Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 91%

 1012769514 Xl3.1-IMAGE:6316626.5 - 24 ESTs
                                                                       .........-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xl3.1-IMAGE:6316626.5                                        TCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGAAAAAAAAA
                                                  Xl3.1-CHK-1012688982                                              GGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGAAAAAAAAAAAAAAA
                                                      consensus depths                                            10    12    11    13    12    14    12    14    12    14    13    14    13    15    15    17    16    18    17    19    17    19    17    19    16    19    17    19    19    20    19    20    20    20    20    20    20    20    20    20    20    20    21    21    21    21    21    21    21    21    22    22    22    22    22    22    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    23    21    22    21    22    21    22    20    22    21    22    17    21    19    21    19    21    20    21    19    20    16    18    14    18    15    18    15    17    13    17    14    16    13    16    12    16    11    14     8    10     8     8     3     4
                                                                   SNP                                                                                                                                                                                        ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ----C-------
                                               BLH ATG      46     479                                        
                                               BLH MIN      46     118                                        
                                               BLH OVR      46      69                                        
                                               CDS MIN      46      55                                        
                                               EST CLI      -3      55                                        
                                               ORF LNG      46       2                                        
  3   1   2       chi DMZ                                 rxl302f06.3p CCCCTGCAGCCACAGTAGTTANCCCTTCCCTGTAGTTACTCGCATTATTGCTTAAAAGTGATTTAGAAGAAGGCCTGGCACCTTTTTATACAGTTGGACAAATGTGCCCTTATTAGCAAGCAGGCTGTTACAAGTGATGTACTACTCAGTGTATCACTCGATTCATTCATAGCAGCTGTTCTTTTCTCACTTGGCAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCA
  5   1   2       bld Ooc3 5g3  in                    IMAGE:3436530.5p                            GAAGAGGGGCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAAGCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAA
  3   1   2       bld Te2  5g3  in                    IMAGE:7208388.3p                                TGGGGCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCCACTTATCCTAATCATAATAAAAGT
  5   1   2       bld Egg1 5g                         IMAGE:4678885.5p                                  TACCCGGAACGAGGTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTTTCTGCCGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCATCTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAA
  5   1   2       bld Li1  5g                         IMAGE:3396533.5p                                  GGGCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAAGATGGAGTTGCATACAGAAGCCTCTTCATTATTGATGGGAAAGGGATCCTTCCTCAGATCACTATTTACGACCTTCCTGTTGGTCGCTCTGTGGATGAAACATTGCTTATGGTGCTGGCGTTTCCATACACTCAATGTACATGGAAAGTGTGTCCAGTCGGATGGAAGCCTCGCAGCGGTCCCGTTTATGCCAATGTAATGGACGGCAGG
  5   1   2       bld Te2  5g3  in                    IMAGE:7208388.5p                                  GGGCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAAACTAATGGCTGATCCAGCTCAAAGGAGACCAATGATCTTCTGNCATGACGTGCACTGACATCATCACTGTCAAACTGACCTCCCAGCACTTATCCTAATCTATTAAAAGTCTAAGAAAN
  5   1   2      seed Ov1  5g3  in                    IMAGE:8328312.5p                                   GGCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCA
  5   1   2       bld Emb4 5x3               IMAGE:5569840-IMAGp.IMAGp                                    GCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGGACATGGAGAGGTGTGTCCAGCACGATGGAAGCCCGGCAGCAGCATCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAAGAATACTAACGGCTGATCCAGCTCACAAGGA
  5   1   2       bld Te2N 5x3                        IMAGE:7767289.5p                                    GCCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCATGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGGTCAAACTGACACTCCCAGCACTTATTCCTAATCTT
  5   1   2       bld Te2N 5g3  in                    IMAGE:7764660.5p                                     CCGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGNCATGAACGTGCACTGACATCATCACTGTTCCAACTGACACTCCCA
  5   1   2       bld Ov1  5x3                        IMAGE:6316626.5p                                      CGTCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCANGATGGAAGCCCGGCAGCAGCATCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAACGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAATCCCACGAAACAACCAAAgccccccctacggccccccccccgccgccccctcggggggcccctctaaagtatccctccaaggggcccccccc
  5   1   2       bld Te2N 5x3                        IMAGE:7206614.5p                                        TCAGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCNTGCATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAAATCTTATTAAAAAGTCCTAAGaaaaaaaaaaaaaaaaaaaaaaaaaaaGGGCCG
  5   1   2       bld Te2  5x3                        IMAGE:7209718.5p                                          AGGAGGTTTTTGCAGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGNCATGAACGTGCACTGACATCATCACTGTCCNAACTGACACTCCCAGCACTTAT
  5   1   2       bld Egg1 5g                            PBX0121G05.5p                                                       AGTTAATTCGGTCTCTGTAATTCACATCATGGCGTGTCCTGTGCGTGCAGTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTC
  5   1   2       bld Ooc1      in                      xlnoc003k06.5p                                                                                                       GTGAAAACTCACATTGGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATATCGCGGTTTTATTTTTCTACCCGATGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGTCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAA
  3   1   2       bld Te2N 5g3  in                    IMAGE:7764660.3p                                                                                                                      TTGCAAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTTTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGGAAAAAAAAAAAA
  5   1   2       bld Ooc1      in                     Ooc1-db25e03.y1                                                                                                                          AAGCCATCCCCAGCCTTTCAGGCCACCGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCGGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCATGATGGAAG
  3   1   2       bld Ooc3 5g3  in                    IMAGE:3436530.3p                                                                                                                                   CCCAGCCTTCAGTGCACCGCTTTGGTATATGGAGAATTTACGCAGATCCAGCTGTCGGGACTATCTAGGTACATACGTGGTTATATTTTACAACCCGTTGGCATTACCTCTGTCTGCCCCACGGAGATCATTGCATTCAGTAACCCTGCTGAAGACATCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAAATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACGGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGAAA
  3   1   2       bld Tbd7                                 XL107m15.3p                                                                                                                                                    CGCTTTGGTAAATGGAGAATTTAAAGAGATCCAGCTGTCAGACTATTTAGGTAAATACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGCGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAACAGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACGGACACTCCCAGCACTTATTNCTA
  3   1   2       bld Egg6                            IMAGE:4435816.3p                                                                                                                                                                                                           TACGTGGTTTTATTTTTCTACCCGTTGGACTTTACCTTTGTCTGCCCCACGGAGATCATTGCCTTCAGTAACCACGCTGAAGACTTCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGAGCAAGCGATCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAACGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCAATTATTCCTAATCTTAATTAAAAAGTCCTAAGA
  3   1   2       bld Ov1  5g3  in                    IMAGE:8328312.3p                                                                                                                                                                                                                                                                                                TCAAGAAGATCAACTGCCAGCTGATTGCCGTCTCTGTAGATTCCCAATTTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGAAAAAAAAAAAAAAAG
  5   1   2       bld Egg1                            IMAGE:4678903.5p                                                                                                                                                                                                                                                                                                                                                TTACCCACCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGATACTTTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTTCTTTTTATAGGTGCGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCT
  3   1   2       bld Ooc1      in                      xlnoc003k06.3p                                                                                                                                                                                                                                                                                                                                                       CCTTGCATGGACCAAAGTGCCCCGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAACGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAAAAAA
  3   1   2       bld Ooc1      in                     Ooc1-db25e03.x1                                                                                                                                                                                                                                                                                                                                                                             CGTAAAGAAGGAGGTTTGGGGCCTGTTAATATACCCCTGGTGTCTGACCTGACCCATTCTATTGCAAAGGATTACGGTGTCCTGAAAGAAGAGGATGGAGTTGCATACAGAGGCCTCTTCATTATTGATGGGAAAGGGATCCTTCGTCAGATCACTATTAACGACCTTCCTGTTGGTCGCTCTGTGGATGAGACATTGCGTCTGGTGCAGGCGTTCCAATACACCGATGTACATGGAGAGGTGTGTCCAGCAGGATGGAAGCCCGGCAGCAGCACCATTAAGCCCAATGTAAAAGACAGCAAGGAGTTCTTCTCTAAAGAATACTAATGGCTGATCCAGCTCACAAGGAGACCAATGATCTTCTGCAATGAACGTGCACTGACATCATCACTGTCCAAACTGACACTCCCAGCACTTATTCCTAATCTTAATTAAAAAGTCCTAAGAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)