Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 18 Jan 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-IMAGE:6948062.5.5                    44 PI      92          3     2281                (no blast hit)

 This cluster: approximate FL confidence score = 98%

 1012769345 Xl3.1-IMAGE:6641871.5 - 46 ESTs
                                                                       .......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6641871.5                  GGAAAGCGTAGTGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTATG
                                                  Xl3.1-CHK-1012686841                        CGTAGTGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACC
                                                      consensus depths                       3     3     3     4     6     8     8    10    10    12    12    14    16    17    16    17    17    17    17    17    17    17    17    17    16    17    17    17    17    17    17    17    17    17    17    17    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    18    19    18    19    18    19    18    19    19    20    19    20    20    20    20    20    20    20    20    20    19    20    19    20    18    20    19    20    19    20    18    19    18    20    16    19    16    19    16    19    16    19    16    19    17    19    16    19    15    19    15    19    15    19    16    20    16    20    14    20    16    19    15    19    14    19    15    19    13    18    14    19    13    17    11    17    13    18    11    16    10    16    10    15    10    15     8    14     8    14     9    14     8    13     8    13     8    13     8    12     8    11     8    10     8     9     8     9     8     8     8     8     8     9     7     9     7     9     7     9     8     9     8     9     8     9     9    10     9    10     9    10     8    10     7    10     7    10     7    10     7    10     6     9     7     8     8     9     8     9    10    10     8     9     7     9     7     9     7    10     8    10     8    10     8    10     8    10     7     9     7     9     7     9     6     8     6     8     6     9     6     9     6     9     6    10     7    10     8    11     8    10     8    10     8    10     8    10     8    10     8    10     8    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    11    11    10    11    12    13    12    13    12    13    13    14    13    14    11    13    11    13    12    14    13    15    14    16    14    16    14    16    14    16    15    17    15    17    16    18    16    18    16    18    15    18    15    18    15    17    15    17    16    17    15    16    15    16    14    16    14    16    14    16    14    16    13    16    13    16    13    16    13    16    13    16    13    15    13    15    13    15    13    15    12    15    11    14    11    13    11    13    11    12    11    12    11    12    11    12    11    12    10    12     9    10     9     9     8     8     6     7     4     7     4     6     3     5     3     5     3     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ------A-----
                                               BLH ATG      46    1747                  
                                               BLH MIN      46     372                  
                                               BLH OVR      46     459                  
                                               CDS MIN      46       7                  
                                               EST CLI       3       7                  
                                               ORF LNG      46     104                  
  5   1   2       bld Oo1  5g3  in                    IMAGE:3404958.5p TCTATTTACGTCTGTACGGAAAGCGTAGTGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAAT
  5   1   2       bld Tail 5g                         IMAGE:8544042.5p                  GGAAAGCGTAGTGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGACAGGCTCCCGTTGTTGTTGTGTGGAAACAGAAAAGGCATTCCTGCTGCCACACTCTATGGAAGGCTCTAGGATGACCCACTCATTTGGGAAAACTTGCCCGGATCTTTGATGGAAAGGGGAAGTCCGGGGGATCCCCCCTCAAAAAAAGAACCACATCCTT
  5   1   2       bld Lmb1 5g                         IMAGE:8533980.5p                  GGAAAGCGTAGTGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATCGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTNCTANGTATGACACCAGTTATTTTGTGGGATACTTTGCCCTGNATCTTTTGATGGAAATGGGTGATGTCGTGGTGTGATCCCCTCTGTATGGAGAATGATCATACTCGCTCAGGGNCAGA
  5   1   2       bld Egg3 5g                         IMAGE:6324566.5p                          TCCCGGGGGTTTGTCAGTCAAGAGTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTTGTTGTTGTGTGGCAGACAGAAACAGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTANGTATGACACCAGGTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCCTGGTGTGATCGCCCTCTGTATGGAAGAAGGAATCCCTACATCCGTTTCAGGGCCAAGAACACTGGTTATAGCCACGGGGGGATATGGGACGTAAAAATTTCAGCTTGGACCTCTGGCTTATACCTGGCCCTGGAAAATGGGACTGCCAAGGGTAACAAAAACTGGGGCTTTCCATGGCCAGGAATTTTAAAAA
  5   1   2       bld Ga18      in                      xlk163j13ex.5p                               TGGTTTGTTCAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTNNCNNAAAGTGGCACCGTCAAGGCTTCTTAGCANNNNNTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGNNGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGANAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGNNCTCTTAGGNNTGACACCAGTTATTTTGTGGNATACTTTGCCCTGGNTCTTTTNATGGAAAATGGTGAATGTCG
  5   1   2       bld Oo1  5g                         IMAGE:6641871.5p                                GGTTGTTCAGTCAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGGTATAGCCACTGGGNNGGATATGGGACGTACATATTTTTCAGCTGTACCCTCTGGCTCATACCTGCCACTGGGGAGATGG
  5   1   2       bld Emb4 5g                         IMAGE:5570664.5p                                      CAGTCAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCCACCGNTGGTTGGTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACCACCTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGGGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAAATGGATCCATACATCGCTTCAGGGCCAAGAACACTGGTTATACCCC
  5   1   2       bld Sp1  5g                         IMAGE:4963052.5p                                          CAAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGA
  5   1   2       bld Sp1  5g                         IMAGE:5506080.5p                                           AAAGAGTTTAGAGCTGCATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACA
  5   1   2       bld Lmb1 5g                         IMAGE:8535086.5p                                                  AAGAGTACTAAATCTATTCGTCCCCTTTGCTGAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGNATCATACATCGCTTCAGGGCCAAGAACAC
  5   1   2       bld Te2N 5g3  in                    IMAGE:7202596.5p                                                           CATTGGGGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGGATCATACATCGCTTCAGGGCCAAGACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACCTGGAGATGGTACTGGCATTGGTTACTAAAGCTGGGCCTCCCATGCCCAGGAATTTATAAAT
  5   1   2       bld He1  5g3  in                    IMAGE:4407167.5p                                                                 GGACATGGCTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGGTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAA
  5   1   2       bld Eye1      in                    IMAGE:6957686.5p                                                                         CTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTTCAGGGCCAAGAACACTGTTATAGCCCACTGGGGGGATATGGGACGTACATATTTTCAGCCTGTACCCTCTGCTCATAACCTGCCACTGGGAGAATGGGTACCTGCCAATGGGGTTAACTAAGAGCCTGGGGGT
  5   1   2       bld Lmb1                            IMAGE:8535878.5p                                                                         CTTTGCTGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTNCTANGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGNNATCTTTGATGGAAAATGGTGATGTCGTGGTGTGATCCCCTCTGTATGGAGAATGATCNTACATCGCTCCAGGCCAGAACACTGTAAGCACTGGGGGATATGACGACTATTCACTGACTCTGCCCACCGCACTGA
  5   1   2       bld Lu1                             IMAGE:4056225.5p                                                                               TGAAAGTGGCACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGTGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCCGAACTGAACTAGGGAAAATTTCCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAAGAGGGAAGGCTCACCGGTGTTGGTGTGTTGGCGACAGAACAGGGCAATTCTTGGTGGCAAACACTTTATGGAAGGGCCCTTAGG
  5   1   2      seed Emb4                   IMAGE:5543360-IMAGp.IMAGp                                                                                        CACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCC
  5   1   2       bld Emb4                            IMAGE:5543360.5p                                                                                         ACCGTCAAGGCTTCTTAGCAGAGCACTGCAGTTAACCAGTACACTACAGAACTGCACAGCAACTTCTATAGCAGCAAGGCGTAACTTTCACTTCACAGTATATGGAAGGAAGGACACTTCAGCAAAAGTTTCTGATTCGATTTCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAAATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCCCTGGGGGATATTGACGTACATATTTCAGCCTGACCCTCTGGCTATACCTGCACTGGGAAATGGTACCTGCAATGGTTAACTAAAACTGGGCCTTCCCTGCCCAGATTTTAAAATTTGTACCGTTTTCACCCCCTACAGGAATCCTTGGGGCCCGGTATGTTT
  5   1   2       bld Te2N                            IMAGE:7765925.5p                                                                                                                                                                                                                                       TCAACACAGTATCCTGTAGTTGATCATGATTTTGATGCAGTTGTTGTTGGTGCTGGTGGTGCTGGATTACGGGCTGCGTTTGGATTGTCTGAAGCTGGCTTTAATACAGCTTGCATTACGAAGCTGTTTCCTACAAGATCTCACACTGTTGCCGCACAGGGTGGAATTAATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCANGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTCAGCTGTACTCTGCTCATACTGCACTGGAGATGTACTGCATGGTACTGAGCTGGCTTCCATGCAGATTAGATTTGACAGTCACCTACAGATCATGGGCGGATGTATACGAAGTG
  3   1   2       chi Ga18      in                      xlk163j13ex.3p                                                                                                                                                                                                                                                                                                                                                           TACNAAGCTNTTNCNTANANGANNTCANNCNNNTGCNGCACNNGGTGGAANNAATGCTGCCCTGGGNNNTATGNANGATGATGACTGGAGGTGGNACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGNCCGNACAANCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGANCTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACANTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGGTACCAATAATCAATATTGATTTTTCTTCTAAAAACATANGGTTACANCTTTGTTTTGTANCCAA
  5   1   2       bld Int2                            IMAGE:8530116.5p                                                                                                                                                                                                                                                                                                                                                                                                                ATGCTGCCCTGGGTAATATGGAAGATGATGACTGGAGGTGGCACTTCTATGACACAGTTAAGGGATCAGACTGGCTTGGTGATCAAGATGCCATCCATTATATGACCGAACAAGCACCAGCCTCTGTTATCGAGCTGGAAAATTACGGAATGCCTTTCAGCAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCACAGTNGAGGTGAAAGTTCNATGGAAGAATGCCCTGTAGCAAGGACTTGCTTCACGAATGTGGTTCCCGTCTATGACATAGAATGCAGAAGAGAGCTGTGGAAGACAGACATGTTACTCGCTCACACTTCACAGTCGTGCATCGACTCAGATTCGAAGCAGAATTCAGGTGAGACAGACATCTGCGCACTCTA
  5   1   2       bld Int2                            IMAGE:8820780.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGTTGCTAATAGATACGAGTCCTAATACTTTATTCGTCCCCCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGTGTTGATGTAACAAAGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACATACAAAGGCAGTGATTACCCATGTAAATGTGAAGAAGAGTGTGCCAGGCTTTATGCTTGTGAAAAGCTGCATCTGCTCAGTACTGAGCAACAGATTGGGCGCAAACTCTCTTCTGATCGTGTCTGGTCTGGCATGTGCTCTAGCATGCAAGATGCCAGGCTGGTGAATGCGTGCCCATCCA
  5   1   2       bld Emb9      in                    IMAGE:7976646.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAACTGAACAGGGGAAAATTTACCAGCGTGCATTTGGAGGACAGAGTCTTAAATATGGAAAAGGAGGACAGGCTCACCGTTGTTGTTGTGTGGCAGACAGAACAGGGCATTCCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCTCGACTCCCAGGAAATTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTTACAAAGGACCCCATTCC
  5   1   2       bld Ga15                               XL417d06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTTGCTGCACACACTCTATGGAAGGTCTCTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATANA
  5   1   2       bld Tbd7      in                         XL058b03.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTAGGTATGACACCAGTTATTTTGTGGAATACTTTGCCCTGGATCTTTTGATGGAAAATGGTGAATGTCGTGGTGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGTCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACA
  5   1   2       bld Egg1                               PBX0111F06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CACTAGGGTGATCGCCCTCTGTATGGAAGATGGATCCATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGTCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATG
  5   1   2       bld Egg1      in                    IMAGE:4784128.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATACATCGCTTCAGGGCCAAGAACACTGTTATAGCCACTGGGGGATATGGACGTACATATTTCAGCTGTACCTCTGCTCATACCTGCACTGGAGATGGTACTGCAATGGTTACTAGAGCTGGGCTTCCATGCCAGGATTTAGAATTTGTACAGTTTCACCCTACAGGAATCTATGGGGCGGGATGTTTAATAACAGAAGGTTGCCGTGGGGAAGGAGGAATCCTTATCAACAGTGAAGGTGAAAGGTTCATGGAAAGATATGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCT
  5   1   2       bld Bone                            IMAGE:8741869.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCTTCTTATTTGGGAGATCACATAAGATTCGTATTCGTCCCTGCCCCTGTAGCAAAGGACTTGGCTTCACGAGATGTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGTCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGCACGCAAAGAAAGTCGTGTGCCCATGCAGAGAGATACAGACGAGGATGATGAGTATGATTATTCAAACAATCAGGTCACAGAGAAAAGGTTTAGCGAGCACTGGAAGAGCCACCACTATCATATGTTGAATAGTAAAGGGAAAGT
  5   1   2       bld Lmb2                            IMAGE:8639069.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGGTTTCCCGTTCTATGACTATAGAAATGCGAGAAGGAAGAGGCTGTGGGAAGGACAAAGACCATGTTTATCTTCAGCTTCACCACCTTCCACCCAGTCAGCTGGCATCCCGACTCCCAGGAATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAAACTGATGTAGTGGAGACCTANAGCTACAAACTTATGCTATGTGCACTGCAAAAATTATATGCTGAGCACCAAGAAATCTGTGCCTGCATAAAATTCAAACAGATGTGATTTATTTCAACATTAGGCACAAAAATTTTCAGCTGAGACCCttttttttATAAGAAGACTGATCTCGTT
  5   1   2       bld Eye1      in                    IMAGE:4743721.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATTTCTGAGACAGCAATGATATTTGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGG
  5   1   2       bld Tad2                            IMAGE:6875985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGCAGGTGTTGATGTAACAAAGGAACCCATTCCTGTCCTGCCAACAGTTCATTATAACATGGGGGGTATCCCCGCCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCCATGCAACTTTAAATGAAGACTGTGCATCCTGTCCCGCCGGCAATTCGTTCCTAACTAAATTACCTTTTAATCCCATTTAATATGAAAATCATTTATTTTTGCAACACCAATCCTTGCATTGCCAAAAACCTTTGATGCCTAAGGAAATCCCAGGCAGGAATTTGGCCTTTAAAAATGCCATTCACATTCTGCCATAAGGTTCCTTTCTTAAAAAATGGGGGCAACTTTCGCCCTGGGCTATTTGGCCCACTTAA
  5   1   2       chi Bone                            IMAGE:8742298.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCGCGTGACGGCAATATGTATGAATTATTCGAATTCGTCCCATCCCCACCAATTACAAAGGGCAGGTGATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACCACACTATCATATGTGATAGTAAAGGAAAGGTTAGCTTGGAATACGGACCTGTAATCGATGCACTTTAAATGAAGACTGTGTGCATTCTGTCCCGCGCATCGTCTACTAATACTTATCATTATTGAATCATTTATTTGAACAATCTTGCATGCCAAACCTGATGCTGAAGATCAGTCAGATGCATATGCATCAATCGCAAGTCTTAAATGGTAATGCATGCCATTGGACATAAACCCTTGTCTGTAT
  3   1   2       bld Emb9      in                    IMAGE:7976646.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCTCTGGTCCATCAGATTGCGCAGATGCGTATACAAGACATCTTCTCACGTCTTTATGGGGTCCCACATCAAGGCGTGATACATTATGTGAGTAGGTGTCCAGGCTATGCTGTGGAGTGCATCGCTCAGTACATGAGCCACAGATGGCGCAACTTCTCTGGATCTGTGGTCTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGATGATCCGCTCAGATTGCTCAGCC
  5   1   2       bld Te2N                            IMAGE:7767123.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATTACCCATGTAAATGGTGAAGATAGAGTGGTGCCAGGGCTTTATGCTTGTGGAGAGGCTGCATCTGCTTCAGTACATGGAGCCAACAGATTGGGCGCAAACTCTCTTCTGGATCTGGTGGTCTTTGGTCGTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGATACAGACCTGTATCGATGCACTTTAAATGAGACTGTGCATCTGTCCCGCCGCATTTCGTCTACTAATTACTTTTATCATTTATATGAATCATTATTTGACACATCTT
  3   1   2       bld Te2N 5g3  in                    IMAGE:7202596.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGGAAGATGTCAGCTAGTGTGAAGCGCTTGTCATCAGAGCACGATGCGCACTTCTCTGATTGTGTCTTGTCGGCAGTGTCTAGCAGCAGAGAGTGCAGCTNGTGAGCGTGCATCATAAGGAAATGCAGAGAGAATCCGTGCAAATCTGACAAATTACGCTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCAAGGGTATTGTACATTAGACACCTTGCTGATACAGATCTTTGTTGTGTCTATGAAATTAAAAATC
  3   1   2       bld Eye1      in                    IMAGE:6957686.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGTTTCTTTGGTTGGTGGCATGGGCTTCTAAGCCATTGCCGAGGGAGGTGCAACCCCTGGTGAAAGGGTTTCCATCCATTTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAAATACGCTTTGCTAATGAAGCAACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATCTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAA
  3   1   2       bld Tbd7      in                         XL058b03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGCATGTGCTCTTAGCATTGCAGAGGAGTGCAAGCCTGGTGAAGCGTTGCCATCAATTAAGGAAAATGCAGGAGAGGAATCCGTTGCAAATCTGGACAAATTACGCTTTGCTAATGGAAGCACTAGAACTTCAGAACTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATGGCATTAAAAGCATTCAA
  5   1   2       bld Gas6                            IMAGE:3474684.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTTAGACTCAACATGCAGAAGACCATGCAGACTCATGCTGCAGTTTTCCGAACAGGTTCTGTGTTGAAGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCAAAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTG
  3   1   2       bld Tbd7                                 XL092a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGGAAGGTTGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTTTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTA
  3   1   2       bld Tbd7                                 XL057o23.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGAAAAACTGAGTGTCATCAATTCTGCAATGGATGACTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAAACTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCAAAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTAG
  5   1   2       bld Gas7                            IMAGE:4061822.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGGGCTTAAAGACATTTGATAGAGGTATTGTTTGGAACACTGATGTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTG
  3   1   2       bld Oo1  5g3  in                    IMAGE:3404958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTAGTGGAGACACTAGAGCTACAAAACTTAATGCTATGTGCACTGCAACCAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAA
  3   1   2       bld Egg1      in                    IMAGE:4784128.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAACTTAATGCTATGTGCACTGCAAACAATTAATAGTGCTGAGGCACGCAAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTTTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTATGACAATAAAAA
  3   1   2       bld Eye1      in                    IMAGE:4743721.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AACTTAATGCTATGGCCACTCCAAACAATTAATAGTGCTGAGGCACGCAAAAAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAACATGCACTTAAAAAAAAAAAAA
  3   1   2       bld He1  5g3  in                    IMAGE:4407167.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGAAAGTCGTGGTGCCCATGCAAGAGAAGATTACAAGNCGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCAAAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCCCTTAAAAAATCAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Lu1                             IMAGE:4674583.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACAAGACGAGGATTGATGAGTATGATTATTCAAAACCAATTCAAGGTCAACAGAAGAAAAGTTTTAGCGAGCACTGGAGGAAGCACACACTATCATATGTTGATAGTAAAGGAAAGGTTAGCTTGGAATACAGACCTGTAATCGATGCAACTTTAAATGAAGACTGTGCATCTGTCCCGCCGGCAATTCGTTCCTACTAAATTACTTTTAATCCATTTAATATGAAATCATTTATTTTGAACACAATCTTGCATTGCAGAAACTTTGATGCTGAGGAATCCAGTCAGTATTGGCATTAAAATGCATTCAATTCTGCATAGTTTCTTTTTAATATTGTGGATTTTGCATGGCTATTGTACATTAGACACCTTGCTGATACAGATCTTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTATGACAAA
  3   1   2       bld Lu1                             IMAGE:4674584.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTGTTTGTGTCTATTGTAAATGTAAAAATAAATATGCACTTAAAAAATCTGCTGTCGCAAAACTGGAACAATAAACTTAAAACTCAGAAAAAGAATACCACTAATAAAACCATTATGACAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)