Gurdon Institute Xenopus laevis EST Database

+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1   0.0    0Xl3.1-XL485m02ex.5                         57 PI      92        149     1144                homeobox protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 90%

 1012769450 Xl3.1-XL424g19ex.5 - 83 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                             2     2     5     7     5     7     5     7     6     8     8    14    10    17    14    20    14    21    15    21    15    21    15    21    15    22    15    22    15    23    15    23    15    23    15    23    16    23    16    23    16    23    16    23    15    23    15    23    14    22    14    22    21    22    21    22    20    22    21    22    22    23    22    23    21    23    21    23    20    22    19    22    20    22    20    22    20    22    20    22    20    22    19    22    20    22    19    22    18    22    17    21    15    19    12    19    13    18    12    18    14    19    14    19    14    19    13    19    12    18    12    18    12    17    12    16    12    16    12    16    12    16    12    16    12    16    11    15    10    14    10    13    12    15    11    14    10    15     9    14     8    13     8    10     8    10     8    10     8    10     8    10     8    10     7     9     7     9     8     9     9     9     9     9     9     9    10    10    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    12    11    12    11    12    11    15    11    15    11    15    11    15    11    15    11    15    12    16    12    16    12    16    12    16    12    16    12    16    11    16    11    16    11    16    12    17    12    17    11    17    11    17    11    18    12    18    12    18    13    19    13    19    10    19    11    19    11    18    12    17    10    16    11    16    13    19    15    21    15    21    15    22    13    19    13    19    13    21    12    21    12    20    12    20    12    21    12    20    12    21    12    21    12    21    12    21    12    23    13    23    13    25    12    34    32    38    28    31    30    34    34    36    35    36    36    37    35    37    35    36    30    36    33    36    36    36    34    36    33    36    37    37    31    37    37    37    35    37    35    38    36    37    30    37    37    38    36    39    36    39    36    39    37    39    36    38    35    38    36    38    37    38    34    38    25    37    21    33    11    23     7     8     6     7     4     4     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------A--
                                               BLH ATG     218     495                                                                                                        
                                               BLH MIN     206     168                                                                                                        
                                               BLH OVR     218      41                                                                                                        
                                               EST CLI      50      16                                                                                                        
                                               ORF LNG     218       1                                                                                                        
                                                                       PROTEIN --- Ce ---- 4e-027     NP_001024213.1 abnormal ThermoTaXis family member (ttx-1) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-031     NP_511091.3 CG12154-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ag ==== 2e-032     XP_310918.4 AGAP000215-PA [Anopheles gambiae str. PEST] =================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Ci ==== 1e-046     NP_001027662.2 Otx [Ciona intestinalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Sp ---- 2e-059     NP_001027540.1 orthodenticle-related protein isoform beta [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 6e-156     NP_571326.1 orthodenticle homolog 2 [Danio rerio] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 4e-157     XP_876837.3 PREDICTED: similar to orthodenticle homeobox 2 isoform 4 [Bos taurus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 8e-159     NP_989851.2 homeobox protein OTX2 [Gallus gallus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 3e-159     NP_659090.1 orthodenticle homolog 2 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Bt ==== 2e-159     XP_876928.1 PREDICTED: similar to orthodenticle 2 isoform b isoform 5 [Bos taurus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 2e-159     NP_758840.1 orthodenticle 2 isoform b; homeobox protein OTX2 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Cf ==== 1e-159     XP_547830.2 PREDICTED: similar to orthodenticle 2 isoform b isoform 1 [Canis familiaris] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 6e-163     AAI35885.1 Orthodenticle homeobox 2 [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Xl ==== 2e-167     NP_001084955.1 hypothetical protein LOC432013 [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xl3.1-XL424g19ex.5                                                                                                                            TAG------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------TGA------------ATGATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------ATG------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------TAA------------------------------------------------------TGA---------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------TAG---------------TGA---ATG---------TAA------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAATAA---------TAA------ATGATGTAG---------------------------------------------------------------TAG------------TGA------------------------------------------------------------------TAATAA---------------------------------TAG------------------TAA------------------------------------------TAA---------------------------------TGA---------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAA------------------------------TAA------------TAAATG------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       chi Emb1                            IMAGE:6865854.5p                                                                                                                                                                CCAGACATAAAGGAGCTCGCTTAGGCACCTCATCGGTTAATCCCGTTTCTGTCCACTTGTAGAAAATACAGTGCAAAAAGAAAGAGCAGGCAACTGATCGTGCGACTTGCTGCTGCTGCAACGATTTCCTTCGCGGATTGTGCTCCCTGATCAAACACTAGCATGATGTCTTATCTCAAGCAACCGCCATATGCCGTGAATGGGCTCAGCCTGACTACCTCTGGGATGGGATTTGTACATCCGTCNGTGGGNATATCCGCGACCCCCANGAAACAGAGGAAGGAAAGGGACACTTTTCACAGAGCTCAACTGGATATCTTCGAAGCCACTTTTTGCCAAAAACTCCCTACCCTTGAAATCTTTCATGAAAAAAGGAGTGGGCTCCTAAAAACAACCCTACCCAAATCCCAAAGTCCCAGGTAAACCCTTTTGAACCCGATTACCAAGCCCAAAACCCCTCCCCCACCTTGGGTTTAGGCCACCCTCAAACaaaaaaaatcccccccagggaaaatccccccaaaaagaaaaaatttttttttgcccccttttttttttttttttcccgggggaaaaaaaggttttaaaaccccggggtttagggaaaaatttttttttaaggggggggggggggaaaaaaaaaccccccccaaaaaaaaaatgtggggcccccccacccnaaaaaaaaaaaaaaannnnncccccaaaaatagggggggggggcccaaaaaaaaaaaagggggcgggccccctccttttttaaaaaagaaaaaaaaaCCCCCC
  5   1   2       bld DMZ  5x                              xl273a17.5p                                                                                                                                                                                                                                               AAAGAGCAGGCNACTGATCGTGCGANTTGCTGCTGCTGCNACGATTTCCTTCGCGGATTGTGCTCCCTGATCAAACACTATTCATGATGTCTTATCTCAAGCAACCGCCATATGCCGTGAATGGGNTCANCCTGACTACCTCTGGGATGGATTTGTTACATCCG
  5   1   2       bld Ga12      in                         XL147j10.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCTCAACTGGATATCCTCGAAGCACTTTTTGCCAAAACTCGCTACCCTGATATCTTCATGAGAGAGGAAGTGGCTCTAAAAATCAACCTACCCGAGTCCAGAGTCCAGGTTTGGTTCAAAAACCGCCGAGCAAAGTGCCGCcagcagcaacagcagcagcagAATGGAGGCCAAAACAAAGTGCGACCTTCTAAGAAGAAGACCTCCCCGGCCAGGGAAGTGAGCTCGGAGAGTGGGACCAGCGGCCAGTTCAGCCCACCTTGCAGCACCTCTGGTCCAGTCATCTCGAGCAGCACAGCCCCTGTGTCCATCTGGAGCCCGGCCTCCATCTCTCCTCTCTCAGATCCACTCTCCACATCATCTTCATGCATGCAGAGGTCCTACCCCATGACCTACACGCAAGCATCAGGCTACAGTCAAGGATATGCAAGCTCTACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGC
  5   1   2       bld Ga15      in                       XL500k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCATGACCTACACGCAAGCATCAGGCTACAGTCAAGGATATGCAAGCTCTACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTANAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGNATTGTCCTANA
  5   1   2       bld Em10                            IMAGE:8320507.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAAGCTCTACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAGCTCTGCTCTTTCACTTCTGGCTAGAAAGAACATTCGGATCTGAGTGATCGTGCACTGATGTCCAGATGCCTACTTATTNAAGAAAACAATATAATATGTTATAGAGTCTGAGTAGTTTAAAGACATCATGGTGCTATCATGTAATCGTGTTTATCGGCA
  5   1   2       bld Em10                            IMAGE:8322087.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGCAAGCTCTACATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCC
  5   1   2       bld Ga15      in                       XL479f17ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATCCTACTTTGGGGGTATGGACTGTGGATCTTACTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAAATTATGTTTAT
  5   1   2       bld Ga15      in                       XL501k05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGACTGTGGATCNTACGTTGACCCCTATGCACCATCAGCTCTCTGGACCTGGAGCTACTCTAAGCCCAATGAGCACCAACGCAGTGACAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTANATATTANCAGGTGGATGAAAGATGGANAANAAATAANTCCAACCCAACTCCANCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCANGCTGCANAGCAATTTGGGTTTGGTGT
  5   1   2       bld Ga18      in                      xlk149o02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACCAACNNNNNNCAAGTCACCTTAACCAGTCCCAAGCTGCCCTCTCCTCACAGGCCTATGGNNNNCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTTACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCANNNNNTTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACNNNTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGNCATGATGTAGNTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGNTTTTAATCTGTGCTANACTTCAAAACTGTGATCTCTTGTATTNGTATGCAACTGTGAACTCCACANCAGCGGGNgggggggggggggNC
  5   1   2       bld Ga12                                 XL167e09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTGCCCTCTCCTCACAGGNCCTATGGGGCTTCTAGCTTGGGTTTTAACTCCACCGCTGACTGCCTGGATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCANAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTANAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCC
  5   1   2       bld Ga18      in                      xlk146p14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATTACAAAGACCAAACGGCCTCCTGGAAGCTGAACTTCAATGCTGACTGCTTGGATTATAAAGACCAAACCTCCTCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCANNNNNTTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGNCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCNCANCAGCGGGNggggggggggggggNC
  5   1   2       bld Ga12      in                         XL169g24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAACGGCCTCCTGGAAGCTGAACTTAATGCTGACTGCTTGGATTTAAAGACAAAACCTCCCCTTGGAAGTTCCAGGTTTTGTGAAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGT
  5   1   2       bld Ga18      in                      xlk146f06ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGAACTTTCCTTCTCTAACTGTGTCAGGTGGAAAACTTTGCTGAGACATTCCCAGCTCTGACCAAGTCTGGTTGAACAAGTAAAAGTAAAAACTACACACAGACCATTTATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCANNNNNTTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGNTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGANCTCCACACCAGCggggaggggggggggggNNNNNCTGTGATTTAATAACNNGGTTTATNNTNAGNAGGNAGNNTCAGGATTTAGNNNAAAANCGATGCCCTTT
  3   1   2       bld Ga18 5g3  in                      xlk135b19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GNTNGAAANNNTNNNNGAGNCATNCCAGNNCNGNNCNAGTCTGNTNGNACAANNAAAAGTAAAAACTANACACAGNCCNTTTTNTTTNCCNNNANANNNNNTGNTCTNNCTCAGCTCTGGACTGNNTCTGNNNNNNTCTNCATGCAATGGGGGGAAAAAGGACATATCTTTATCNAGTGNCCAAGAGCCACNTCAAGTNCNTTATCTTGTTNNNGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCNNCCCANCTCCAGCAGCACAGGACCCATAAGCTNNGGCCAANCCCAGGCTNCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCNNNNNTGCTCTTTCNCCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTNCTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGNCTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGANCTCCACNCCAGCGGGGAGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCCTGGATCTGGCAAATANGTANNAAAA
  3   1   2       bld Ga18      in                      xlk146f06ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAAANNNTNNCTGANNNNNNCCAGCNCTGNCCNAAGTCTGGTNGANNNANNAAANNTNAAAACCNACACACAGNCCATTTNTTNNCCCANNNNNNNCCTNNTCTTACTCAGCTCTGGNCTGGATCTGNANACNNCTCCATGCAATGGNNNNANAAAGGACATATCTTTATCCAGTGNCCAAGAGCCACATCAAGTCCTTATCTTGTTNTNAGATATTAGCAGGTGGATGAAAGATGNAGAAGAAATAAGTCNNNCCAACTCCAGCAGCACAGGACCCATAAGCTNNNGNCCAAGCCCAGGCTNNAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCNNNNNTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGANTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATNAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGNCTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGANCTCCACNCCAGCGGGGAGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGANCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACNCCCANNNNCTTTCCCCCTGGATCTGGCAAATANGNANNAA
  3   1   2       bld Ga18      in                       xlk74k14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TNNAANNNTNNCTGANNNNTTCCNAGCNNNGNCNAAGTCTGNNNGAACAAGTAAAANTAAAANCTANNNACAGNCNNTTTNNTTTACCNANNNANNCCCTGNTNNTNCTCAGCTCTGGACTGGATCTGNAGACNNCTCCATGCAANGGGGGAAAAAGGACATNTCTTTATNCAGTGNNCANGAGCCACATCAAGTCCTTATCTTGTTNNTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCNNCTCCAGCAGCACAGGACCCATAAGCTGNGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCNNNNNTGCTCTTTCNCCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTNCTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGNCTTCAAAACTGNGATCTCTTGTATTGTATGCAACTGTGAACTCCACNCCAGCGGGGAGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCCTGGATCTGGCAAATATGTATAAAA
  5   1   2       bld Ga15      in                       XL452n13ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTTTACCCACACAGAACCCTGGTCTTACTCAGCTCTGGACTGGATCTGGAGACATCTCCATGCAATGGGGGGAAAAAGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggagggggggggggg
  5   1   2       bld Ga15                               XL421k09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGACATATCTTTATCCAGTGACCAAGAGCCACATCAAGTCCTTATCTTGTTATTAGATATTAGCAGGTGGATGAAAGATGGAGAAGAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggaggggggggggCC
  5   1   2       bld Ga15      in                       XL437e03ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATCNAGTCCTTATCTTGTTATTAGATATTANCANGTGGATGANANATGGAGAANAAATAAGTCCAACCCAACTCCAGCAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCAAGCTCTGCTCTTTCANCTTCTGGCTTANAAAGAACATTTCAGGATCTGA
  3   1   2       bld Em10      in                    IMAGE:7983307.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TATAGCAGTGATGAAAGTGAGAGAATAAGTCTAACCAATCAGCAGCACAGACCCATAGATGTGGCCAAGCACAGGTGCAGAGCATTTGGGTTTGTGTGTGTGTATTGCTGGAGACTCAAGCTCTGCTCTTTCACATTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGAGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCCTGAGATATTAATTGCGACAAGGAATCCCATACGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCCTAATCCTTTCCCCATGAACGCATATGGATCCTGCGCAATAACT
  5   1   2       bld Ga15      in                       XL466p16ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGCACAGGACCCATAAGCTGTGGGCCAAGCCCAGGCTGCAGAGCAATTTGGGTTTGGTGTGTGTGTATTGGCTGGAGACTCNAGCTCTGCTCTTTCACCTTCTGGCTTAGAAAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggagggggggggggg
  3   1   2       bld DMZ                                 rxl245d02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTTCACCTTNTGGNTTAGAAAGAACATTTCAGGATNTGAGTGAATCGTGCAACTGATTGTCCNAGATGCACTACTTTATTTAAAGAAAACAAATTNATAATTATGTTTATAAGAAGTCNTGATGTAGTTTTTAAAAGACNATCNGNGNGNGTNTTATATCAATGGNAAATCTGNGGNTTTTAATCTGNGCTAGNCTTCAAAACTGNGATCTCNTGTATTGTATGCAACTGTGAACTCCNCNCCAGCGGGGnGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCNATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCT
  3   1   2       bld Neu1      in                      Neu1-32E7-2.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAAAGAACATTTCCAGGATCTGAGTGAATCCGTGCAACTGATTGTCCTAGATGCACCTACTTTATTTTAAAAGAAAACAAATTTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGAGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTTTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATAAAAAAAAATCTATTAAATGACTCTAGCACAAACAACTGTTTTCCATTTTCATTTTCATACACCAGCTGTTTGGGTGGAGGTGGCTATGAAAGACTTGCTGAGTTTTTCTTTGGACATAGAAATACTTTCAAGGGGTCCTCCGCCTAAAAACTGCATAATAAAAAGTTGTGAAACAAAAAAAAAAAAAAC
  5  -1   2       bld Em10      in                    IMAGE:7983307.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTGGCTTAGAAGAAACATTTCAGGATCTGAGTGAATCGTGCAACTGATGGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggaggggggggggTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACttttttttttGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGatataaatatatatataCACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATaaaaaaaaatctattaaatgactctagcacaaaaaaaaaaaaaaaaaaaaa
  5   1   2       bld Ga15      in                       XL506o14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGAACATTTCAGGATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggagggggggggg
  3   1   2       bld Ga18 5g3  in                      xlk142d21ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAACATTTCAGGATCTGANTGANTCGTGCANCTGATTNTCCTAGATNNNCTNCTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAANNCATGATGTAGTTTTTAAAAGACAANCAGTGTNTNTCTTATNTCAATGGTAAATCTGTGGTTTTTAATCTNNNCTAGNCTTCAAANCTGNGNTCTCTTGTATTGTATGCAACTGTGANCNCCACNCCAGCGGGGAGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCCTGGNTCTGGCAAATANGNATNA
  5   1   2       bld Ga15      in                       XL421m11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATCTGAGTGAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggagggggggggggCC
  5   1   2       bld Ga15      in                       XL444d14ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GAATCGTGCAACTGATTGTCCTAGATGCACTACTTTATTTAAAGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCggggaggggggggggNC
  3   1   2       bld Ga18      in                      xlk146p14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TNNTTTAAAGAAANCAANTTAANANTTNNNTTTANAAGAANNCATGATGTANTTTTTAAAAGACANNCAGTGTNTNNCTNATNTCAANGGNAAATCTGTGGTTTTTAATCTGTGCTAGNCTTCAAANCTGNNNTCTCTTNTNTNGTANGCANCTGTGACCCCCNCNCCAGCGGGGAGGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACNCNCCCANNNNCTTTCCCCCTGGATCTGGCAAATANG
  3   1   2       bld EggS      in                    IMAGE:4785401.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAAAACAAATTAATAATTATGTTTATAAGAAGTCATGATGTAGTTTTTAAAAGACAATCAGTGTGTGTCTTATATCAATGGTAAATCTGTGGTTTTTAATCTGTGCTAGACTTCAAAACTGTGATCTCTTGTATTGTATGCAACTGTGAACTCCACACCAGCGGGGAGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCGTTTAAAAATAAAACGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGATAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAAGGAAAATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAATA
  3   1   2       bld Ga18      in                      xlk135f11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ANTTTTTAAAAGACANNCAGTGTNTNNCTTATNTNAANGGNAAATCTGTGGTTTTTAATCNGTNCTAGNCTTCAAANCTNNNNTCTCTTNTNTNGTANGCANCTGTGANCNCCACNCCNNCGGGGAGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCCTGGATCTGGCAAATATGTANNAAAAANA
  3   1   2       bld Ga15 5g3  in                       XL416h12ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGGGTTTTNNNTCAAAGGGAAATNNGGGGGNTTTTNATTTGGGGTNGNCTTCAAAACNGGGNTTTTTTGTATTNTANNCCACNGGGAACNCCCCCCCCnnGGGGnGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCNGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTG
  3   1   2       bld Ga15      in                       XL506o14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAAAACNGNGATTTNTTGTATTGTANGCNACTGNGNACTCCCCCCCNGNGGGGnGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGNCNGACGATTATTTAATAACTAAAAGNCTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATA
  3   1   2       bld DMZ                                 rxl335k02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCAAAACNGNGATNTCTTGTATTGNANGCAACTGNGAACTCCCCCCCNGCGGGGnGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCNGGGACTGGAAGCCGCNATATAGAAAGGAT
  3   1   2       bld Ga18      in                      xlk110k19ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCNNNCCNNCGTCCGCCCNNNNCCGCCCNNNNNCCGCCCACGCGTCCGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCTGGNTCTGGCAAATATGTATA
  3   1   2       bld Ga18      in                      xlk149o02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGTGANCTCCACNCCAGCGGGGnGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGANCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACNCACCCANNNNNTTTCCCCTGGATCTGGCNAATANG
  3   1   2       add Ga15      in                       XL500k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGNACNCCCCCCCNNCNGGGAGGGGGGGGGGTCGTNCTGTGATTTAATAACNGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGNGCAAAACCGATGCCCNTTAANGTTATTCCGAGCGAGCGCNTGGGCCNGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCNATTCCTCTTGAGTTGATTTTATATTNGACCCGGCAACGAACGCAGGGNCTGGAAGCCNCNATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGC
  3   1   2       bld Ga15      in                       XL421m11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCCCCCNNCGGGGNGGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCNTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTNGACCCGGCNACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGNCNGNCGATTATTTAATAACTAAAAGNCTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATAAAAAA
  3   1   2       bld Ga15      in                       XL452n13ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCnnGGGGGGGGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCNATTCCTCTTGAGTTGATTTTATATTCGNCCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGNCNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATA
  3   1   2       bld Ga15      in                       XL466p16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCnnGGGGnGGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCNGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTNGACCCGGCAACGAACGCAGGGACTGGAANCCGCAATATAGAAAGGAACAGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATNNGGCAAATATGNNAAAAAAA
  3   1   2       bld Ga15      in                       XL406c20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCCCGGGGnGGGGGGGGGGGGTCGTACTGTGATTTAATAACNGGNTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGNGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGNCTGGAAGCCGCAATATAGAAAGGAACNGGNCNGNCGATTATTTAATAACTAAAAGNCTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGATAAAAAAA
  3   1   2       add Ga15      in                       XL479f17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCCCCCCCGGGGGGGGGGGGGGGGGTCGTACNGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCNGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCNATTCCTNTTGAGTTGATTTTATATTNGNCCCGGCAACGAACGCAGGGACTGGAAGCCGCNATATAGAAAGGAACNGGNCNGACGATTATTTAATAACTAAAAGNCTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATG
  3   1   2       bld Ga15      in                       XL437e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCCCCCNNCGGGGnGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTNGNCCCGGCAACGAACGCAGGGACTGGAAGCCGCNATATAGAAAGGAACNGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGATAAAAAAA
  3   1   2       bld Ga15 5g3  in                       XL428o16ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCCCNGCGGGGnGGGGGGGGGGTCGTNCTGTGATTTAATAACAGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGNCNGNCGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGNTAAAAAAA
  3   1   2       bld DMZ       in                         xl316p02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CNCCNGCGGGGnGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGNCCCGGCAACGAACGCNGGGACTGGAAGCCGCNATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAAT
  3   1   2       bld DMZ  5g3  in                         xl234h01.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCNGCGGGGNGGGGGGGGGGGTCGTACTGTGATTTAATAACNGGTTTTATTATTAGCNGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGNCCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCNATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGANAAAAAAAT
  3   1   2       bld Tbd7 5g3  in                         XL056i07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AACGGGGANGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCC
  3   1   2       add Ga12      in                         XL147j10.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACGGGGANGGGGGGGGGGTNGTACTGTGATTTAANAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGNGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGNGCATGGGCCTGTAAANAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTANATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATANAAAGGAACAGGACAGACGATTATTTAANAACTAAAAGACTTTTTTTTTTGTCNCNGACCNTGAGATATTAATTGCGACAAGGAATCCCAT
  3   1   2       bld Ga15      in                       XL444d14ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCGGGGnGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGAAAAAAAA
  3   1   2       bld Ga15                               XL466h20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGNNGGGGGGGGGGGTCGTACTGTGATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCNGTAAAGAACTGCAGTTAAACCNTTNTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGNCCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACNGGACNGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATC
  5   1   2       bld Ga18      in                      xlk110k19ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCNNATGGNCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACttttttttttGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGatataaatatatatataCACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATaaaaaaaaaTCTATTAAATGACTCTAGCAC
  3   1   2       bld Ga18      in                      xlk116o09ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTAATAACAGGTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCANNNNNTTTCCCCCTGGATCTGGCAAATANGTA
  5   1   2       bld Ga18      in                      xlk116o09ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ATTTAATAACAGGNTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCNNATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACttttttttttGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGatataaatatatatataCACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATaaaaaaaaaTCTATTAAATGACTCTAGCACNNANA
  5   1   2       bld Ga15      in                       XL513m02ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTATTATTAGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACttttttttttGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGatataaatatatatataCNCNCCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATaaaaaaaaatctattaaatgactctagcacaaacaaaaaaaaaa
  3   1   2       bld Ga18      in                      xlk122p01ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCNNNNTCCGCAGGAAGATTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGANCGAGCGCATGGGCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATANNCCTTTCCCCTGGNTCTGGCAAATANGTATAAAA
  5   1   2       bld Ga18      in                      xlk122p01ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNTTCAGGATTTAGCGCAAAACCGATGCCCTTTAATGTTATTCCGAGCGAGCNCATGGNCCTGTAAAGAACTGCAGTTAAACCTTTCTTTTCCTCGACCAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACttttttttttGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGatataaatatatatataCACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATAAANNNNNNTCTATTNNNNNNCTCTNGC
  3   1   2       bld Emb1 5g3  in                    IMAGE:3402294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAATTCCTCTTGAGTTGATTTTATATTCGACCCGGCAACGAACGCAGGGACTGGAAGCCGCAATATAGAAAGGAACAGGACAGACGATTATTTAATAACTAAAAGACTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAGGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATAAAAAAAAATCTATTAAATGACTCTAGCACAAACAACTGTCTTCCATTTTCATTTTCATACACCAGCTGTTTGGGTGGAGGTGGCTATGAAAGACTTGCTGAGTTTTTCTTTGGACATAGAAATACTTTCAAGGGGTCCCTCCGCCTAAAAACTGCATAATAAAAAGTTGTGAAACATAA
  3   1   2       add Ga15      in                       XL513m02ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAACCGCAATATAGAAAGGAACNGGACANACGATTATTTAATAACTAAAAGACTTTTTTTNTTGTCACTGNCCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTNANGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGAAAAAAAAATC
  3   1   2       add Ga12      in                         XL169g24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTNTTTNANAANTAAAANACTTTTTTTTTTTTGTCACTGACCTTGAGATATTAATTGCGACAAAGAATCCCATATGCGTTTATGCTTGCCTTTGTGAATTAAGATATAAATATATATATACACACCCATAATCCTTTCCCCCTGGATCTGGCAAATATGTATAAAAAAAAATCTA
  3   1   2       add Ga15      in                       XL501k05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTAAAAGNCTNTTTTTTCTTGTCACTGACCTTGAGATATTAATTGCGATCAAGGAATCCCATATGCGTTTATGCTTGCCTTNGTGAACNTAAGATATAAATATATATATACACACCCATAATCCTTTGCCCCCTGGATC

In case of problems mail me! (