATTTCATCTGATTAAGGGTGGAACTCCTCTCGGTGCGGCTCGAGCCGACGCGTCGCCATGTGACGAGGCGCGTGCGTCGTGTCGGGTGTTCTGAAGATG
  5   1   2       bld Em10                            IMAGE:8321847.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGGAAAAAGTGAAGAGGCCACGAATGCGCCAGAGGAACCTATGGAACAAGACTAACCAATTGCCGCCGACACACCAGTATTTTCCAGACACTTCTGTTTTTACACTGTATaaaaaaaaattttatgtacaaaaaaagtggacctttttagttttttttCAAAAGGCAAGTAAACCACAAACTACTCTGGAATAAAAACCTGAACGAGCTTTACTTTCCCTTTATAAGACTGAATCTGCAACTCCAGGTTCTGTGCTCGCCGCTGATTGTCAGTTGGGTAAAAACAATGGTTTCTGTATAGATTTCTTTTGTGttttttttttttttATTCTTGTTTAGAAAGTTTTTAAACTGGATGGCTATTCCTTTCCCCTCGAGGTTTCAACATTGGTTACGTTATTAGAAGGAGAAAAAGAAAGTTCTGTTGTCCTTTCATTTGATTTCATCTGTTTAAGGGTAGAACTCCTCCTCGCACTTCTAAAGCAAAAGCTCATCCTTATGATAACTTGCTTGCTCCCTGTACCATCATGACACTCATTCATTAGTAAATCTACTTTCCAAACTTCACATATATTGATTCCATAAATCTTCATTCTTATAACTATATCAACTAGATAATCTCCTTATTCCTAAGCATCTGATCTTTTTTCTATCATTCAAATATTGCAACCTCAAAATTGTATAATTCCATCATCCCTTCATATATTAAATATCTTTTCTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)