Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL501e04ex.5                         29 PI      90          5      581                hypothetical protein LOC735055 [Xenopus laevis]

 This cluster: approximate FL confidence score = 67%

 1012769364 Xl3.1-XL515k05ex.5 - 32 ESTs
                                                                       -60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL515k05ex.5                                                             TGAATCCGGCACCATGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCAGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAATTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCCAGAAACCTGTTATCCAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATGACTTATTTTTTTCTCTGTAA
                                                  Xl3.1-CHK-1012687890                                                                   CGGCACCATGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCAGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAATTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCCAGAAACCTGTTATCCAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATGACTTATTTTTTTCTCTGTAAAAATAA
                                                      consensus depths                                                                  3     3     3     6     8    11     9    12    10    14    13    17    14    19    15    19    16    20    19    21    19    21    19    22    20    24    20    24    20    24    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    24    24    24    24    24    24    25    25    25    25    25    25    25    25    25    25    25    26    25    26    25    26    25    26    25    26    25    26    25    26    25    26    25    27    25    27    20    27    19    27    20    27    20    28    19    27    19    26    18    26    24    26    19    26    19    26    16    27    17    27    12    26    11    28    14    28    13    28    14    28    13    28    12    25    11    22    11    22    10    19     8    15     7    12     8    12     8    12     8    12     8    11     6    10     7    10     7    10     6    10     5     9     6     9     6     9     6     9     6     9     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     2     5     3     5
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTCCATAAACTTAAGAGGCTTTTTTTTAACTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTCACACAGAAAACTTAACCTACTGCTTACCATTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATTTGATTTT
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                               BLH ATG      16      86                                                             
                                               BLH MIN      16      57                                                             
                                               BLH OVR      16      29                                                             
                                               EST CLI       4      11                                                             
                                               ORF LNG      16       1                                                             
  5   1   2       bld Ga15 5g3  in                       XL449d11ex.5p CCGGTTCCGAGCGCTATTCCCGTGATGCAGTGCGTGAAGACGTCATTGAGCCCATATTTTTGAATCCGGCACCATGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatatTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTtattttattttttttcttttcatattttgtttttacatattccataaacttanaggctttttttttAAC
  3   1   2       bld Ga15 5g3  in                       XL479g05ex.3p                                                 TCCGGATTTTTGGAAATCCGGCACCATGTNGAGTATTTCTCCGATTGTTTCTCTACGTCGCTGTGATAATGAGCCGTCTATGCCNGNCGAATGGCGCCTGTATAACTTGGCTACGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACANCAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATATGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTCTTGTTTTCATATTTTGTTTTTACATATTCCATAAACTTAAGAGGCTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATG
  5   1   2       bld Ga15 5g3  in                       XL479g05ex.5p                                                        ATTTTTGAATCCGGCACCATGTTGAGTATTTCTCCGATTGTTTCTCTACGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAACTTGGCTACGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATATGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTgtatattactttttatgaaacaatcgacccttaccttattttatttttcttgttttcatattttgtttttacatattccataaacttaagaggcttttttttAACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCaaaaaaaaaa
  5   1   2       bld Egg3 5x3                        IMAGE:6324814.5p                                                              GATTCCCGGGACCTGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatatTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTtattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTACATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATCGTTCTATTTTTAACGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACTAGGNTAATGAACTGCATGAGACCAGCTTTCCGTGTTTGCTTCTGCTGGTGCACAACTTGATTTGCTGGAGGTAAAATAGCAGGTTTGGACCTCCTTTTGCAAGGAA
  5   1   2       bld Egg1 5x3                           PBX0103D06.5p                                                                  CCGGCACCATGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatatTACTTTTTATGAAACAATCGA
  5   1   2       bld Emb1 5x3                        IMAGE:6863717.5p                                                                         CATGCTGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggcttttttttttaactgctagctgcaccacctataatatatatatatGGTCTTAAATGTTTTCACACCGGAAAACTTTACCCTACTGCTTACCATTCATGAAAGCATGTATCTGTGGTCAAATACATTTTGATTTTAACATGGCTCTATGGATGGGAAGGTTTTTAATTTTTAAAGATGGGGGTCACAAAACTATTAATGCCCCTCCCTGTCCTTGGCCTaaaaaaaaCCCGGGTTTAATGGAACTGGCATGGAG
  3   1   2       bld Ga18 5g3  in                      xlk161g10ex.3p                                                                          CCATGATGAGTATTTCTCCGATTGTTTCTCTCNGTCGCTGTGATAATGANNCGTCTATGCCCGACGAATGGCGCCTGTATAAANNNNNNNCNCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTNCTTNCCATTCATGAAGCAT
  5   1   2       bld Ga18      in                      xlk109m20ex.5p                                                                           ATGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTNNNNNCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGNNTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGNCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagagnnttttttttttnactgctagctgcacaacctataatatatatatatGTTCTTAAANGTTTNCACACAGAAAACTTAACCTACTGCTTACNATTCANGANGCANGTATCTNTGTCAAATNNATTTGATTTNNAA
  5   1   2       bld Spl                             IMAGE:8462819.5p                                                                            GATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatatTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTAttttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttactgctagctgcacacctataaatatatatatatGTTTCTAATGTTTCACCAGAAACTTAACTACTGCTTACATCATGAGCATGTACTGTGTCAATCATTGATTTATGTCCTAGATGTATGTTTATTTAAGAGGGACGACTTATGCTCTGCTGCTGACACAGTATGATGTAACACTCGGTGCTCCGTGCATATGG
  5   1   2      seed Ga15      in                       XL515k05ex.5p                                                                             ATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTA
  5   1   2       bld Ga18 5g3  in                      xlk161g10ex.5p                                                                             TGATGAGTATTTCTCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTNNNNNCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGANNTNGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGNCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatnnnnnaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggcttttttttttaactgctagctgcacaacctataatatatatatatGTNCTTAAATGTTTTCACACAGAAAANTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCaaaaaaaaaa
  5   1   2       bld Te2                             IMAGE:7392966.5p                                                                                        TCCGATTGTTTCTCTCCGTCGCTGTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatatTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTAttttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacacctatatatatatatatGTTCTTAATGTTTCACACAGAAACTTACCTACTGCTACCATCATGAGCATGATCTGTGCAATACATTGATTTAATGTCaaaaaaaaaaaaaaaaaaaGGCGCCGCTATACTCGAGATGTCCTTATGATCTTTA
  5   1   2       bld Egg3                            IMAGE:6323368.5p                                                                                                         TCCGGGGTGAAATGAGCCTGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTANATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCGGTGTTTGCTTCTGCTGNTGCAGAACTTGATTGCTGGAGTAAAATAGCAGCTTGGACTCATTTGCAAGAAATTTATCTCCN
  5   1   2       bld Egg3                            IMAGE:6323346.5p                                                                                                             GGGTGATAATGAGCCGTTTCTGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAGTGTCTCTATGATTGGAATGTTTTTATTTTTAAGGATGGGGGACAGAACTATAATGCACTCCTGTCTTGCATAGAAACACCCAGGTTTAATGGAACTTCATTGAGACCCAGCTTTCGGGGGGTTTGGCCTTCTGGCTGTTTGCCAGAAACCTTGGATTTGGCTGGAAAGTAAAAATTAAGCAGTTTTTGGGAACTTCCTTTTTA
  5   1   2       bld Ov1                    IMAGE:4055840-IMAGp.IMAGp                                                                                                               GTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCaaaaaaaaaaaaaaa
  3   1   2       bld DMZ       in                         xl313k13.3p                                                                                                               GTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCANT
  5   1   2       bld DMZ       in                         xl313k13.5p                                                                                                               GTGATAATGAGCCGTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCAAAAA
  3  -1   2       bld Ga11                            IMAGE:3474747.3p                                                                                                                            GTCTATGCCCGACGAATGGCGCCTGTATAAATTGGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGC
  5   1   2       bld Ga18      in                       xlk61a08ex.5p                                                                                                                             CGTCTATGCCCGACGAATGGCGCCTGTATAACTTGGCTNNNNNCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGNNNNNGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCttattttatttttcttgttttcatattttgtttttacatattccataaacttaagaggctttttttttAACTGCTAGCTGCACAACCTATAATATATATGTNCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGNANGTATCTGTGTCANNACATTTGATTTTAAATGT
  5   1   2       bld DMZ       in                         xl272f07.5p                                                                                                                                                             GGCTTCGCGCCTCAGGACCTTCTCTAACTGGCCCTTTACTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtatatatTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTATCTtattttattttttttcttttcatattttgtttttacatattccataaacttagaggctttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTA
  3   1   2       bld Ga18      in                       xlk61a08ex.3p                                                                                                                                                                   GCGCCTCAGGNCCTTCTCTAACTGGCCCTTTNCTGAAGACTGNGCTTGTNCCCCAGAGCGGATNNCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCNCCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTCTTGTTTTCATATTTTGTTTTTACATATTCCATAAACTTAAGAGGCTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTANCCTACTGCTTACCATTCATGAAGCATG
  3   1   2       bld Ga18      in                        xlk8m10ex.3p                                                                                                                                                                                         CCACGCGTCCGTGAAGACTGCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATG
  5   1   2       bld Ga18      in                        xlk8m10ex.5p                                                                                                                                                                                                     TGAAGNCTGCGCTTGTACCCCAGAGCGGATGGNAGNNNNGGATTTGTTCACTGCCCCACTGACAACAGTCCAGATGTGGTTAAGTGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatattactttttatgaaacaatcgacccttaccttattttattttttttcttttcatattttgtttttacatattccataaacttagaggcttttttttttaactgctagctgcacaacctataatatatatatatGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCaaaaaaaaaa
  3   1   2       bld Ga15      in                       XL515k05ex.3p                                                                                                                                                                                                            GCGCTTGTACCCCAGAGCGGATGGCAGAGGCTGGATTTGTTCNCTGCCCCACTGACAACAGTCCAGATGTGGTTAAGNGTTTCTTCTGTCTCAAAGAACTAGAAGGTTGGCAGCCTGAGGATGACCCTATGGATGAACACAAGAAACATTCACCAAGCTGNTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATATATATATGTGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGC
  5   1   2       bld Ooc1      out                    Ooc1-db25f04.y1                                                                                                                                                                                                                                                                                                                                                       CAAGAAACATTCACCAAGCTGCTTATTCATCGCATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAatatatatatgtgtgtatatattccctggctgtataaactgtatatTACT
  5   1   2       bld Ga12                                 XL204k20.5p                                                                                                                                                                                                                                                                                                                                                                                       CATTGAAAAAGAAAGCAGAGGAACTGACACTAAGCGAGTTCCTGAAACTGGACTTGGAGCATACGAAAATCAAGATGCAAAAGCAGATGAACCTGCACATTGAAAGGTTCCAGGCAAAAGCAAATGAGGTGCGGGGTCACTTGGAGAAACTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTtattttatttttcttgttttcatattttgtttttacatattccataaacttaagaggcttttttttAACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATA
  3   1   2       add Ga18      in                      xlk109m20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAANNANNNTNNAAAAGCAGATGNNCCTGCACATTGAAAGNTTCNNNNNAAAAGCAAATGAGGTGCGGGGTCACTTGGAGNANCTTGATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTNATATATATATGTGTGTATATATTCCCCTGGCTGTATAAACTGTATATnnCTTTTTATGAAACAATCGACCCTTnCCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAnnCTTAGAGGCTTTTTTTTTAACTGCTAGCTGCACAnCCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTANCCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCGGTGTTTGCTTCNGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAGTTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCTGGAAACCTGTTATCAAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATACTTATTTTTTTTTTCTGTAAAAATAAAACANNCCTTGTNCNNNNNNAAACTAAGATANAA
  3   1   2       bld Ga12                                 XL150d19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCTGACGAAACACAGTGATTTCATTTTGTGTTTTAATACTGAGTGTATATATTCCCTGGCTGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTACCTTATTTTATTTTTCTTGTTTTCATATTTTGTTTTTACATATTCCATAAACTTAAGAGGCTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACCACCAGGTTAATGAACTGCATGAGACCAGCTTCAGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAATTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCCAGAAACCTGTTATCCAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAANACTTATTTTTTTCTCTGTAAAAATAAAACAGTACCTTGTACTNATCCAAACTAAGATAAATTAAAANAATCCT
  3   1   2       bld DMZ       in                         xl272f07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTATAAACTGTATATTACTTTTTATGAAACAATCGACCCTTATCTTATTTTATTTTTTTTCTTTTCATATTTTGTTTTTACATATTCCATAAACTTAGnGGCTTTTTTTTTAACTGCTAGCTGCACAACCTATAATATATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCNTTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCGGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCNTTAAATGTATGCTGCNTTTGGTAAAGACAGTGGGAAAGATCAGAGTTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCTGGAAACCTGTTATCAAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCNTTTTATCCAAATGTTTAAA
  3   1   2       add Ga15 5g3  in                       XL449d11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TNCNTATTCCATAAACTTAGNGGCTTTTTTTTTAACTGNTAGCTGCNCNACCTATAATATATATATATGTTNTTAAATGTTTTCNCNCAGAAAACTTNACCTNGCTGCTTACCATTCATGAAGCATGTATCTGNGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCNCTCCTGTCTTGCATAGAACAACCAGGTTAATGAACTGCATGAGACCAGCTTCGGTGTTTGCTTNTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAGTTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCTGGAAACCTGTTATCAAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATACTTATTTTTTTTTTCTGTAAAAATAAAACAGTAC
  3   1   2       bld Ga18      in                       xlk76i14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACCACCAGGTTAATGAACTGCATGAGACCAGCTTCAGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAATTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCCAGAAACCTGTTATCCAGAAAGTTCCGGATTACGGAATGGCCNTCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATGACTTATTTTTTTCTCTGTAAAAATAAAACANTNNNNTGTACTTGNNCCAAACTAAGANA
  5   1   2       bld Ga18      in                       xlk76i14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACTGCTAGCTGCACAACCTATAATATATATGTTCTTAAATGTTTTCACACAGAAAACTTAACCTACTGCTTACCATTCATGAAGCATGTATCTGTGTCAAATACATTTGATTTTAAATGTCTCTATGATTGGTATGTTTTTATTTTTAAGGATGGGGTACAGAACTATAATGCACTCCTGTCTTGCATAGAACCACCAGGTTAATGAACTGCATGAGACCAGCTTCAGTGTTTGCTTCTGCTGTTGCAGAACTTGATTGCTGGAGTAAAATAGCAGTTTGGACTCATTTGCAGGAAATTTTAGTCTCGCCATTAAATGTATGCTGCATTTGGTAAAGACAGTGGGAAAGATCAGAATTCTGTACATAAAGGTAGTAAATCTATATAGTAGTAAGGTATGGGATCCGTTATCCAGAAACCTGTTATCCAGAAAGTTCCGGATTACGGAATGGCCATCTCCCATAGTCCCCATTTTATCCAAATGTTTAAAAATGACTTATTTTTTTctctgtaaaaataaaacagtaccttgtacttgatccaaactaagatataattaaAATGAATCCTTATTGGAACANAAAAANNAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)