Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-IMAGE:5085209.5                      27 END     13         38       48                hypothetical protein LOC734417 [Xenopus laevis]
     2   2.0    0Xl3.1-XL438m05ex.3                         10 END     1           2       10                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3   0.0    0Xl3.1-XL438m05ex.3                         10 PI      76        588      847                (no blast hit)
     4   0.0    0Xl3.1-IMAGE:7393805.5                       7 PI      87          4      198                G-2 and S-phase expressed 1 [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012769366 Xl3.1-XL463o04ex.3 - 34 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-XL463o04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCCTCTGTTGCAAGGTCTGTTTCTGCTACACCTAGTACAAAACACATATCTTCCTTGCCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTCAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGCACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAAT
                                                  Xl3.1-CHK-1012687657                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTGTTGCAAGGTCTGTTTCTGCTACACCTAGTACAAAACACATATCTTCCTTGCCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTCAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGCACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     7    10     7    11     6    11     7    11     7    11     7    11     9    11     9    11    10    13    12    14    14    16    17    21    17    23    17    22    15    23    15    23    16    23    17    24    17    25    19    27    19    27    20    28    21    28    21    28    21    28    20    28    20    29    19    29    18    29    17    30    18    30    18    30    19    30    19    30    21    30    25    30    27    30    28    30    28    30    27    29    26    29    26    28    25    28    27    28    26    28    25    28    25    28    26    28    23    28    25    28    25    28    25    28    25    28    25    28    24    28    24    28    22    27    21    27    19    26    19    25    19    25    17    23    15    19     8    14     7    13     5     8
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGCTACCTGTTTTATTGTGATGGCATTGACATTTTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --A---------
                                                                       ...PROTEIN --- Mm ---- 2e-019     NP_038910.1 G two S phase expressed protein 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PROTEIN --- Bt ---- 9e-021     NP_001095360.1 G-2 and S-phase expressed 1 [Bos taurus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 4e-023     NP_057510.2 G-2 and S-phase expressed 1; B99 protein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Cf ---- 1e-023     XP_851086.1 PREDICTED: similar to G-2 and S-phase expressed 1 [Canis familiaris] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 4e-024     NP_001026503.1 G-2 and S-phase expressed 1 [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 2e-091     CAJ81296.1 novel protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xl ---- 3e-109     NP_001089367.1 hypothetical protein LOC734417 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL463o04ex.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATG------------------------------------------ATG------------------------------------------ATG------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG---------------------TGA---------ATG---------------------ATG---------------------------------ATG---------------------------------------------TAG---------------------------TGA---------------------TAA---------------------------TAG---------------------TAG---------TAG---TAG---------ATG---------------------------------------TGATAA------TAAATG------------------------TAA------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2       bld Ga15      in                       XL463o04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAGAGCTACAGGAGTATCGCCTGATCGATCTGTGCTAAAGACATTGCAGCCAATTCGATTAATGTCCTGTGGCGATATTGGAAGTGGTATAGCTGAAAGCACTCCGATGAAATCCACACAAGGCAGAGAATCCACCAGTGCCTCTGTTGCAAGGTCTGTTTCTGCTACACCTAGTACAAAACACATATCTTCCTTGCCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTCAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGCACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCCTGAAGTTTTGAAACACCAAATGTTTTTACA
  5   1   2       bld Ooc1      out                     xlnoc001a09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTGGTATAGCTGAAAGCACTCCACTGAGATCAACACAAGGCACTGCAACTAGCAATTCCTCTGTTGCAAGATCTGTTTCCACTACACCCAGTACAAAGCAAATATCTTCTTTGCCTACTCCACTGAGTCGGAGGACATCTTCTGCTCTGATGACACCAAGGACAATCCCACGATCCATTTCATCTCAACGGACAGTGCAAGCTCTGCAGGCTTCAGCAAAGCCCAATAAGAAACCTCTTGTGAATGGGCAAAAAGAAGGCCCAAAAACGGCTTCTAGTCCAGGCTCTCCCACTGAAGATCTTTCTTCAGCAGATGTGATTCCTTGTTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATGCCTGTAAATGGAAAAGAAACTCCTAAATCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAAGCGATGCTAAACTGAGGAAACACT
  5   1   2       bld Gas5                            IMAGE:3747979.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACCAGTGCCTCTGTTGCAAGGTCTGTTTCTGCTACACCTAGTACAAAACACATATCTTCCTTGCCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTTAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGAACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTCTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTG
  5   1   2       bld Gas5      in                    IMAGE:3747907.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTGCCTCTGTTGCAAGGTCTGTTTCTGCTACACCTAGTACAAAACACATATCTTCCTTGCCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTCAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGAACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCAT
  5   1   2       bld Egg3                            IMAGE:6327094.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCCGGGACTATCTTCCTTGTCTACTCCTCTGAGTCGGAGAACTTCTGCTCTGATGACACCAAGGACAATCCCAAGATCCATCTCATCCCAGAGGACAATGCAAGCTCTGCAGACTTCAGCAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGCACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGANAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAAGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAATTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTTGAAATGTCCTCTTTC
  3   1   2       bld Ga15      in                       XL463o04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAAAGTCCATTAAGAAGCCTCTCATGAATGGGCAAGAAGAATCTAAAGGCAAAGGCACAAAAATGACTTCTAGTCCAGTCTCTCCCACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTGAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAATTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTT
  5  -1   2       bld Emb4                            IMAGE:4970609.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCCAGTCTCTCCCAATGAAGATCTTGCTTTGGCGGATGTTTTCCTTGCTCTTGAAGTTTCTCTCCTGAAAGCAAAAATATACTGTAAATGAGAAAGAAACCCCGTAAGTCACTCTGTTCTTCAAACAAAGAGTTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACaaaaaatgaaatgtattgaaaatgtctcttttaaaaagaaatCTGCCTGATAACTGTTAT
  3   1   2      seed DMZ                                 rxl299a04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CNCTGAAGATCTTGCTGTAGCAGATGTTATTCCCTGCTCTTTAAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTG
  3   1   2       bld DMZ  5g3  out                        xl225a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACTGAAGATCTTGCTGTAGCAGATGTTATTCCTTGCTCTTTAAAGTTCTCTCCTGAAAGCAAAAATATACCTGTAAATGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCC
  3   1   2       bld DMZ                                 rxl327h22.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTATAAAGCCGGAAGCACTTGCCAGGACGGGTACGACCAGCACGACCGGCTCTTTGTTGTGCTGAAGCTTTTGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACANNNTGNTTCTCCACTCNNGAAGTTTTGAAACACCAAANGTTNTTNCAAAAATACTGCTACCTGTTTTATTGNGATGGCATTGACATTTNATGTATGGTGAACATGGTGGNTGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTNATNNTGCGGAGTACAGTTTGCANGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTNGGTATATAATTTGCAGAAAAAGAAGAGGNGAAANGAAGTGAGCNGTGTTGANTAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCNGCATTTTAGACAAATCTTTACGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATNACTGTCATAA
  3   1   2       bld DMZ                                 rxl328g03.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAGCCGGAAGCACNTGCCAGGACGGGTACGACCAGCACGACCGGCTCTTTGTTGTGCTGAAGCTTTGGGAAAGAACCCCCTAAGTCACTCTGTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATNCAGCTGNGTCCTGTGNTGNNCAAAGAAAANATACNNNGTGNTTCTCCNCTCGCGAAGTNNNGNANCACCAANNGTTNNTTCANNAATANTGNTACCTGTNTTATNGNGATGGCATTGACNTTTNANGTNTGGTGAACATGGNGGNTGTGTAAAGCATGGGACTCTTTNA
  3   1   2       bld DMZ                                 rxl327h14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAAGTCNCTCTGTTNTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAANCCGATGNTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAANATAATCGTTCCNATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATNTGATTCTCCNCTCNNGAAGTTTTGNAACACCAANNGTTNNTACAAAAATANTGCCACNTGTGTTATTGNGATGGCATTGACNTTTNATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTNATAGTGCGGAGTACNNTTTGCANGAAAGANGNTGCGCAGAAATGTAANCAGCAAGACTTACAAGNGTGNTAGGTATATAATNTGCAGAAAAAGAAGAGGTGAAANGAAGTGAGCNGTGTTGAATAAAACCCTCCTGACTNTTCAGTTGTTTACTAGTCTGAAAATAATGCCGCATTTTAGACAAATCTTTACGTGCTAGGGACAACAANTGAAATGTANTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACCTGTCATAAA
  3   1   2       bld Ga12 5g3  out                        XL205j02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAAT
  3   1   2       bld Ga12 5g3  out                        XL174a14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCTTCAAACAAAGAGGTTTTACTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTNAG
  3   1   2       bld Tbd7 5g3  out                        XL059l01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGNATCTGTTTAATTTTTTTGTAAATAAAATAAA
  3   1   2       bld Tbd7 5g3  out                        XL084c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTNATAACTGTTATAAATGTTGGNATCTGTTTATTTTTTGTAAATAAAATAAAAT
  3   1   2       chi Ga12                                 XL208i15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGATCTTTCAACTGTTCAGGTTGGATATCCTAATCGGTATTTGTTGAATTACATATTGAAACTTGGCAGTGGTAGTCAAGAATTAGTCTTTCCTTTATGTTTAATAGTGCAGGTTTATTGACATATAATTTGATGTTTTCTTCTCCTTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGA
  5   1   2       bld Ga15      in                       XL460b04ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCTCCGCTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCNTCCGCTGGAAGTGATGGTTACCCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACaaaaaatgaaatgtattgaaaatgtctcttttaaaaagaaaTCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTACNANNNNAAA
  3   1   2       bld Neu7      out                        XL006k16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGNATCTGTTTAATTTTTTGTAAATAAAATAAAA
  5   1   2       bld Tbd2                            IMAGE:3200258.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATATTGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTCTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTA
  3   1   2       bld Ga15      in                       XL460b04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAAGAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGT
  3   1   2       bld Neu7 5g3  out                        XL048h15.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAGCTAAAACATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGNATCTGTTTATTTTTTGTAAATAAAATAAAAT
  3   1   2       bld Tbd7 5g3  out                        XL074h20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATGAAACCGATGCTAAACTGAGGAAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGNATCTGTTTAATTTTTTGTAAATAAAATAAAATNAATGT
  3   1   2       bld Egg4 5g3  out                   IMAGE:3745025.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAACACTCATCCGCTGGAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATTTTAACANAATAATCGTTCCAATANAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAA
  3   1   2       bld Tbd2 5g3  out                   IMAGE:3201407.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTCATCCGCTGAAAGTGATGGTTACCCTCTAATTGACCTTTCAAACACACCCGATCTTAACATAATAATCGTTCCAATACAACCAGCAATTGTTGGTCAGCTGATAGATCTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGAAATGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTAC
  3   1   2       bld Gas5      in                    IMAGE:3747907.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CACTCATCCGGTGGAAGTGATGGTTACCCTATAATTGGCCTTTCAGACACACCCGATTGTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCGTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATACCTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTG
  3   1   2       bld Egg6                            IMAGE:4435955.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTAATTGACCTTTCAAACACACCCGATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATTTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTA
  3   1   2       bld Tbd2                            IMAGE:3200256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AACACACCCGATTTTAACAAAATAATCGTTCCAATACAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGACCAAAGATAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAACACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTG
  3   1   2       bld Ov1       out                   IMAGE:5048293.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATTTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTAAATATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTA
  3   1   2       bld Ov1       out                   IMAGE:5073731.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTTTAACAAAATAATCGTTCCAATAAAACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCCTGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTAAAAAAAAAAAAAAA
  3   1   2       bld Ooc2 5g3  out                   IMAGE:3746559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCCAATAANACCAGCAATTGTTGGTCAGCTGATAGATTTGAGTTCTCCTCTTATACAGCTGAGTCATGTGCTGAACAAAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAATTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTAA
  3   1   2       bld Ga15                               XL441a16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGNCGCGTGGGAGAAAATATACAATTTGATTCTCCACTCCTGAAGTTTTGAAACACCAAATGTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTT
  3   1   2       bld Unk3                                546A_1C19.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACTCCTGAAGTTTTGAAACCCCAAATGTTTTTCCAAAAATACTGCTACCTGTTTTATTGTGAGGGCATTGCCATTTTATGTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTCCAGTTTGCATGAAAGAAGATGCCCAGAAATGTAACCAGCAAGACTTACAAGTGTGCTAGGTATATAATTTCCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAGTTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGCCAAATCTTTAGGGCTAGGGCCAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTCCA
  5   1   2       bld Ooc3                            IMAGE:3437267.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GTTTTTACAAAAATACTGCTACCTGTTTTATTGTGATGGCATTGACATTTTATGTATGGTGAACATGGTGGATGTGTAAAGCATGGGACTCTTTTATGCTACTGCAACTAATATTGCGGAGTACAGTTTGCATGAAAGAAGATGCGCAGAAATGTAAACAGCAAGACTTACAAGTGTGCTAGGTATATAATTTGCAGAAAAAGAAGAGGTGAAAAGAAGTGAGCTGTGTTGAATAAAACCCTCCTGACTTTTCAATTGTTTACTAGTCTGAAAATAATGCTGCATTTTAGACAAATCTTTAGTGCTAGGGACAAAAAATGAAATGTATTGAAAATGTCTCTTTTAAAAAGAAATCTGCCTGATAACTGTTATAAATGTTGGTGATCTGTTTAATTTTTTTGTAAATAAAATAAAATTAATGTATTCTTAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)