Gurdon Institute Xenopus laevis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xl3.1-XL054a09.5                            8 END     1           2       12                LIM homeobox protein 1b [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2   0.0    0Xl3.1-XL520g11ex.5                         14 PI      76        330      653                Unknown (protein for IMAGE:8889270) [Xenopus tropicalis]
     3   0.0    0Xl3.1-xlk66l19ex.5                         13 PI      95       1578     1824                bromodomain containing protein 2 [Gallus gallus]

 This cluster: approximate FL confidence score = 95%

 1012769529 Xl3.1-xlk77g17ex.3 - 49 ESTs
                                                                       ......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xl3.1-xlk77g17ex.3                 CAACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAGAAACGAGAAAAAAAAGAGAAAAAGAAAAAGAAGTCGGATAAAAAAAAGAGGAAAGAGGATGATGAATGGCGATCTAGCAAATCCAAACCATCCCAAGCCAAAAAATCTTCCAAGAAATCTGGGGGAGGAATTGCTACCAGCA
                                                  Xl3.1-CHK-1012686732                       GAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAGAAACGAGAAAAAAAAGAGAAAAAGAAAAAGAAGTCGGATAAAAAAAAGAGGAAAGAGGATGATGAATGGCGATCTAGCAAATCCAAACCATCCCAAGCCAAAAAATCTTCCAAGAAATCTGGGGGAGGAATTGCTACCAGCAGTACAA
                                                      consensus depths                      2     3     9    12    12    15    14    16    14    16    14    16    14    16    14    16    14    16    16    21    16    21    20    21    20    21    20    21    20    21    20    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    21    22    21    22    21    22    17    22    17    22    17    22    17    22    17    22    17    22    17    22    18    23    18    23    18    23    18    23    17    23    19    24    19    25    17    25    19    25    18    26    18    26    16    26    16    26    15    26    14    25    15    25    13    25    11    23    12    20    11    20    11    19     9    18     9    18     8    17     7    17     8    15     6    15     8    15     7    14     7    14     6    12     7    14     5    14     9    16     9    18    11    17    10    16    12    17    11    17    13    17    13    17    13    17    13    19    13    19    14    19    15    20    16    20    15    20    17    20    18    20    17    22    19    22    18    21    18    21    16    22    17    21    18    21    20    22    20    22    20    22    20    22    19    22    19    22    19    22    19    22    18    21    18    21    17    21    17    21    18    21    20    23    19    22    20    22    19    22    20    22    20    22    20    22    20    22    19    22    18    22    20    22    18    22    19    22    18    22    19    22    18    22    18    22    18    22    17    22    17    22    13    21    14    22    13    22    11    18     8    14     6    11     5    11     3     6     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4     2     4
                                                                   VAR                                                                                                                             GGAGAGGAGAGTGGTAGTTTTTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGATCTACACATCCATGAATTTGTAAAGGACCCCAAGTGTGAAAGTATTAAAGCAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTT
                                                                   SNP                                                                                                                                                                                                                                         ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----G--A----
                                               BLH ATG      99    1014                 
                                               BLH MIN      99     282                 
                                               BLH OVR      99      39                 
                                               CDS MIN      99      25                 
                                               EST CLI      -1      25                 
                                               ORF LNG      99       7                 
  5   1   2       bld Emb1 5g                         IMAGE:6863813.5p GGACGCGTGGGGCAGACAACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTTAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCCAAAATCAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCACGCTGTCCTCATCTTCAATCGGTCTCTGTATCCCAAGCTCCTCCTGAAATTGCCCTACTACAATGCCTCAGTCTGGCCACATTCCTTCCAATTTATTTCCAAATCCCTGG
  5   1   2       bld Brn1      in                    IMAGE:6950632.5p     TCCGGAATTCCCGGGATGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCATTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGANATTCCTAATACTGCTNTCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAATCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCCCAAGCTCTCCTGAAATTGCCTACTACAATGGCTCCAGTCTGGGCACA
  5   1   2       bld DMZ       in                         xl231k14.5p               GACAACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGT
  5   1   2       bld Ga15      in                       XL463e03ex.5p                  TCCGGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCC
  5   1   2       bld Em10      in                    IMAGE:7981514.5p                  CACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAATTCCTAATACTGCTTCAAAATCAAGAGTGTAAAGAACAGTAAGACTCTGGGGCTACCGGTG
  5   1   2       bld FaB       in                    IMAGE:8069720.5p                  AACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGATCTACACATCCATGAATTTGTAAAGGACCCCAAGTGTGAAAGTATTAAAGCAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAAAAAGGCTAGAAACAACTATTACTGGAGTGCTTAGAGTGTATGCAGGACTTCAACACATGTTTACCACTGTTACTCTACACAACCAACGATGATATTGTGCTGATGCCCAAGTCTGAGAGATGTTTCGCGAAAGTGCTCAAAGCCCAGGAGACAAG
  5   1   2       bld Ga15 5g                            XL462i04ex.5p                    CTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGNACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAA
  5   1   2       bld Ga18      in                       xlk77g17ex.5p                     ACTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACNCNCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGNCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAANTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTNNCGGTGGAGTCACCACAGCACACNAAGTACCAGCTGTCTCATCTCAATCGNCTCTGTATC
  5   1   2       bld Ga18      in                       xlk59b10ex.5p                      CTGGAGAGGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACNCNCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGNCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGNNTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGNNNNCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTNTGTNTCCNAGCTCNC
  5   1   2       bld Emb4 5g                         IMAGE:5537118.5p                       GGACGCGTGGGGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAAAAAGTTGCTCAAATGCCCCAGGAGGAACAAGAAATTCCTAATACTGCTTTCCAAATCAAGAGTGGAAAGAAACAGAAGACTTCTGGGCTTACCCGGGGGAGTCCCCACAGCCCACCAAGTACCAGCTGGTCTCATCTCAATCGCCTCTGGATCCAAGCTCCCCCTGAAATGCCTACTAACAGGCTCCGTCTTGGCCCATCCCTTCAATTAATTTCAAAACCCGGGCCCTAAAACCTTGGCCGGCTTCCAAGAAAGGGGTG
  5   1   2       bld DMZ       in                         xl303i04.5p                           GGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGATCTACACATCCATGAATTTGTAAAGGACCCCAAGTGTGAAAGTATTAAAGCAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAA
  5   1   2       bld DMZ       in                         xl302e21.5p                           GGAGAGTGGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGATCTACACATCCATGAATTTGTAAAGGACCCCAAGTGTGAAAGTATTAAAGCAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCA
  5   1   2       bld Emb9      in                    IMAGE:7974010.5p                                GTCCGGATTCCCGGGATTTGTAACGTAGGAAGCTAGCAACGCCCCCTCTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGTAATTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAAAGTGTATGCTGGACTTCAACACCATGTTTACCTTCTGTTATATCTACTACAAACCAACTGATGATATTGTGTTGATCGCCTCTAGTCTGGAGAAGATGTTTCTGCTATAGTTGTCCAAATGCCTCAGGAGAGCTAGAATTCTCTATACTAGCTTCCAAATCAGAGTGTAAAGACTGTATTATTCTGGCTTACGGTGGGTCCATAGCAATCAGTATACTTTCTATTCTTACTCTTTCTACTCCTTAATGCTACATAGCCATCTGCCACCTCATTTCATCCTTATATTCTGTGCTACGATGTCTCGTTCCGGTTTCACTTCAAAAGTGTTCATGTACCTCCCATTTTATTGTGGACTTCTTTC
  5   1   2       bld Emb4 5g                IMAGE:5537118-IMAGp.IMAGp                                  GGTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTC
  5   1   2      seed Ga15 5g                            XL495l20ex.5p                                   GTAGTTTTTGAGGTTTGTAACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGC
  5   1   2       bld Ga12 5g                              XL215c20.5p                                                     AACGTAGGAAGCTAGCAACGCCCCCACTCGGAGTGCGGACGTCCATTCAATCCGTGTCCATCCGCATGGAGGCTGCCGTTAACCCGGCTGTTAAGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGA
  5   1   2       bld Emb1      in                    IMAGE:3401480.5p                                                                                                                    CAGACAACTGGAGAGGAGAGTGGTAGTTTTTGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTTAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACATACCATCTGATGATATTGTGCTGATGGCCCATAGTCTGGAGAAGATGTGTCTACTGAAAGTTGCTCTAATGCTGCCAGATGAGCTAGATATTGCTAATACTGCTTTCCAAATCAAGAGTGTTAAGAACAGTAAGACTTCTGGGCTTACCCGGGGAGTCACGACACCACAC
  5   1   2       bld Emb3      in                    IMAGE:3400048.5p                                                                                                                     AGACAACTGGAGAGGAGAGTGGTAGTTTTTGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGGGGAAGCATCAAGTTTCTTGGCCTTTTAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCANAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTATACTGCTTCAAAATCAAGAGTGAAAGAACAGTAAGACTTCTGGGCTTACCGGTGAGTCACCCAGCACACCAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTG
  5   1   2       chi Emb1                            IMAGE:5155720.5p                                                                                                                       GAAACTGGAGAGGAGAGTGGTAGTTTTTGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGTATGTATCATTCTGTTGCTATTAGTGCTGTAACGGTTTTTAACCATTGGGAAAGGTTTGTTTTAACTTGCTGAACTGAAACATTGTATTTTGCCTTCTGACTCAGTTTCATTATGTCTCTCAAGAGCATTGTGATTCTTTATGCCCGGCCTGATGACAGTTCTGGGTCTGTGACCGTTTTGAGGCATTTTGTGCTGAGTTCTTTTTGGCAGCGTAAAGTGATCTTGTGGCCCTTTTTTCGAGATTGTGTGAACACACTTTATTTCACAATTAACGTTTTTAAGTTGTGGACATAAACATTTAAGCTGAATTCTCATCTTGTGGAATAAGCCTTATAACTGTCAAATAGCAGATATCTCTGCATTTAAGTGATACTGACACTATACAGCTTTTCAAAATATTAGTGTACACAAAAAATTACCTATGGGTCATGTTGACCGTTCTTCACGAATAGGTCTGCTTTTGTAAGTATTTGTTACTAGAAGTTCTTAAGCCTGACTGTTTTTGN
  5   1   2       bld Emb1                            IMAGE:6862725.5p                                                                                                                        AACTGGAGAGGAGAGTGGTAGTTTTTGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGNGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGATTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGGTGTCGTCTGTATTGCCAGGGGGCTACACAACCCTGTTTGCAAAGGAAAAAAGGGGGGTAAAAGCGNAAAG
  5   1   2       bld Ga15                               XL453k06ex.5p                                                                                                                           CTGGAGAGGAGAGTGGTAGTTTTTGAGACCACCTTTGGATCTGAATCATGGCATGATGGGACAGTCTGTAGAAGGCACACCAGGGAAAAGAATCCGTAAGCCATCCCTCCTTTATGAGGACTTTGAAGGCCCCAACATGACATCAAGTGTGTTTCATCAGCTGCCTCAGACAAACCCACCAGCTCCTGAGTTTATCAATCCTAAGAAGCCAGGACGCTCTACTAACCAACTGCAGTACCTACACAAAGCAGTTGTGAAGTCACTGTGGAAGCATCAGTTTTCTTGGCCTTTCAGACAGCCTGTGGATGCAGTTAAACTGGGTTTACCGATCTACACATCCATGAATTTGTAAAGGACCCCAAGTGTGAAAGTATTAAAGCAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGNAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCCTAATCCTGNTCTTAAATC
  5   1   2       bld Ga15      in                       XL406e11ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                  CAACACATACTGATGTCTTGGATTAGAAGTATGAAGGTACTTTAAACTGGACTATCATAAGATTATCAAGCAGCCAATGGACATGGGAACTGTAAAGAAAAGGCTAGAAAACAACTATTACTGGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGG
  5   1   2       bld Ga18      in                      xlk139p24ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGTGCGTTAGAGTGTATGCAGGACTTCAACACCATGTTTACCAACTGTTACATCTACAACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCANNNNNNCACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGNTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGNNNNNNCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGNNAGAAGTGGNCNNCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCANNTTAAGNACTGTNATGGAATCCTGAAAGAGCTTCTCTCAAGAAGCATGCTG
  5   1   2       bld Brn3                            IMAGE:8539145.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CACAAACCAACTGATGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTGCAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAGCATCCATGGACATGAGCACCATCAGAAGAAAATGACAGCAGAGATTCAGGATGCTCAGAGTTGCACTGCTATCGCCTATGTTTCAATTGTACNATACATCTCAGATCTGATGTGG
  5   1   2       bld DMZ                                  xl311m24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACCGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGCTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCNATGGACATGAGCACCATCAAGAAGAAAATGGACAGCA
  5   1   2       bld DMZ                                  xl226a01.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGATATTGTGCTGATGGCCCAAAGTCTGGAGAAGATGTTTCTACAGAAAGTTGCTCAAATGCCCCAGGAGGAGCAAGAAATTCCTAATACTGCTTCCAAAATCAAGAGTGTAAAGAACAGTAAGACTTCTGGGCTTACCGGTGGAGTCACCACAGCACACCAAGTACCAGCTGTCTCATCTCAATCGTCTCTGTATCCAAGCTCTCCTGAATTGCCTACTACAATGCTCAGTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTTGCCGTCTTCACAGACGGTGTCGTCTGTATTGCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACCGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGCTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAA
  3   1   2       bld Ga18      in                      xlk139p24ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTNTGCAGAAANNNNCNNNNTGCCCNGNNGNNNNAANAAATTCCNANNNTGCTTNCNAAATCANNAGNNTNAANNNNCAGTANGNCTTCNNNCTTACNNNTGNANNCACCACAGCANNCCAAGNNNNAGCTNTCTCNTCTNAATCNTCTCTGTANCCANGCTCTCCTGAATTNCCTACTACAATGCTCANTCTGGCACATCCTTCTATTATTTCTAATCCTGTTCTTAAATCCTNNCGNCTTCACAGACGGTGTCGTCTGTATTNCCAGGGGCTACACAACCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACNCCAACCACCACAGATATCATTGCAACTGGCGGAGNCTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTNCCGGAGGGAGAGTGGTCGCCCGATAAAGCCNCCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAANCATGCTGCTTATGCGTGNCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGNNNNANTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTNCAGAGCTTCAGGANCAGCTCCGTGCAGTACATGAGC
  3   1   2       bld Ga18      in                       xlk77g17ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCNGGGCTTNCCGNNGNNNNCNCCACAGNNNNNAANNNCCAGCTGTCTCNTNTCAATCNNCTCTGTATNCAAGCTCTCCTGAATTGCCTACTACAATGCTCANNCTGGCACATCCTTCTATTATTTCTANNCCTGTTCTTAAATCCTTGCCGNCTTCACAGACGGTGTCGTCTGTATTNCCAGGGNCTACACANCCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACNCCACTACNCCAACCNCCNCCGATATCATTGCAACTGGCGGAGNCTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGCTAAAATACTTGCCNGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAANCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTNCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACNNNAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCANCTGGCAGNACTTTCTCAAGCCCCATTTCCAANCCAAAGAAGAANCGAGAAANAA
  3   1   2       bld Brn1      in                    IMAGE:6950632.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCTCTTGAAATTGCCCTACTACCAATGTTCAGTTCTGGGCACATCCTTCTATNATTCTAAATCCGTTTCTAAAATCTTTGCGGTGTCACCAGACGGTGTCATCTGTATTGCCAGGGGCTACACAACATGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTNTGAGACAAAGCGTTCTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCTTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTTAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAAAGAGCTAACAGGCTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCGGGCAG
  3   1   2       bld FaB       in                    IMAGE:8069720.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGAATTGTCGCTAACTAACAATGACTCAGTCTGGCACATCCCTCTAATTATTTCTAATCTCGAGCTCAAATCCTTGCCGTCTTCAACAGACGGTGTCGTCCTGTATAGCCACGGGCTACACAACCTGTTGCAAAGAAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCCACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCGCGATAAAGCCACCAAAAAAAGATCTCTCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCTTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCTTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATTTACGTCTTCTCAGCTGCCACCTTTTGATTCAAAATCGTCTTCAGAGTCTTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTTCAAGGCCCCATTCGAGATAATCTTAAACTTT
  3   1   2       bld DMZ       in                         xl303i04.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGCCAGGGGCTACACAACCTGTTGCNAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAG
  3   1   2       add Ga18      out                       xlk4l04ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATTNCAGGGGCTNNNNANCTNNTGCAANNNAAAAGGGGGTAAAGNGNANGCTGACACCACTACNCCANCCNCCNCCGATATCATTGCANCTGNNGGAGNCTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGCTAAAATACTTNNNNGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGNTCTNCCCAGNCTCNCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCANCTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAANCATGCTGCTTATNCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTNCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACNNNANAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCNNCNNGCAGNACTTTCTCAAGNCCCATTTCCNNNNCAAAGAAGNAACGAGA
  3   1   2       bld DMZ       in                         xl302e21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTGTTGCAAAGAAAAAGGGGGTAAAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGC
  3   1   2       bld Ga15                               XL505e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGAAAAAGGGGGGTAAAGNGNAAAGGNTGACNCCNNTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTNTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGCCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTNTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATT
  3   1   2       bld Em10      in                    IMAGE:7981514.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTAGAAAGGAAAGGGTGACACCACATACTCCAACCACCCACCGGATATCATTAGCAACATGGTGGAGACTTCTCACCCATACAAGATTTTTGAGACAAAGACTGGTATAATACCTGTCCCAGAGGGAGAGTGGTCGCCCGATAAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTCTCAAGGCCCCCATTCCCAAAACCAAAG
  3   1   2       chi Ga18      in                       xlk59b10ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AANNGGGNNAANNNNAAANNCTGNNNNCNNTACGCCANCNCCNNNNGATATCATNNNNNCTGGNGNANNCTNNTCACCCANACAANNNNNGAGACAAANCCTGGNNAAAANNCTNNCNGNAGGNAGAGTGNTNNCCCGATAAANNCACCAAAAAAAGATCTCCNAGNCTCNCAGCAGCATCNAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGANCTTCTCTCAAAGAANNATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGNNNNNNTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACNNNAGNGCTTCAGGAGCAGCTCCGTGCAGTACATGAG
  3   1   2       bld DMZ       in                         xl231k14.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGCGAAAGGCTGACACCACTACGCCAACCACCACAGATATCATTGCAACTGGCGGAGACTTCTCACCCATACAAGCTTCTGAGACAAAGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTCTCAAGGCCCC
  3   1   2       bld Ga15      in                       XL463e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CNGATATCATTGCAACTGGGCGGAGACTTCTCACCCATACAAGCTTNTGAGACAAAGCCTGCTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAG
  3   1   2       bld Ga15      out                      XL506e03ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGCCTGGTAAAATACTTGCCCGGAGGGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTNTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGCCCTTTTTACAAGCCTGTAGATGTATCTGCGNTGGGATTGCATGACTATTATGATNTTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACNATCCTCCAGATCATGATGTTGTGGNTATGGCACNGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCNCCATCTACGTCCTCTCAGCTGCCACCTTCNGATTCAAAATNGTNTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGNAAGAGAGAGNTAACAGACTNGCAGAGCTTCAGGANCAGCTCCGTGCANTACATGAGCAGTTGGCAGCACTTTCTCAAGGCCCCA
  3   1   2       bld Emb9      in                    IMAGE:7974010.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGGTAAAATACTTGCCCAGGAGAGAGAGTGGTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGCGGCAGCGTCAAACATCAAAGAAGAGCAAATTGTGTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAAAAGCATGCTGTTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCTAGTACAATGAGCGAGCTGGCAAAGCC
  3   1   2       bld Ga15      in                       XL472p05ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCGCCCGATAAAGCCACCAAAAAAAGATCTCCCAGACTCGGCAGCAGCATCAAACATCAAAGAAGGGCAAATTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACA
  3   1   2       bld Emb3      in                    IMAGE:3400048.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCAANTTGTCTGAGCAACTTAAGTACTGTAATGGAATCCTGAAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAGAAACGAAAA
  3   1   2       chi Ga18      in                      xlk139n20ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GNGNCTTTTACAAGCCTGTAGATGTATCTGNGCNNNATTGCATGACTATTATGATNTNTAAAGCATCCAATGGACATGAGNACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGNNNNNTTCGCCTTATGTTTTCAAATTGTTACAAATACANNCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGTAAGTCTTCACAAATCTGTTCTNCTTTAGACAATCTCCCCTTTGGCAGGCTGTTTACATACTGTGTTTTTGTGTTTTAGGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGGTATAGTAGTGTAATCCCATAATCTTTTCCAAACTGATGCCATGAAAATAAACCACCTAAAGTTTTTTATATAGTTTTTTTTCCAAAGAAAGAAAACTTGAAGTTTTTATTGGGTTATATTTTGCAATCCAAGAAATGGTACTCTTAAGTAGTTTGGCTAGACTAGCCCTGGTGAACATGCTTCTAAACTCCCCATATAAGATATATATTTAGGACATTAAAAAAACTTGTGTAAGCACCATCAATACATAAATTTTATTTATTTTTTTTGTTTTTTAAACCTTGGCTANCCTATCGCTAAGCACACATTCACACTCAAATGCAGCTATGAGGAAATCAAAGTTCTTTGGGACTTTTACTTTTTTTTGCTTGGTAATTGACTAAGATGTGCCATTTATGNNNTCACTTAAGCTCCGTGCAGTACATGAGCANCTGGCAGNACTTTCTCAAGNCCCNTTTCCAANCCAAAGAAGAAACGAGAAAAAAAA
  5   1   2       chi Ga18      in                      xlk139n20ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGAGCTTCTCTCAAAGAAGCATGCTGCTTATGCGTGGCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGNACGGAAGTTGCAAGTAAGTCTTCACAAATCTGTTCTACTTTAGACAATCTCCCCTTTGGCAGGCTGTTTACATACTGTGTTTTTGTGTTTTAGGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGNNNNNNCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCNGNNNNCAGGAGCAGGTATAGTAGTGTAATCCCATAATCTTTTCCAAACTGATGCCATGAAAATAAACCACCTAAAgttttttatatagttttttttCCAAAGAAAGAAAACTTGAAGNTTTTATTGGGTTATATTTTGCAATCCAAGAAATGGTACTCTTAAGNAGNTTGGCTAGACTAGCCCTGGTGAACATGCTTCTAAACTCCCCAT
  5   1   2       bld Int2                            IMAGE:8530121.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTTTTTACAAGCCTGTAGATGTATCTGCGCTGGGATTGCATGACTATTATGATATTATAAAGCATCCAATGGACATGAGCACCATCAAGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCaaaccaaagaagaaacgagaaaaaaaagagaaaaagaaaaagaagtcggataaaaaaaagaggaaagaGGATGATGAATGGCGATCTAGCAAATCCAAACCATCCCAAGCCAAAAAATCTTCCAAGAAATCTGGGGGAGGAATTGCTACCAGCAGTACATCAGTCCTGCAGTATCTAGAGCAACAGAAACGCTGAGTCTTACTCCTCCCCTCTGTTTGTATGATCGAGAGAGAGGAACANNACATGCTAGATAGAGCGCGTGAGCTGACATACAATGCANGAGAGCTGCGGTGTCTTCATATGCTGACTCTGCAATCATCGAAATGATACTGAACTACTCACGA
  5   1   2       bld Ga15      in                       XL472p05ex.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAAGAAAATGGACAGCAGAGAATTCAAGGATGCTCAAGAGTTTGCAGCTGCTATTCGCCTTATGTTTTCAAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGA
  3   1   2       add Ga15      in                       XL406e11ex.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTTCAAATTGTTACAAATACAATCNTCCAGNTCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTNGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTTGTTGTAAATCCACCATNTACGTCCTCTCAGCTGCCACCTTNNTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCATGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGANCTTCAGGAGCAGCTTCCGTGCAGTACATGAGCAGCNGGCAGCACTT
  3   1   2       bld Emb1      in                    IMAGE:3401480.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TCNAATTGTTACAAATACAATCCTCCAGATCATGATGTTGTGGCTATGGCACGGAAGTTGCAAGATGTGTTTGAGTTCAGTTATGCCAAGATGCCAGATGAACCCCTGGTAGTAAATCCACCATCTACGTCCTCTCAGCTGCCACCTTCTGATTCAAAATCGTCTTCAGAGTCCTCCAGTGAAAGCAGCAGTGAGAGTTCAGATGACAGCGAGAGCTCCGATGACTCTGAGGAAGAGAGAGCTAACAGACTGGCAGAGCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAGAAACGAGAAAAAAAAGAG
  5   1   2       bld FaB                             IMAGE:8072705.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTTCAGGAGCAGCTCCGTGCAGTACATGAGCAGCTGGCAGCACTTTCTCAAGGCCCCATTTCCAAACCAAAGAAGAAACGAGaaaaaaaagagaaaaagaaaaagaagtcggataaaaaaaagaggaaagAGGATGATGAATGGCGATCTAGCAAATCCAAACCATCCCAAGCCAAAAAATCTTCCAAGAAATCTGGGGGAGGAATTGCTACCAGCAGTACAATCAGTCCTGCAGTATCTAAGAGCAACAAGAAAACGCTTAAGTCTTTACCTCCTCCCCCCTCTGTTTTGTATGATTCGGAAGAAGAGGAGGAAAGCAAACCAATGACTTATGATGAGAAGCGGCAGTTGAGCCTGGACATTAACAAACTGCCAGGGGAGAAGCTTGGCCGTGTGGTTCATATCATTCAGTGTCGTGAGCCCTCTTTGCGAGACTCTAATCCTGAAGAGATTGAAATAGACTTTGAGACCCTTAAACCTTCTACTCTGCGAGAACTGGAGAGATACGTGATGTCTTGCCTGAGGAAAAAACCTCGTAAGCCTTATACTCCCCCTAACTCTGTGCTCTCTCCAGCACTTAAGCCAGTGGGGAAAACAAAAGAGGAGATTGCTCTGGAGAAGAAGAGGGAGCTGGAAAAGAGATTGCAGGATGTGAGTGGGCAACTGAACTCTGCAAAGAACCTCCCAAGAACCCCATGACAGGCAGATCGGCCCATAAGTGTCAGTGCCCCGCTCAGTGCTTCAGTTCAGTTCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)